Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection



Similar documents
How To Make A Molecular Encoder And Decoder

EZ Load Molecular Rulers. Catalog Numbers bp bp bp PCR bp kb Precision Mass

GENOTYPING ASSAYS AT ZIRC

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Supporting Information. The G-triplex DNA could function as a new variety of DNA peroxidase

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

Real-Time PCR Vs. Traditional PCR

Taq98 Hot Start 2X Master Mix

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

Introduction To Real Time Quantitative PCR (qpcr)

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

NimbleGen DNA Methylation Microarrays and Services

mircute mirna qpcr Detection Kit (SYBR Green)

Table of Contents. I. Description II. Kit Components III. Storage IV. 1st Strand cdna Synthesis Reaction... 3

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

RT-PCR: Two-Step Protocol

Human serum albumin (HSA) nanoparticles stabilized with. intermolecular disulfide bonds. Supporting Information

TransformAid Bacterial Transformation Kit

DNA Detection. Chapter 13

PrimeSTAR HS DNA Polymerase

Reverse Transcription System

Rakesh N. Veedu a, Birte Vester b & Jesper Wengel a a Nucleic Acid Center, Department of Physics and Chemistry, Southern Denmark, Odense M, Denmark

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

RNA Fragment DeepSeq Library Preparation Protocol

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

First Strand cdna Synthesis

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Essentials of Real Time PCR. About Sequence Detection Chemistries

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

Introduction. Preparation of Template DNA

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Speed Matters - Fast ways from template to result

Technical Manual No Update Date

Validating Microarray Data Using RT 2 Real-Time PCR Products

BacReady TM Multiplex PCR System

HiPer RT-PCR Teaching Kit

Cloning GFP into Mammalian cells

1/12 Dideoxy DNA Sequencing

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Procedures For DNA Sequencing

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation

Application Guide... 2

DNA ligase. ATP (or NAD+)

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

Preparing Samples for Sequencing Genomic DNA

Quantitative Real Time PCR Protocol. Stack Lab

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

HBV Quantitative Real Time PCR Kit

SYBR Green Realtime PCR Master Mix -Plus-

Southern Blot Analysis (from Baker lab, university of Florida)

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

DNA Assembly and Enzymatic Cutting in Solutions: A Gold Nanoparticle Based SERS Detection Strategy

Wide range of high-quality enzymes and proteins for molecular biology

Řekněte si o vzorky zdarma!

RevertAid Premium First Strand cdna Synthesis Kit

FOR REFERENCE PURPOSES

Amplicon Template Preparation and Sequencing

qstar mirna qpcr Detection System

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

Assembly of Restriction Enzyme Digestions

DNA Sequence Analysis

Molecular Cloning, Product Brochure

Fluorescent dyes for use with the

Terra PCR Direct Polymerase Mix User Manual

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System

Stratagene QPCR Mouse Reference Total RNA

Real-time PCR: Understanding C t

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Reconstituting and Diluting Primers and TaqMan Probes

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Chem 405 Biochemistry Lab I Experiment 2 Quantitation of an unknown protein solution.

CompleteⅡ 1st strand cdna Synthesis Kit

ISOLATE II PCR and Gel Kit. Product Manual

Session 5: Restriction Digestion and Making an Agarose Gel. Session 6: Analysis of Results by Gel Electrophoresis

RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) COMPONENTS OF THE KIT

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Updated: July ' End label RNA markers (18mer) and (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.

Phosphate Assay Kit (Colorimetric)

PicoMaxx High Fidelity PCR System

ptune Inducible Vector

Biological Stability and Activity of sirna in Ionic Liquids**

How To Write An Ipa

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

HCS Exercise 1 Dr. Jones Spring Recombinant DNA (Molecular Cloning) exercise:

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

GenScript BloodReady TM Multiplex PCR System

Troubleshooting for PCR and multiplex PCR

Troubleshooting Guide for DNA Electrophoresis

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

Troubleshooting Sequencing Data

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

QIAGEN Multiplex PCR Handbook

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

ZR DNA Sequencing Clean-up Kit

Transcription:

Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supplementary Information Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection Hong-Xin Jiang, Meng-Yao Zhao, Chen-Di Niu, De-Ming Kong*

1. Experimental details 1.1 Materials and reagents 1,1,2,2-tetrakis{4-[(trimethylammonium)butoxy]pheny} tetraphenylethene tetrabromide (QATPE) was kindly provided by professor Dong-Sheng Guo (Nankai University). 1 SYBR Green I was purchased from Keygen Biotech Co. (Nanjing, China). All of the oligonucleotides (Pad-lock, LT, PR, ssdna and dsdna, Table S1) were purchased from Sangon Biotech. Co. Ltd. (Shanghai, China). The concentrations of the oligonucleotides were represented as single-stranded concentrations. Single-stranded concentrations were determined by measuring the absorbance at 26 nm. Molar extinction coefficient was determined using a nearest neighbor approximation (http://www.idtdan.com/analyzer/applications/oligoanalyzer). T4 DNA ligase, Phi29 DNA polymerase, Exonuclease I (Exo I), Exonuclease III (Exo III), restriction endonuclease EcoR I, nicking endonuclease Nb.BbvCl, Taq polymerase, Bst polymerase, deoxyribonucleoside 5 -triphosphate mixture (dntps) and bovine serum albumin (BSA) were obtained from New England Biolabs (Beijing, China). All chemical reagents were of analytical grade and used without further purification. DNAs Sequence (from 5 to 3 ) LT Pad-lock CTCACACGAATTCATCTGAC P-5'-ATTCGTGTGAGAAAACGGAACTGCGTCTAGGCAAAAGTCAGATGA-3' (P=phosphorylation) PR ssdna dsdna TCATCTGAC ATTCGTGTGAGAAAACGGAACTGCGTCTAGGCAAAAGTCA CGACGATGGAATTCTCTTTTGAGAATTCCATCGTCGTTGTT Table S1 The oligonucleotides used in this work

1.2 Preparation of circular RCA template (cpad-lock). A mixture of Pad-lock (2 nm) and LT (6 nm) was prepared in 1 T4 DNA ligase buffer (5 mm Tris HCl, 1 mm MgCl 2 and 1 mm ATP, ph 7.4). To ensure Pad-lock fully hybridized with LT, the mixture was heated to 37 o C and incubated at this temperature for.5 h. Then, 1U T4 DNA ligase was added and the mixture was allowed to incubate at 16 o C for 3 h to ensure that the 5 -phosphate and 3 -hydroxyl ends of Padlock be ligated to form a circular template (cpad-lock). The ligation reaction was terminated by a thermal treatment at 65 o C for 1 min. Next, 1 U Exonuclease I (Exo I) and 1 U Exonuclease III (Exo III) were added and the mixture was incubated at 37 o C for 1 h to digest the leftover single-stranded DNAs and double-stranded DNAs. The prepared circular template (cpad-lock) will be used in subsequent experiments. 1.3 Real-time monitoring of RCA reaction. To above-prepared circular template (cpad-lock) was added 4 µm QATPE, different concentrations of PR,.2 mm dntps, 3 µg/ml BSA, 1 Phi29 buffer (5 mm Tris HCl, 1 mm MgCl 2, 1 mm (NH 4 ) 2 SO 4, ph 7.5) and 2U Phi29 DNA polymerase. The total volume was 35 μl. The RCA reaction was performed at 3 o C in a commercial StepOnePlus TM Real-Time PCR instrument (ABI company, USA) for 5 h. The fluorescence detection channel set for FAM (6-carboxylfluorecein) was used for fluorescence signal collection. The fluorescence signal was collected at intervals of 2 min. 1.4 End-point detection of RCA product When the detection of RCA product was conducted by the end-point mode, 4 µm QATPE was added after RCA reaction instead of before RCA reaction. The final volume was 1 μl. The fluorescence signal was recorded in a SHIMADZU RF- 531PC spectrofluorimeter with 1cm-path-length micro quartz cell (4 μl, Starna

Brand, England). The excitation and emission wavelengths were set at 33 and 475 nm, respectively. 1.5 Gel electrophoresis The RCA reaction mixtures (25 μl total volume) were sufficiently mixed with 2 μm QATPE. Then, 5 μl loading buffer (.25% bromophenol blue,.25% xylene cyanol, 3% glycerol, 1 mm EDTA) was added. The mixtures were loaded onto a 1% agarose gel, and electrophoresis analysis was carried out in TBE buffer (89 mm Tris-boric acid, 2. mm EDTA, ph 8.3) at room temperature. The gel was run at a constant potential of 7 V for 1 h, and was photographed by a Gel Documentation system (Huifuxingye, Beijing, China). 1.6 AFM imaging Freshly cleaved mica was soaked in 1 mm MgCl 2 for five minute, then dried with N 2. The samples were diluted 1-fold in deionized H 2 O and 5 µl was applied to the mica for 3 seconds, rinsed with dh 2 O and dried with N 2 again. The samples were imaged in tapping mode with a Digital Instruments scanning probe microscope (Dimension 31) with Nanoscope IIIa controller hardware. 1.7 T4 DNA ligase-sensing based on real-time RCA. Circular RCA template was prepared as above but different concentrations of T4 DNA ligase were added. Then, 4 µm QATPE, 1 nm PR,.2 mm dntps, 3 µg/ml BSA, 1 Phi29 buffer and 2U Phi29 DNA polymerase were added. RCA reaction was conducted performed at 3 o C in the StepOnePlus TM Real-Time PCR instrument for 5 h, and fluorescence signal change of QATPE was recorded as a function of reaction time. T4 DNA ligase activity was determined by three ways using fluorescence signal at designated time, initial reaction rate, or the data processing method provided by the commercial real-time PCR instrument, respectively.

2. Different discriminating abilities of QATPE and SG I towards ssdna and dsdna (a) 4 Fluorenscence (a.u.) 3 2 1 dsdna ssdna 35 4 45 5 55 6 Wavelength (nm) (b) dsdna 4 ssdna Fluorenscence (a.u.) 3 2 1 52 54 56 58 6 Wavelength (nm) Figure. S1 Fluorescence emission spectra of (a) QATPE and (b) SG I in the presence of ssdna or dsdna. 3. Fluorescence response rate of QATPE to single-stranded DNA product of RCA 2 15 1 5 QATPE addition 2 15 1 5 6s 9 95 1 15 11 115 12 Time (s) 5 1 15 2 25 3 35 4 Time (s) Figure. S2 Fluorescence signal change with time after mixing of QATPE with RCA product. [PR] =1 nm. [QATPE] = 4 nm.

4. Real-time monitoring of RCA reactions containing deferent concentrations of primer. Figure S3 Time-dependent fluorescence changes of the RCA reaction solutions containing different concentrations of PR. All experiments were performed in triplicate. 5. End-point detection of T4 DNA ligase activity using the experimental results at different time points. (a) 35 3 25 2 15 1 5 2 min (b) 35 3 25 2 15 1 5 25 min..2.4.6.8 1. T4 DNA ligase activity (U/ L)..2.4.6.8 1. T4 DNA ligase activity (U/ L)

(c) 35 3 25 2 15 1 5 3 min..2.4.6.8 1. T4 DNA ligase activity (U/ L) (d) Normalized fluorescence (a.u.) 1..8.6.4.2. 2 min 25 min 3 min..2.4.6.8 1. T4 DNA ligase activity (U/ L) Figure S4 fluorescence signal change at 2 min (a), 25 min (b) or 25 min (c) as a function of T4 DNA ligase activity; (d) Normalized fluorescence signal changes at the three time points as a function of T4 DNA ligase activity. 6. Selectivity of T4 DNA ligase sensor 3 25 2 15 1 5 T4 DNA ligase T4 PNKP; EcoR I; Nb.BbvC1 Taq polymerase; Bst polymerase Heat-inactived T4 DNA ligase 5 1 15 2 25 3 Time (min) Figure. S5 Fluorescence responses of the proposed T4 DNA ligase sensor to T4 DNA ligase and other enzymes. [T4 DNA ligase] =.1 U/μL; [T4 PNKP] = [EcoR I] = [Nb.BbvCl] = [Taq polymerase] = [Bst polymerase] =.1 U/μL. Heat-inactived T4 DNA ligase was prepared by heating the enzyme at 95 o C for 1 min. All experiments were performed in triplicate. References 1 B. P. Jiang, D.S. Guo, Y. C. Liu, K. P. Wang, Y. Liu, ACS Nano. 214, 8, 169-1618.