Nonribosomal Peptide Synthesis and Toxigenicity of Cyanobacteria

Transcription

1 JOURNAL OF BACTERIOLOGY, July 1999, p Vol. 181, No /99/$ Copyright 1999, American Society for Microbiology. All Rights Reserved. Nonribosomal Peptide Synthesis and Toxigenicity of Cyanobacteria BRETT A. NEILAN, 1,2 * ELKE DITTMANN, 2 LEO ROUHIAINEN, 3 R. AMANDA BASS, 1 VERENA SCHAUB, 2 KAARINA SIVONEN, 3 AND THOMAS BÖRNER 2 School of Microbiology and Immunology, The University of New South Wales, Sydney 2052, New South Wales, Australia 1 ; Institute for Biology (Genetics), Humboldt University of Berlin, D Berlin, Germany 2 ; and Department of Applied Chemistry and Microbiology, University of Helsinki, FIN Helsinki, Finland 3 Received 14 December 1998/Accepted 21 April 1999 Nonribosomal peptide synthesis is achieved in prokaryotes and lower eukaryotes by the thiotemplate function of large, modular enzyme complexes known collectively as peptide synthetases. These and other multifunctional enzyme complexes, such as polyketide synthases, are of interest due to their use in unnatural-product or combinatorial biosynthesis (R. McDaniel, S. Ebert-Khosla, D. A. Hopwood, and C. Khosla, Science 262: , 1993; T. Stachelhaus, A. Schneider, and M. A. Marahiel, Science 269:69 72, 1995). Most nonribosomal peptides from microorganisms are classified as secondary metabolites; that is, they rarely have a role in primary metabolism, growth, or reproduction but have evolved to somehow benefit the producing organisms. Cyanobacteria produce a myriad array of secondary metabolites, including alkaloids, polyketides, and nonribosomal peptides, some of which are potent toxins. This paper addresses the molecular genetic basis of nonribosomal peptide synthesis in diverse species of cyanobacteria. Amplification of peptide synthetase genes was achieved by use of degenerate primers directed to conserved functional motifs of these modular enzyme complexes. Specific detection of the gene cluster encoding the biosynthetic pathway of the cyanobacterial toxin microcystin was shown for both cultured and uncultured samples. Blot hybridizations, DNA amplifications, sequencing, and evolutionary analysis revealed a broad distribution of peptide synthetase gene orthologues in cyanobacteria. The results demonstrate a molecular approach to assessing preexpression microbial functional diversity in uncultured cyanobacteria. The nonribosomal peptide biosynthetic pathways detected may lead to the discovery and engineering of novel antibiotics, immunosuppressants, or antiviral agents. * Corresponding author. Mailing address: School of Microbiology and Immunology, The University of New South Wales, Sydney 2052, NSW, Australia. Phone: Fax: [email protected]. Not all proteins are synthesized on the ribosome. Small polypeptides, with fewer than about 50 amino acids, can be assembled by peptide synthetases just as other compounds, such as fatty acids, are linked by other synthases. The products of microbial nonribosomal peptide synthesis include the immunosuppressant cyclosporine and antibiotics such as gramicidin S, tyrocidin A, and surfactins (for a review, see reference 13). A modular structure of peptide synthetases has been shown to be responsible for the sequential and amino-acidspecific elongation of peptide chains (17). The specific combination of modules and various functional domains within the peptide synthetase determines the structure and hence the activity of the peptide product. The Cyanobacteria, as determined on the basis of several molecular phylogenies, comprise a single and coherent group of prokaryotes (35). Commonly, these bacteria proliferate in eutrophic marine and freshwater habitats, resulting in the formation of water blooms. Cyanobacteria represent a relatively unexplored and potentially rich source of bioactive secondary metabolites (6, 20, 21). Of these bioactive compounds, the toxins produced by certain planktonic species of cyanobacteria have been particularly well studied. These oxygenic phototrophs are the only known producers of the hepatotoxic microcystins, and several morphologically and physiologically diverse genera have been shown to synthesize these compounds (11, 14, 30). Microcystins are cyclic heptapeptides (Fig. 1A). Sixty-five isoforms of these compounds which vary by degree of methylation, hydroxylation, epimerization, peptide sequence, and toxicity have been identified (26, 29). These peptides are potent inhibitors of eukaryotic protein phosphatases type 1 and 2A, with inhibition being dependent on particular structural variations (1), including the substitution of two variable L-amino acids and the methylation of aspartate ( -iso-asp) and dehydroalanine (Fig. 1A). The modified -amino acid (Adda in Fig. 1A), which is also found in the hepatotoxic pentapeptides nodularin and motuporin, is conserved in all known toxic microcystins. Microcystins and related cyclic peptides are carried into hepatocytes via the bile acid transport system, where hyperphosphorylation of microfilaments, including cytokeratins, is the primary toxic effect (33). Microcystins may also activate phospholipase A 2 and cyclooxygenase in hepatocytes, while in macrophages they induce tumor necrosis factor alpha and interleukin 1. These functions, together with hyperphosphorylation of DNA, have implicated microcystins as agents promoting hepatocellular carcinoma (8). Like other small peptides which contain unusual amino acids, microcystins are synthesized nonribosomally (2, 4). We have recently identified peptide synthetase genes in cyanobacteria of the genera Microcystis and Anabaena (3, 19). The characteristic modular structure of the peptide synthetase genes and particular conserved sequence motifs seen in other bacteria and fungi were also found in these cyanobacterial genes (Fig. 1B) (3). The insertional inactivation of a peptide synthetase gene from the hepatotoxic strain Microcystis aeruginosa PCC7806 resulted in transformation to the nontoxic state and a loss of microcystins, demonstrating that this gene, called mcyb, encodes a microcystin synthetase (4). To date, peptide synthetase genes have been isolated from two cyanobacterial species, while a microcystin synthetase gene 4089

2 4090 NEILAN ET AL. J. BACTERIOL. FIG. 1. (A) General structure of microcystins, cyanobacterial heptapeptide hepatotoxins, showing the most frequently found variations. X and Z, variable L-amino acids L-leucine and L-arginine, respectively; R 1 and R 2, H (demethylmicrocystins) and CH 3, respectively; D-MeAsp, D-erythro- -methylaspartic acid; Adda, (2S,3S,8S,9S)-3-amino-9-methoxy-2,6,8-trimethyl-10-phenyldeca-4,6-dienoic acid; Mdha, N-methyldehydroalanine (Dha, dehydroalanine). (B) Diagram depicting the gene encoding a single peptide synthetase module. The functional domains of a type I peptide synthetase module include condensation (shaded box), amino-acidspecific acyladenylation (open box), thioesterification (hatching), and possibly epimerization (cross-hatching). A type II module would contain an N-methyltransferase domain between the acyladenylation and thioesterification regions. Peptide synthase conserved motifs (13) are shown as roman numerals (I to VI) (for a more detailed description of functional domains in peptide synthetases, see reference 17). Arrows indicate the relative positions of degenerate cyanobacterial PS-PCR primers (at motifs I and V; MTR2) and MS-PCR primers. has been isolated from only one of several microcystin-producing genera. The present study describes the detection and characterization of microcystin and peptide synthetase genes in a genetically diverse range of microcystin-producing and nontoxic cyanobacterial species. Oligonucleotide primers which amplify DNA from both the conserved sequence motifs of peptide synthetase genes and specific sequences of microcystin synthetase genes in cyanobacteria were designed (Table 1). These PCR products were used as hybridization probes and/or directly sequenced. Correlations were made between the presence of peptide synthetase genes and the production of microcystins by hepatotoxic cyanobacteria. The data presented provide initial indications of the distribution of microcystin synthetase and other peptide synthetase genes in the phylum Cyanobacteria and the possible mechanism underlying their transmission. In addition, these gene-targeting procedures enable the isolation and characterization of sequences from novel peptide synthetase modules with potentially diverse biosynthetic activities. Isolation and culturing of the many microorganisms which may produce nonribosomal peptides are not required. TABLE 1. Peptide synthetase gene consensus and specific PCR primers Primer (annealing) temp Degeneracy (fold) T m ( C) Product (bp) Oligonucleotide primer sequence, from 5 33 (conserved peptide motif) PS-PCR (52 C) MTF ,000 GCNGG(C/T)GG(C/T)GCNTA(C/T)GTNCC(AGGAYVP, core motif I) MTR ,000 CCNCG(AGT)AT(TC)TTNAC(T/C)TG(QVKIRG, core motif V) MS-PCR (50 C) FAA CTATGTTATTTATACATCAGG RAA CTCAGCTTAACTTGATTATC

3 VOL. 181, 1999 NONRIBOSOMAL PEPTIDE SYNTHESIS OF CYANOBACTERIA 4091 MATERIALS AND METHODS Cyanobacterial strains and culturing. Cyanobacterial strains with the designations AWT, HUB, NIES, PCC, and UNSW were obtained from the culture collections of Australian Water Technologies (AWT; Sydney, Australia), Humboldt University (HUB; Berlin, Germany), the National Institute for Environmental Studies (NIES; Tsukuba, Japan), the Institut Pasteur (PCC; Paris, France), and The University of New South Wales (UNSW; Sydney, Australia), respectively (Table 2). The remaining strains were from a culture collection of one of the authors (K. Sivonen, University of Helsinki). Strains were grown in JM, BG-11, or Z8 (Helsinki strains only) medium at 20 2 C and under continuous illumination of 25 mmol/m 2 /s as detailed earlier (16, 25). Nitrogenfixing species were grown in nitrogen-free medium (25), and Nodularia species were grown in salt-containing medium (16). Strains obtained from culture collections were axenic. Measurement of strain toxicity and chemical analyses of microcystins. Detection of microcystins by mouse bioassay, high-pressure liquid chromatography (HPLC), commercially available enzyme-linked immunosorbent assay (ELISA) (EnviroGard Microcystins Plate Kit; Strategic Diagnostics), and protein phosphatase inhibition was performed according to previously published procedures. Briefly, the mouse bioassay was performed by intraperitoneal injection of aqueous cell suspensions, measurement of the 50% lethal dose, and histological observation of hepatic hemorrhage (5). For HPLC analyses, microcystin was extracted from a log-phase culture with methanol. Unquantified measurement of microcystin content was performed with a LiChroCART RP18 column (15). Protein phosphatase type 2A inhibition activity was determined with frozenthawed cell extracts and standardized for total protein and dry cell mass (1, 4). For many of the strains listed in Table 2, at least one microcystin has been isolated and the structure has been identified (26, 29). DNA extraction, amplification, sequencing, and probe hybridization. Total genomic DNA was extracted by standard methods commonly used for cyanobacteria and plants (10, 22). Alternatively, a PCR template was prepared by rapid cell lysis in the presence of a cation-exchange resin and nonionic detergents (24). PCR annealing step temperatures are shown in Table 1 along with peptide synthetase gene-directed oligonucleotide primer sequences. In capillary or 200- l tubes, the PCR thermal cycling protocol included an initial denaturation at 94 C for 2 min, followed by 35 cycles at 93 C for 10 s, at the annealing temperature (Table 1) for 20 s, and at 72 C for 1 min. Amplification reaction components were as previously described (23), and incubations were performed with an FTS-1S capillary thermocycler (Corbett Research, Sydney, Australia) or a PE2400 apparatus (Perkin-Elmer Cetus Corporation, Emeryville, Calif.). Amplified DNA was purified from surplus reaction components and sequenced directly by standard automated fluorescence techniques (19, 23). Larger, contiguous fragments of the M. aeruginosa PCC7806 and M. aeruginosa HUB524 microcystin synthetase genes (accession no. U97078 and Z28338, respectively) were also isolated from phage and plasmid gene libraries by PCR probe hybridization. A method of semidegenerate, long PCR was developed to extend sequence information flanking that obtained from the gene libraries. This procedure used the highly redundant primers MTF2 and MTR (Table 1) directed to the conserved motifs of known peptide synthetase genes combined with primers specific for the Microcystis genome (19). By modifying and using long- PCR protocols, we found it possible to amplify regions of DNA encoding entire modules of the synthetase. In this way, sequences flanking the known microcystin synthetase gene could be extended to unknown conserved regions of the peptide synthetase gene. This method is termed module jumping. Sequencing of these PCR fragments was performed with 100 pmol of the degenerate primer and automated protocols. DNA sequences of the peptide and microcystin synthetase genes were aligned with the program Pileup (Genetics Computer Group) and the multiple-sequence-alignment tool Clustal W. Manual confirmation of the sequence alignment was also performed. Phylogenetic analyses are described in the corresponding figure legends. Cyanobacterial genomic DNA (about 100 ng) was dot blotted onto nylon membranes (Hybond N ; Amersham, Little Chalfont, United Kingdom) by a previously described protocol (27). A 2.0-kb clone and a 2.4-kb clone corresponding to different modules of a peptide synthetase gene from Anabaena sp. strain 90, as well as a 1.15-kb amplified clone of the mcyb gene of strain HUB524 (4), were used as probes. Probe labeling, DNA hybridization, which was performed at 60 C, and membrane washing were done by standard procedures (27). RESULTS AND DISCUSSION Detection of peptide synthetase genes by dot blot hybridization. In order to compare the distributions of two peptide synthetase genes derived from M. aeruginosa HUB524 (mcyb) (4) and Anabaena sp. strain 90, DNAs from hepatotoxic, neurotoxic, and nontoxic strains belonging to various species of Anabaena, Nostoc, Microcystis, Nodularia, Oscillatoria, and Aphanizomenon were simultaneously probed in dot blot experiments (Fig. 2A). The mcyb fragment recently identified as a microcystin synthetase gene was shown to hybridize, with variable signal intensity, to DNAs from all hepatotoxic strains and to DNAs from three nontoxic strains (Microcystis sp. strain 130, Aphanizomenon sp. strain 202, and Oscillatoria sp. strain 2) (Table 2 and Fig. 2B). This probe did not hybridize to DNAs from neurotoxic strains and other nontoxic strains (Table 2). The two Anabaena sp. strain 90 peptide synthetase gene fragments gave strong signals with all hepatotoxic Anabaena strains but showed insignificant hybridization to most other microcystin-producing species (Fig. 2C). These probes did, however, cross-hybridize to Nostoc sp. strain 152, Nodularia sp. strain HEM, nontoxic Anabaena sp. strain 299 (data not shown), and (weakly) Nodularia sp. strain NSOR12. Therefore, we have evidence for two distinct peptide synthetase genes showing different distributions among the cyanobacterial strains tested. These results reflect the observation that nonribosomal peptide and microcystin contents vary among cyanobacterial species (26). The mcyb hybridization data revealed the presence of similar genes across all genera investigated. It remains to be determined whether all positive hybridization signals corresponded to microcystin synthetase genes. To obtain more detailed information on the distribution of peptide synthetase genes among toxic and bloom-forming cyanobacteria, several selected strains were further investigated by DNA amplification and sequencing. Design of amplification primers for peptide synthetase genes in cyanobacteria. A comparison of peptide synthetases and other adenylate-forming enzymes from various prokaryotes and eukaryotes revealed the presence of highly conserved functional domains (13, 17) (Fig. 1B). Degenerate PCR primers were directed to these conserved sequence motifs (Table 1). The design of these primers was based on conserved peptide motifs in other bacteria and fungi. Back-translation (reverse translation from protein to DNA) of these consensus motifs was sensitive to the codon bias of cyanobacterial genes in general (7). Specifically, sequence motifs I and V of the adenylate-forming domain of known peptide synthetase modules were used as target sequences (Fig. 1B). These functional domains are only weakly conserved in non-peptide synthetase adenylate-forming enzymes (34). Degenerate primers were used to detect genes encoding peptide synthetases (degenerate peptide synthetase PCR [PS-PCR]). The mcyb gene of M. aeruginosa PCC7608 (4) and its orthologue in M. aeruginosa HUB524 (19) were aligned in order to design PCR primers specific for peptide synthetase genes involved in microcystin biosynthesis (microcystin synthetase PCR [MS-PCR]). These primers were directed to regions within the peptide synthetase module which were shown not to be part of the series of conserved functional motifs (17). The resulting PCR product did, however, contain a conserved core sequence (core motif II) which was used to align DNA sequences for further phylogenetic analyses (Fig. 1B). Specific amplification primers (for MS-PCR) based on the characterized peptide synthetase gene sequence of M. aeruginosa (4) were designed and directed to the region between conserved peptide synthetase motifs I and III (Fig. 1B and Table 1). The priming sites for MS-PCR did not have a sequence identical in the two Microcystis strains, PCC7806 and HUB524, and were selected to enable amplification of a microcystin synthetase fragment from a broad range of microcystin-producing cyanobacteria. Detection of peptide synthetase genes in cyanobacteria by PCR. All DNA samples were checked for integrity in a cyanobacterium-specific 16S ribosomal DNA amplification reaction prior to use in PS-PCR and MS-PCR (23). The degenerate PCR (PS-PCR) was used to identify cyanobacterial strains

4 4092 NEILAN ET AL. J. BACTERIOL. TABLE 2. Cyanobacterial strain toxicities and amplification and hybridization of DNA involved in the biosynthesis of microcystins and other nonribosomal peptides Strain Origin Toxins a PS-PCR b MS-PCR b Probes c HUB ANA Anabaena circinalis AWT006 Australia S ND ND Anabaena cylindrica NIES19 England nt ND ND Anabaena flos-aquae CYA83/1 Norway M Anabaena sp. strain 90 Finland M Anabaena sp. strain 202A1 Finland M Anabaena sp. strain 66A Finland M ND ND Anabaena sp. strain 186 Finland M ND ND Anabaena sp. strain 54 Finland A ND ND Anabaena sp. strain 79B Finland A ND ND Anabaena sp. strain 123 Finland A ND ND Anabaena sp. strain 14 Finland A ND ND Anabaena sp. strain 277 Finland nt Anabaena sp. strain 302 Finland nt Anabaena sp. strain 299A Finland nt Aphanizomenon sp. strain 3 Finland A ND ND Aphanizomenon sp. strain 301 Baltic Sea nt ND ND Aphanizomenon sp. strain TR18 Baltic Sea nt ND ND Aphanizomenon sp. strain 202 Finland nt Aphanizomenon flos-aquae NIES81 Japan nt ND ND Cylindrospermopsis raciborskii Australia C ND ND AWT205 Lyngbya sp. strain AWT211 Australia nt ND ND Microcystis aeruginosa PCC7806 The Netherlands M Microcystis aeruginosa HUB524 Germany M Microcystis aeruginosa PCC7820 Scotland M ND ND Microcystis wesenbergii NIES107 Japan M ND ND Microcystis viridis NIES102 Japan M ND ND Microcystis sp. strain UNSWCP1 Australia M ND ND Microcystis sp. strain AWT139 Australia M ND ND Microcystis sp. strain 199 Finland M ND Microcystis sp. strain 98 Finland M ND Microcystis sp. strain 205 Finland M ND Microcystis aeruginosa PCC7005 United States nt ND ND Microcystis aeruginosa NIES99 Japan nt ND ND Microcystis elabens NIES42 Japan nt ND ND Microcystis sp. strain HUB53 Germany nt ND ND Microcystis sp. strain 269 Finland nt ND Microcystis sp. strain 130 Finland nt ND Nodularia spumigena PCC73104 Canada N d ND ND Nodularia spumigena HEM Baltic Sea N Nodularia spumigena BY1 Baltic Sea N Nodularia spumigena NSO Australia N Nodularia sphaerocarpa HKVV Baltic Sea nt Nostoc sp. strain 152 Finland M Nostoc commune NIES24 Japan nt ND ND Nostoc punctiforme PCC73120 Australia nt ND ND Nostoc sp. strain 268 Russia nt Nostoc sp. strain PCC7120 United States nt Oscillatoria agardhii 195 Finland M Oscillatoria agardhii 18R Finland M Oscillatoria agardhii 223 Finland M Oscillatoria agardhii 49 Finland M ND ND Oscillatoria agardhii 97 Finland M ND ND Oscillatoria agardhii 126 Finland M ND ND Oscillatoria agardhii 128 Finland M ND ND Oscillatoria agardhii NIES204 Japan M ND ND Oscillatoria agardhii 2 Finland nt ND Plectonema sp. strain UNSW United States nt ND ND Pseudanabaena sp. strain AWT300 Australia nt ND ND Synechococcus sp. strain AWT400 Australia nt ND ND a S, paralytic shellfish toxins (e.g., saxitoxins); nt, nontoxic; M, microcystins; A, anatoxin-a; C, cylindrospermopsin; N, nodularin. b, positive;, negative; ND, not determined. c HUB, peptide synthetase gene probe amplified from M. aeruginosa HUB524; ANA, two amplified probes from Anabaena sp. strain 90. d N. spumigena PCC73104 mildly inhibits protein phosphatase 2A activity; however, the structure of this inhibitory compound has not been characterized.

5 VOL. 181, 1999 NONRIBOSOMAL PEPTIDE SYNTHESIS OF CYANOBACTERIA 4093 FIG. 3. Ethidium bromide-stained 1.5% agarose Tris-acetate-EDTA electrophoresis gels showing peptide synthetase gene amplification products from various toxic and nontoxic cyanobacteria (Table 2). (A) Amplification products obtained with the degenerate PS-PCR. Lanes 1 to 13, PCR fragments from the cultured cyanobacteria Anabaena sp. strain 90, A. circinalis AWT006, Aphanizomenon sp. strain 202, C. raciborskii AWT205, Lyngbya sp. strain AWT211, M. aeruginosa PCC7806, M. aeruginosa PCC7005, M. elabens NIES42, N. spumigena PCC73104, Nostoc sp. strain 152, Nostoc sp. strain 203, Oscillatoria sp. strain 195, and O. agardhii NIES204, respectively. The marker lane (M) contains fx174 digested with HaeIII, the top four bands being 1,358, 1,078, 872, and 603 bp. (B) Specific amplification of the microcystin synthetase gene by use of the MS-PCR described in the text. Lanes 1 to 13 are the same as in panel A. (C) Results of the MS-PCR for uncultured cyanobacterial bloom samples containing the genera Oscillatoria (lane 1), Nodularia (lane 2), and Microcystis (lanes 3 to 6). The marker lane (M) contains SPP-1 digested with EcoRI, the six bottom bands being 1,390, 1,160, 980, 720, 480, and 360 bp. FIG. 2. Schematic representation of cyanobacterial DNAs on a template dot blot filter and results of hybridization and autoradiography. (A) Abbreviations for cyanobacterial genera are as follows: Anab, Anabaena; Nos, Nostoc; Mic, Microcystis; Osc, Oscillatoria; Nod, Nodularia; and Aph, Aphanizomenon. Hepatotoxic (H), neurotoxic (N), and nontoxic ( ) strains were investigated. (B) Hybridization pattern of the cyanobacterial dot blot filter with a kb fragment of the mcyb gene of M. aeruginosa HUB524 as the probe. (C) Hybridization pattern of the dot blot filter with a 2.0-kb fragment of a peptide synthetase gene from Anabaena sp. strain 90 as the probe. which contained significant DNA sequence similarity to the adenylate-forming domains of known peptide synthetase genes (13, 28, 34). With the described amplification reaction, putative peptide synthetase genes were detected in strains of the cyanobacterial genera Anabaena, Aphanizomenon, Cylindrosper- mopsis, Microcystis, Nodularia, Nostoc, Oscillatoria, Plectonema, and Pseudanabaena. However, similar degenerate PCR products were not observed for the Synechococcus strain analyzed (Table 2). The results presented in Table 2 were consistent with a larger body of data generated for several other strains of the species listed (data not shown). Several members of the genera Anabaena, Aphanizomenon, and Nostoc were tested for the presence of cyclic peptide toxins and sequences homologous to those of peptide synthetase genes (Fig. 3A). No strains of nonhepatotoxic Anabaena representing the species Anabaena circinalis, A. cylindrica, and A. flos-aquae were shown to possess a microcystin synthetase gene orthologue by the described MS-PCR or probe hybridization. However, these species were shown to contain peptide synthetase gene orthologues. Of the 15 Anabaena strains examined and listed in Table 2, 7 were microcystin producers; the other strains were either nontoxic or produced alkaloid neurotoxins (anatoxins or saxitoxins). These seven strains were

6 4094 NEILAN ET AL. J. BACTERIOL. identified by amplification of the MS-PCR product and by positive probe hybridization (Fig. 2B and 3B). The closely related genus Nostoc, which was represented by both microcystin-producing and nontoxic strains possessed peptide synthetase gene homologues in toxic and nontoxic types and microcystin synthetase gene homologues selectively in only the hepatotoxic strain. Neurotoxic and nontoxic strains of Aphanizomenon possessed peptide synthetase but not microcystin synthetase gene orthologues. This result correlates with the lack of microcystin-based toxicity observed to date for the genus Aphanizomenon (Fig. 2 and 3). MS-PCR of nonmicrocystin-producing strains of cyanobacteria from these three genera did not reveal an amplification product. The other filamentous and heterocyst-forming cyanobacteria used in this study, Nodularia and Cylindrospermopsis, also showed gene detection experiment results which were congruent with toxin analyses. Members of the genus Nodularia are responsible for the synthesis of nodularin, a cyclic pentapeptide, similar in structure to microcystin and likewise hepatotoxic due to its potent inhibition of eukaryotic protein phosphatases. PS-PCR and MS-PCR products were amplified from all strains of Nodularia spumigena. These strains were also shown to produce nodularin, as detected by HPLC, or to inhibit protein phosphatase 2A, as in the case of N. spumigena PCC The Nodularia strains used in this study were isolated from distinct geographic regions, implying a high degree of gene conservation or a cosmopolitan distribution of hepatotoxic strains of this brackish-water cyanobacterium (31). No amplification of the MS-PCR fragment correlated with the lack of microcystin-based toxicity in Cylindrospermopsis raciborskii. This cyanobacterium is capable of synthesizing a hepatotoxic alkaloid known as cylindrospermopsin. The presence of PS- PCR products for the strains studied may be related to the presence of peptide synthetase genes of unknown function. PS-PCR revealed that all strains of Microcystis studied possess one or more peptide synthetase loci. It has been shown that strains of Microcystis, irrespective of their ability to produce microcystin, as determined by chemical analyses and bioassays, contain DNA sequences with significant identity to known peptide synthetase genes (3). The data presented here support these findings and describe a rapid method for the determination of potentially hepatotoxic Microcystis based on the amplification of the MS-PCR template. Samples of uncultured cyanobacterial blooms containing hepatotoxic Microcystis, Nodularia, or Oscillatoria strains were all detected by MS-PCR (Fig. 3C). Both the degenerate and the specific amplification products were generated coordinately only for strains which were shown to produce microcystin or otherwise inhibit eukaryotic protein phosphatases (Fig. 3 and Table 2). Moreover, we sequenced the products obtained by MS-PCR from M. aeruginosa strains and consistently found significant identity to the mcyb gene of strain PCC7806 (see below). It has recently been shown that a single gene cluster inclusive of mcyb is responsible for the synthesis of all microcystin isoforms in M. aeruginosa PCC7806 and that all protein phosphatase inhibition activity is due to cellular microcystin content (4). The amplification of an MS-PCR product for nonhepatotoxic Microcystis sp. strain 269 was not supported by the HUB524 microcystin synthetase gene probe hybridization (Fig. 2A). All other nontoxic strains of this genus did not show amplification of the microcystin-specific DNA sequence (Table 2). Strain 269 may contain a genome sequence compatible with the MS-PCR primers but not the dot blot probe. In addition, it is also possible that toxin levels in this strain are below detection limits or that the altered expression of peptide synthetase genes in laboratory cultures has inhibited microcystin biosynthesis by this strain (36). It is also possible that mutational inactivation of the microcystin synthetase gene in regions other than the fragments assayed resulted in the observed differences among MS-PCR, probe hybridizations, and toxicity tests. All the Oscillatoria agardhii strains produced detectable levels of microcystin, except for one, Oscillatoria sp. strain 2. This strain also cross-hybridized with the HUB524 peptide synthetase probe but was found to be nontoxigenic by MS-PCR. MS-PCR experiments and/or probe hybridizations indicated that these strains, including strain 2, contained orthologous toxin biosynthesis genes (Fig. 2B and 3B). Of the remaining cyanobacterial groups to be tested with the described molecular methods, the filamentous and non-heterocyst-forming genera Lyngbya, Pseudanabaena, and Plectonema (Table 2) and several stromatolite-associated (benthic) cyanobacteria (data not shown) showed genomic orthology to the conserved peptide synthetase loci but not to the microcystin synthetase gene. The sole Synechococcus isolate examined did not possess peptide synthetase or microcystin synthetase (Table 2). Similarly, there was a lack of peptide synthetase orthologues in the genome of Synechocystis sp. strain PCC6803 (12). These results indicate that a broad range of cyanobacteria are capable of nonribosomal peptide synthesis. Sequence analysis and evolutionary relationships between the putative microcystin synthetase gene and other peptide synthetase genes in cyanobacteria. The specific MS-PCR products from 12 hepatotoxic cyanobacterial strains (representing five genera and seven species) and four PS-PCR products (representing peptide synthetase modules of unknown function) from nontoxic M. aeruginosa HUB53 (three modules) and NIES99 (one module) were purified and sequenced. Approximately 700 bp of the putative microcystin synthetase gene was determined for each strain. Furthermore, we included the respective most similar sequence from another module of the microcystin synthetase gene, mcyc, that had been determined during a study aimed at identifying the entire microcystin synthetase gene cluster of M. aeruginosa PCC7806 (33a). DNA sequences of the microcystin synthetase gene and other peptide synthetase gene orthologues were aligned with each other, and the pairwise (Jukes-Cantor) genetic distances were calculated. These distances were represented in a phylogenetic analysis (Fig. 4A). Differences between the peptide synthetase gene sequences were surprisingly large and reflected relatively low sequence similarity between the highly conserved and functional domain motifs of each peptide synthetase module (Fig. 4B). The unicellular cyanobacteria of the genus Microcystis had a second cluster of MS-PCR sequences which was delineated from the PS-PCR sequences of the nontoxic Microcystis strains. We concluded from this observation that, for the Microcystis species studied, MS-PCR specifically amplified a sequence of the mcyb gene and thus may be used to identify potential microcystin producers in these species. However, the situation appears more complicated for strains of Anabaena, Nodularia, Nostoc, and Oscillatoria. For these strains, MS-PCR amplified sequences were clearly different from the sequences amplified for Microcystis strains. Moreover, some of these sequences (N. spumigena BY1, Nostoc sp. strain 152, and O. agardhii 195) clustered more closely with the MS- PCR products from Microcystis strains, whereas other sequences (Anabaena sp. strain 90 and N. spumigena HEM and PCC73104) were more related to the PS-PCR products from nontoxic M. aeruginosa strains. Since the sequences between different modules (having different functions) and of different peptide synthetase genes (again, having different functions) were compared (Fig. 4B), no phylogenetic relationships can be concluded from the PS-PCR sequences. The above-mentioned

7 FIG. 4. (A) Phylogenetic affiliations in a defined region of peptide synthetase genes from strains of the cyanobacterial genera Anabaena, Microcystis, Oscillatoria, Nodularia, and Nostoc. M. aeruginosa HUB53 is nonhepatotoxic and contains a peptide synthetase with paralogous modules designated M, S, and U (27a). Comparisons were based on partial sequence data from MS-PCR products (hepatotoxic strains in Table 2) and PS-PCR products (nontoxic strains). The phenogram was reconstructed from a pairwise distance matrix by use of the neighbor-joining method. Hepatotoxic and nontoxic clusters of Microcystis strains are enclosed by square brackets. (B) Evolutionary relationships among peptide synthetases of microcystin-producing cyanobacteria, nontoxic cyanobacteria, and other bacteria and fungi. Translated MS-PCR and PS-PCR DNA sequences of cyanobacteria were compared to sequences of similar database peptides. Divergence between amino acid sequences was calculated by use of PAM-Dayhoff matrix, and the tree was constructed by use of the neighbor-joining method obtained from the PHYLIP suite of programs. Peptide synthetases, including various modules of the same multienzyme complex, are as follows: GrsA and GrsB, gramicidin A and B synthetases (with modules A to C), respectively, from Bacillus brevis; SrfA, SrfB, and SrfC, surfactin A, B, and C synthetases, respectively, from B. subtilis; TycA, tyrocidin A synthetase from Brevibacillus brevis; EntF, enterobactin synthetase component F from Escherichia coli; Hts1, HC toxin synthetase 1 (modules A to D) from Cochliobolus carbonum; and SimA, cyclosporin A synthetase from Tolypocladium niveum. McyB and McyC are involved in microcystin biosynthesis in the M. aeruginosa strains indicated (Table 2). M. aeruginosa strains HUB53 and NIES99 are nontoxic and possess putative peptide synthetases of unknown function. The scale for each tree indicates inferred evolutionary distances. Bootstrap values greater than 50% which were derived from 100 resampling events of the aligned sequence data and which support the tree topologies are also shown. 4095

8 4096 NEILAN ET AL. J. BACTERIOL. cluster of sequences from different cyanobacterial genera that possibly represents the mcyb gene (Fig. 4A), however, reflects organismic phylogenetic relationships, as inferred by 16S rrna gene sequences (9, 23, 35). More information on the sequence and organization of peptide synthetase genes in cyanobacteria and of the microcystin synthetase gene in particular is required before final conclusions can be made regarding the evolution and phylogeny of microcystin biosynthesis. The present study has shown, for the first time, that microcystin synthetase gene orthologues are present not only in all toxic strains of the genus Microcystis but also in microcystinproducing strains of the genera Anabaena, Oscillatoria, and Nostoc. Nodularin-producing cyanobacteria of the genus Nodularia also appear to possess a microcystin synthetase gene orthologue and therefore a similar biosynthetic pathway for toxin production. We have also shown that strains of other toxic and nontoxic cyanobacterial genera, such as Anabaena, Aphanizomenon, Cylindrospermopsis, Lyngbya, Nodularia, Nostoc, Oscillatoria, Plectonema, and Pseudanabaena contain genes for similar peptide synthetase complexes of unknown function. Due to this broad intergeneric distribution of integrated enzyme systems, therefore, cyanobacteria provide a rich and novel source of many uncharacterized amino-acid-activating and -modifying peptide synthetase modules (18, 28, 32). This study reveals a molecular approach to the discovery of novel bioactive compound synthetic pathways in uncultured cyanobacteria and probably other microorganisms. The specific PCR (MS-PCR) was applicable to the rapid and sensitive detection of toxigenic strains of Microcystis. This method could also be used to identify microcystin-producing strains of other cyanobacterial genera. Further characterization (including insertional inactivation) of various microcystin synthetase gene orthologues from Nodularia, Anabaena, Nostoc, and Oscillatoria will enable the design of specific PCRs for the detection of potential hepatoxin producers in each of these genera. This strategy will provide a procedure for detecting toxic genotypes prior to the production of toxins by relevant cyanobacterial species. ACKNOWLEDGMENTS Additional strains used in this study were kindly supplied by Sue Blackburn (CSIRO) and Boris Gromov (University of St. Petersburg). The anonymous reviewers are thanked for their contributions to the manuscript. This work was funded in Australia by the Australian Research Council, Australian Water Technologies, and the Co-operative Research Center for Water Quality and Treatment; in Germany by the German Research Foundation, DFG (grant Bo 1045/13-3), and the European Commission (grant BIO 4 CT ); and in Finland by the University of Helsinki and the Academy of Finland. B.A.N. was supported by fellowships from the Alexander von Humboldt Foundation and the Australian Research Council. K.S. is a senior research scientist of the Academy of Finland. REFERENCES 1. An, J., and W. W. Carmichael Use of a colorimetric protein phosphatase inhibition assay and enzyme linked immunosorbent assay for the study of microcystins and nodularins. Toxicon 32: Arment, A. R., and W. W. Carmichael Evidence that microcystin is a thiotemplate product. J. Phycol. 32: Dittmann, E., K. Meißner, and T. Börner Conserved sequences of peptide synthetase genes in the cyanobacterium Microcystis aeruginosa. Phycologia 35: Dittmann, E., B. A. Neilan, M. Erhard, H. von Döhren, and T. Börner Insertional mutagenesis of a peptide synthetase gene which is responsible for hepatotoxin production in the cyanobacterium Microcystis PCC7806. Mol. Microbiol. 26: Eloff, J. N Autecological studies on Microcystis, p In W. W. Carmichael (ed.), The water environment algal toxins and health. Plenum Press, New York, N.Y. 6. Erhard, M., H. von Döhren, and P. Junblut Rapid typing and elucidation of new secondary metabolites of intact cyanobacteria using MALDI- TOF mass spectrometry. Nat. Biotechnol. 15: Fay, P., and C. van Baalen The cyanobacteria. Elsevier/North-Holland Publishing Co., Amsterdam, The Netherlands. 8. Fujiki, H Is the inhibition of protein phosphatase 1 and 2A activities a general mechanism of tumor promotion in human cancer development? Mol. Carcinog. 5: Giovanonni, S. J., S. Turner, G. J. Olsen, S. Barns, D. J. Lane, and N. R. Pace Evolutionary relationships among cyanobacteria and green chloroplasts. J. Bacteriol. 170: Golden, J. W., C. D. Carrasco, M. E. Mulligan, G. J. Schneider, and R. Haselkorn Deletion of a 55-kilobase-pair DNA element from the chromosome during heterocyst differentiation of Anabaena sp. strain PCC J. Bacteriol. 170: Honkanen, R. E., F. R. Caplan, K. K. Baker, C. L. Baldwin, S. C. Bobzin, C. M. Bolis, G. M. Cabrera, L. A. Johnson, J. H. Jung, L. K. Larsen, I. A. Levine, R. E. Moore, C. S. Nelson, G. M. L. Patterson, K. D. Tschappat, G. D. Tuang, A. L. Boynton, A. R. Arment, J. An, W. W. Carmichael, K. D. Rodland, B. E. Magun, and R. A. Lewin Protein phosphatase inhibitory activity in extracts of cultured blue-green algae (Cyanophyta). J. Phycol. 31: Kaneko, T., A. Tanaka, S. Sato, H. Kotani, T. Sazuka, N. Miyajima, M. Sugiura, and S. Tabata Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. PCC6803. I. Sequence features in the 1 Mb region from map position 64% to 92% of the genome. DNA Res. 2: Kleinkauf, H., and H. von Döhren A non-ribosomal system of peptide biosynthesis. Eur. J. Biochem. 236: Krishnamurthy, T., W. W. Carmichael, and E. W. Sarver Toxic peptides from freshwater cyanobacteria (blue-green algae). I. Isolation, purification and characterisation of peptides from Microcystis aeruginosa and Anabaena flos-aquae. Toxicon 24: Lawton, L. A., C. E. Edward, and G. A. Codd Extraction and high performance liquid chromatographic method for the determination of microcystins in raw and treated waters. Analyst 119: Lehtimäki, J., P. Moisander, K. Sivonen, and K. Kononen Growth, nitrogen fixation, and nodularin production by two Baltic Sea cyanobacteria. Appl. Environ. Microbiol. 63: Marahiel, M. A., T. Stachelhaus, and H. D. Mootz Modular peptide synthetases involved in non-ribosomal peptide synthesis. Mol. Gen. Genet. 97: McDaniel, R., S. Ebert-Khosla, D. A. Hopwood, and C. Khosla Engineered biosynthesis of novel polyketides. Science 262: Meißner, K., E. Dittmann, and T. Börner Toxic and non-toxic strains of the cyanobacterium Microcystis aeruginosa contain sequences homologous to peptide synthetase genes. FEMS Microbiol. Lett. 135: Moore, R. E Cyclic peptides and depsipeptides from cyanobacteria: a review. J. Ind. Microbiol. 16: Namikoshi, M., and K. L. Rinehart Bioactive compounds produced by cyanobacteria. J. Ind. Microbiol. 17: Neilan, B. A Identification and phylogenetic analysis of toxigenic cyanobacteria by multiplex randomly amplified polymorphic DNA PCR. Appl. Environ. Microbiol. 61: Neilan, B. A., D. Jacobs, T. Del Dot, L. Blackall, P. R. Hawkins, P. T. Cox, and A. E. Goodman Ribosomal RNA sequences and evolutionary relationships among the toxigenic cyanobacteria of genus Microcystis. Int. J. Syst. Bacteriol. 47: Neilan, B. A., D. Jacobs, and A. E. Goodman Genetic diversity and phylogeny of toxic cyanobacteria determined by DNA polymorphisms within the phycocyanin locus. Appl. Environ. Microbiol. 61: Rapala, J., K. Sivonen, C. Lyra, and S. I. Niemelä Variation of microcystins, cyanobacterial hepatotoxins, in Anabaena spp. as a function of growth stimuli. Appl. Environ. Microbiol. 64: Rinehart, K. L., M. Namikoshi, and B. W. Choi Structure and biosynthesis of toxins from blue-green algae (cyanobacteria). J. Appl. Phycol. 6: Sambrook, J., E. F. Fritsch, and T. Maniatis Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 27a.Schaub, V. Unpublished results. 28. Schneider, A., T. Stachelhaus, and M. A. Marahiel Targeted alteration of the substrate specificity of peptide synthetases by rational module swapping. Mol. Gen. Genet. 257: Sivonen, K Cyanobacterial toxins and toxin production. Phycologia 35: Sivonen, K., W. W. Carmichael, M. Namikoshi, K. L. Rinehart, A. M. Dahlem, and S. I. Niemelä Isolation and characterization of hepato-

9 VOL. 181, 1999 NONRIBOSOMAL PEPTIDE SYNTHESIS OF CYANOBACTERIA 4097 toxic microcystin homologs from Nostoc sp. strain 152. Appl. Environ. Microbiol. 56: Sivonen, K., K. Kononen, W. W. Carmichael, A. M. Dahlem, K. L. Rinehart, J. Kiviranta, and S. I. Niemelä Occurrence of the hepatotoxic cyanobacterium Nodularia spumigena in the Baltic Sea and structure of the toxin. Appl. Environ. Microbiol. 55: Stachelhaus, T., A. Schneider, and M. A. Marahiel Rational design of peptide antibiotics by targeted replacement of bacterial and fungal domains. Science 269: Theiss, W. C., W. W. Carmichael, J. Wyman, and R. Bruner Blood pressure and hepatocellular effects of the cyclic heptapeptide toxin produced by the freshwater cyanobacterium (blue-green alga) Microcystis aeruginosa strain PCC7820. Toxicon 26: a.Tillett, D. Unpublished data. 34. Turgay, K., and M. A. Marahiel A general approach for identifying and cloning peptide synthetase genes. Peptide Res. 7: Turner, S Molecular systematics of oxygenic photosynthetic bacteria. Plant Syst. Evol. 11: Watanabe, M. F., and S. Oishi Effects of environmental factors on toxicity of a cyanobacterium (Microcystis aeruginosa) under culture conditions. Appl. Environ. Microbiol. 49: