RNA Fragment DeepSeq Library Preparation Protocol
|
|
|
- Amice Harper
- 9 years ago
- Views:
Transcription
1 RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor and keep on ice 2. Add the following to a PCR tube on ice: 7 um App Adaptor 1.0 µl RNA x µl Water to 4.8 µl 3. Heat 65 C 10 min; 4 C hold 4. Transfer tubes to ice. Add the following to each tube for a total reaction volume of 15 µl: 1X rxn note minimize pipetting error by 10X Buffer (from NEB) 1.5 µl preparing a ligation mastermix 50% PEG µl 33 mm DTT 0.45 µl T4RNL2 Tr. K227Q 0.75 µl Total Volume added 10.2 ul 5. Incubate 30 C for 6 hr; 65 C 20 min heat inactivation; 4 C hold II) REVERSE TRANSCRIPTION 1. Thaw RT Primer, 10 mm dntp mix, 5X First-Strand Buffer w/o MgCl2 (see recipe below), 100 mm DTT; store on ice 2. Add to 15 µl ligation on ice, same tube: 10 um RT Primer 1.0 µl 10 mm dntp mix 2.25 µl Water 14.3 µl 3. Incubate 65 C 5 min; 4 C hold 4. Transfer to ice and add the following to each tube for a total reaction volume of 45 µl: 5X FS Buffer w/o MgCl µl 100 mm DTT 2.25 µl SSIII (200U/µl) 1.2 µl 5. Incubate 55 C min; heat inactivate 70 C 15 min; 4 C hold 6. Add 25 µl 2X Denaturing Load Buffer (see recipe below) 7. Gel purify RT product on 10% denaturing PAGE 8. Cut RT product from gel, using a new razor blade for each sample 9. Crush gel fragment: place in a 0.5 ml eppy sitting inside a 2 ml eppy, having previously poked a 22 gauge needle hole in the bottom of the 0.5 ml eppy; spin 10,000xg for 3 min at RT to crush
2 10. Elute in DNA Elution Buffer (see recipe below) O/N at 37 C with constant rotation (add enough volume so that the gel fragments are free to move in the tube) 11. Transfer slurry to Spin-X Column and spin at 10,000xg for 3 min, RT 12. Concentrate eluate, either by SpeedVac or butanol extraction 13. Ethanol precipitate. Note: if the RT fragments are < 100 nts, you might improve precipitation efficiency by adding MgCl 2 to a final concentration of 10 mm before adding ethanol III) CIRCULARIZATION 1. Thaw CircLigase I Reaction Buffer, 1 mm ATP, 50 mm MnCl 2; 5M Betaine 4 C 2. Spin down RT product at 12,000xg, 4 C, 30 min 3. Wash with 1 ml 75% EtOH (stored at -20 C) 4. Repeat spin for 10 min 5. Remove as much EtOH as possible; heat pellet at 37 C for 3-5 min to dry pellet 6. Resuspend DNA in 10 µl water; 7. Transfer DNA to PCR tube and prepare 20 µl Circularization Reaction: RT Product 10.0 µl CircLigaseI Rxn Buffer 2.0 µl 1 mm ATP 1.0 µl 50 mm MnCl µl 5M Betaine 4.0 µl Water 1.0 µl CircLigase 1.0 µl 8. Incubate 60 C 3-4 hr; inactivate 80 C 10 min IV) PCR AMPLIFICATION 1. Thaw phosphorothioate PE1.0 and PE2.0 primers and KAPA 2X HiFi; store on ice once thawed 2. To determine the appropriate number of PCR cycles, prepare several small-scale reactions with phosphorothioate primers: KAPA 2x HiFi 7.5 µl Denaturation: C 10 um PE 1.0 phos 0.75 µl Cycling: C 10 um PE 2.0 phos 0.75 µl C Circularization Rxn up to 3 µl C Water to 15 µl Final Extension: 1 72 C 3. Analyze on normal length 8% nondenaturing PAGE to determine the optimal number of PCR cycles, ensuring that primers show no depletion (i.e. are still abundant in the rxn) 4. Repeat with a 50 µl PCR for fixed cycle number (determined in steps 2-3): KAPA 2x HiFi 25 µl 10 um PE µl 10 um PE µl Circularization Rxn 3.3*volume used in test Water to 50 µl
3 5. Purify PCR fragment on 8% nondenaturing PAGE run on double-wide apparatus to minimize heating and denaturation of double stranded library. Alternatively, replace steps 5-8 with purification on Pippin Prep/BluePippin 6. Stain gel in SYBR Gold, excise product band, crush as in II Step 8 7. Elute by nutating O/N in DNA Elution Buffer (see recipe below); the following morning, remove some buffer and keep on ice; add back an equal volume of DNA Elution Buffer for 2-4 more hours to elute as much material as possible from the gel fragments 8. Concentrate the eluate by SpeedVac or butanol extraction 9. Ethanol precipitate 10. Spin down libraries at 12,000 x g for 30 min, 4 C. Wash 2x 75% EtOH. Remove as much EtOH as possible by pipetting and immediately resuspend pellet in 20 µl ddh Quantify library by submitting 2 µl for Bioanalyzer analysis on High Sensitivity DNA Chip 12. Pool libraries (if necessary) to a final concentration of 10 nm (usually submit at least 15 µl). If necessary, SpeedVac samples on low setting, 3 min increments, to concentrate the libraries GENERAL NOTES: 1. The inclusion of 4 degenerate bases (NNNN) at the beginning of the 5' adaptor allows us to determine if a sequence was captured multiple times or over-amplified during PCR. However, this benefit of NNNN only applies if your sequence read is longer than your RNA insert length, meaning you will read through to these bases. If you want the benefit of NNNN but are using a short sequencing run, move the NNNN to the RT primer, between the PE1.0 sequence and the barcode. The first 4 bases of the sequencing reaction will be the degenerate bases, then the 5 nt barcode, then GG, then your sample. Ex. BC1: 5' - pggatcacnnnnagatcggaagagcgtcgtgtagggaaagagtgt-sp18-2. In an attempt to keep the sample free from contaminants, all pipetting should be done with filter tips (use low retention when possible, especially for handling viscous solutions like PEG8000) 3. The RT is done with a buffer lacking additional MgCl 2, since a 3-fold dilution of the ligation buffer yields MgCl 2 concentration optimal for SSIII 4. All primers should be gel purified or HPLC purified 5. IMPORTANT: CircLigase circularization efficiency can change depending on the lot (also see Epicentre's CircLigase patent #WO A1; Jendrisak, Decker and Dahl). 1Therefore, every tube of CircLigase should be checked for circularization efficiency before use in library preparation. To do this, perform an RT with N24 RNA and 32 P dctp, gel purify the RT product and test circularization on a gel. 6. If you're having trouble with these reactions, your primers may not be fully 5' phosphorylated. A few other labs have occasionally run into this issue. If this is a problem, 5' phosphorylate with T4 PNK prior to use, ensuring both the RT primer and the 3' adaptor (before Mth Ligase preadenylation that requires 5' P; if manually pre-adenylating) are fully 5' phosphorylated. 7. Depending on the amount of RNA input, your RT product may not be visible with SYBR Gold staining. It is advisable to use a guide oligo in a separate ligation/rt reaction to indicate where to cut on the gel.
4 PURCHASED REAGENTS: Published in Heyer EE, et al. NAR 2014; doi: /nar/gku1235 T4 RNA Ligase 2, truncated K227Q NEB #M0351L (PEG8000 currently comes with the enzyme) Superscript III Reverse Transcriptase Invitrogen # CircLigase ssdna Ligase Epicentre Biotechnologies #CL4115K 5M Betaine Sigma #B0300-5VL KAPA HiFi Library Amplification Kit KAPA Biosystems #KK2611 or #KK2612 PREPARED REAGENTS: 5X First-Strand Buffer w/o MgCl mm Tris-HCl (ph 8.3 at room temp), 375 mm KCl DNA Elution Buffer (TE) 10 mm Tris-HCl (ph 8.0 at room temp), 1 mm EDTA 2X Denaturing Load Buffer 2 ml 5X TBE, 1.2 g Ficoll Type 400, 4.2 g Urea, 2 mg bromophenol blue, 2 mg xylene cyanol, up to 10 ml ddh20; store at 4 C - heat to get into solution or nutate O/N - add dyes after adjusting the volume to 10 ml OLIGOS: Preadenylated Adaptor for SE Sequencing: 5' AppTGGAATTCTCGGGTGCCAAGGddC 3' (mircat-33 Conversion Kit from IDT) or 5' AppNNNNTGGAATTCTCGGGTGCCAAGGddC 3' (order 5' phosphorylated; preadenylate with NEB 5' DNA Adenylation Kit - E2610; gel purify) RT Primers (barcodes based upon TruSeq barcodes for Illumina sequencing) for SE Sequencing: NOTE: the barcodes used in Heyer et al. Nucleic Acids Research 2014; doi: /nar/gku1235 are the reverse of those used below due to an initial ordering mistake. The sequences below should be used, as the first few sequenced nucleotides are more base-balanced. BC1: 5' - pggcactaagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC2: 5' - pgggtagcagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC3: 5' - pggtcgatagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC4: 5' - pggcctcgagatcggaagagcgtcgtgtagggaaagagtgt-sp18-
5 BC5: 5' - pggtgacaagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC6: 5' - pggtagacagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC7: 5' - pgggccctagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC8: 5' - pggatcggagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC9: 5' - pggactgaagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC10: 5' - pggtgttcagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC11: 5' - pggtaagtagatcggaagagcgtcgtgtagggaaagagtgt-sp18- BC12: 5' - pggagatgagatcggaagagcgtcgtgtagggaaagagtgt-sp18- PCR Primers (PE DNA from Illumina): PE PCR Primer 1.0: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3' PE PCR Primer 2.0: 5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T 3' * indicates location of phosphorothioate bond
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
How To Write An Ipa
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
RNA Isolation for Frozen Mouse Livers and Reverse Transcription
RNA Isolation for Frozen Mouse Livers and Reverse Transcription I. Introduction RNA is typically isolated from tissue or cells based on the procedure originally described by Chomczynski and Sacchi in 1987.
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
Illumina TruSeq DNA Adapters De-Mystified James Schiemer
1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
Amplicon Template Preparation and Sequencing
Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing
Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing PAGE electrophoresis Polyacrylamide gel electrophoresis (PAGE) is used for separating
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Detailed protocol: Combined method for RNA isolation. from cartilage
Detailed protocol: Combined method for RNA isolation from cartilage REAGENTS - chloroform - DNase (RNase-free DNase Set, cat.no. 79254, Qiagen, Hilden, Germany) - 80 % Ethanol (in DEPC-treated water) -
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100
Sanger Sequencing: Sample Preparation Guide
Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation
BUFFERS and MEDIAS Coomassie Blue Staining Solution Coomassie blue Destaining Solution DMEM Normal Cell Culture Media
BUFFERS and MEDIAS Coomassie Blue Staining Solution 2 g Coomassie Blue 2 L Methanol or Ethanol * 1.6 L 400 ml Glacial acetic acid *If you will be microwaving the gel in staining solution for rapid staining
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
Paired-End Sample Preparation Guide
Paired-End Sample Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Sample Prep Workflow 4 Best Practices 5 DNA Input Recommendations 7 Kit Contents 9 Consumables and Equipment 11 Fragment DNA 13
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
An In-Gel Digestion Protocol
An In-Gel Digestion Protocol This protocol describes the digestion of a protein present in an SDS-PAGE gel band with trypsin. The band can be taken from either a 1D or 2D electrophoresis gel. Reagents
Procedure for RNA isolation from human muscle or fat
Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe
Sequencing Library qpcr Quantification Guide
Sequencing Library qpcr Quantification Guide FOR RESEARCH USE ONLY Introduction 3 Quantification Workflow 4 Best Practices 5 Consumables and Equipment 6 Select Control Template 8 Dilute qpcr Control Template
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
ELUTION OF DNA FROM AGAROSE GELS
ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supplementary Information Real-time monitoring of rolling circle amplification using aggregation-induced
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
MMLV High Performance Reverse Transcriptase
MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Cluster Generation. Module 2: Overview
Cluster Generation Module 2: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Cluster Generation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule
RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) COMPONENTS OF THE KIT
3 RevertAid First Strand cdna Synthesis Kit (#K1621 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The RevertAid fi rst strand cdna synthesis kit
2D gel electrophoresis
2D gel electrophoresis Required solutions Cathode buffer: TRIS 7.6g Glycine 36g SDS 2.5g Fill up with ddwater to 250ml ESS (equilibration stock solution) SDS 2g Urea 36g EDTA 3mg 50 mm TRIS-HCl ph 6.8
Preparing Samples for Sequencing Genomic DNA
Preparing Samples for Sequencing Genomic DNA FOR RESEARCH ONLY Topics 3 Introduction 5 Kit Contents and Equipment Checklist 7 Fragment the Genomic DNA 11 Perform End Repair 12 Add A Bases to the 3' End
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems
USER GUIDE Encore PART NOS. 8041 and 8042 SP Rapid Library Systems Patents, Licensing and Trademarks 2012 2013 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of
DNA SEQUENCING (using an ABI automated sequencer)
DNA SEQUENCING (using an ABI automated sequencer) OBTECTIVE: To label and separate DNA fragments varying by single nucleotides, in order to determine the sequence of nucleotides. INTRODUCTION: Determination
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
Arcturus PicoPure RNA Isolation Kit. User Guide
Arcturus PicoPure RNA Isolation Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
Protein Precipitation Protocols
Protein Precipitation Protocols Notes: All reagents need to high purity/hplc quality. All tubes used should be new or hand cleaned thoroughly with Micro90 detergent. High quality water needs to be used
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
MinElute Handbook. Sample & Assay Technologies. March 2008
March 2008 MinElute Handbook MinElute PCR Purification Kit For purification of PCR products (70 bp to 4 kb) in low elution volumes MinElute Gel Extraction Kit For gel extraction of DNA fragments (70 bp
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
Western Blot Protocol (updated on 05/20/14)
Western Blot Protocol (updated on 05/20/14) Required Solutions 10x PBS (1L) 80 g NaCl 2 g KCl 14.4 g Na 2 HPO 4 or 22 g Na 2 HPO 4 7H 2 O 2.4 g KH 2 PO 4 or 2 g KH 2 PO4 Adjust ph to 7.4 Autoclave PBST
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit
USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Rakesh N. Veedu a, Birte Vester b & Jesper Wengel a a Nucleic Acid Center, Department of Physics and Chemistry, Southern Denmark, Odense M, Denmark
This article was downloaded by: [UQ Library] On: 17 August 2011, At: 19:56 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
How To Get Rid Of Small Dna Fragments
AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique
