Influence of the skin mechanical and microbial properties on hair growth
|
|
|
- Gavin Gallagher
- 10 years ago
- Views:
Transcription
1 Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont Enigma. Impossible? Keywords (5) Hair, Growth, Stem cells, Microbiome, Mechanics Team members Name Name Interests Sophie BARY Ecology, Taxonomy, Phylogeny Frances EDWARDS Cell biology, Developmental biology,cytoskeleton Paul KENNOUCHE Microbiology, Modeling, Tissue engineering Paul Guéridon RIDVO Immunology, Biomaterials, Medicine Mariela SKENDI Medicine, Ultrasound imaging and therapeutic techniques Abstract (200 words max) Human bodies are covered in hair of different lengths. The length of hair is determined by the rate at which it grows and the time it spends growing before it falls out during the anagen phase. The causes of these physiological variations have not yet been determined. Here, we propose to concentrate on the comparison of scalp hair and eyebrows to establish the influence of the hair follicle environment on hair growth. We first aim to compare the physiology of scalp hair and eyebrow follicles. We will then identify the differences between the environments of these follicles, in particular their microbiome and mechanical properties. After these descriptive studies, the influence of specific parameters will be tested on follicle stem cell behaviour by using an in vitro culture system. This original project will provide a novel insight on the influence of the environment on homeostasis, but could also lead to new therapeutic solutions to alopecia.
2 B Description of the project B 1 General Introduction Pluricellular organisms derive from a single cell. Throughout development and despite a similar genetic background, cells have very different fates depending on the environment in which they grow. This stands true for the macro environment as well as for the micro environment. This multi scale regulation was initially studied during embryonic development. Yet, it has now become apparent that such a multi factorial regulation also plays a major role in the development of mature organisms. Adult stem cells are responsible for this constant cell renewal. Because of their well characterized cyclic regeneration pattern, hair bulbs are a good model to analyze the influence of the environment on development. Moreover, hair always originates from the same multi cellular epidermal structure: the hair bulb. Yet, there is a visible diversity in the hair covering the human body. What could explain the difference between the limit length of our eyebrows and our scalp hair? To understand this phenomenon, the hair follicle anatomy and cycle must be described. Its structure evolves through three phases : the anagen phase (or growth phase) during which the follicle penetrates deeper into the dermis, progenitor cells proliferate in the bulge and finally cells in the papilla (the basal structure of the hair bulb) divide to forms new hair fiber; the catagen phase which marks the end of the growth of the hair following apoptosis of the cells in the hair follicle. the telogen phase, the dormance of the follicle. A difference in the duration of the anagen phase of the scalp hair and the eyebrow has previously been reported. The rate of hair growth and the duration of anagen vary with the type of hair and location. On the scalp, the growth rate of terminal hair is approximately 0.3 mm per day and the duration of anagen ranges from two to six years. In contrast, eyebrow hair grows only at a rate of 0.1 mm per day and has an anagen phase of two to three months. Yet, the determinants of the duration of the anagen phase remain unknown. Classical hypothesis include cell to cell signalling, signalling through endocrine factors or blood irrigation. Recent reports reveal the diversity of the skin microbiome. Given the major role that the micriobiome plays in organs such as the gut, we suspect that it might have a determinant role in the development of the hair. This is further supported by pathologies such as bacterial folliculitis. In addition to that, a factor that has long been overlooked and we aim to study is the influence of the mechanical constraints. B 2 Objectives and specific aims The aim of our project is to determine if two specific environmental cues, namely tissue stiffness and the microbiota, influence tissue homeostasis in the particular case of hair renewal. Compared description of the physiology of the hair and brow follicles Comparative histology of follicles of scalp hair and eyebrows Compare the division rate and the time stem cells spend dividing in vitro in the same conditions? Comparison of the environment of these two types of follicles Mechanical properties : high frequency ultrasounds Microbiota Determine the influence of tissue mechanics and microbial populations on hair stem cell physiology. Primary cultures of hair follicle stem cells in environments with differential stiffness Variation of the microbial populations in culture
3 C Detailed description of the project I. Correlation of hair growth with physiological parameters of the stem cells. The first aim of our project is to determine which physiological characteristics of bulge stem cells are correlated with the length of hair. For this, we will compare the scalp hair and eyebrows of a group of blond men aged 25 to 30. We will first compare the histology of eyebrow and hair follicles, concentrating on the number of stems cells and their size. For this, hair and eyebrows will be collected, and dissected, before proceeding to the staining of the stem cells using immunohistochemistry. In order to characterize the behavior of the different follicles, hair stem cells will be collected from the bulbs, cultured, and then sorted using Fluorescent Automated Cell Sorting targetting CD24 and a6 integrin as specific markers of bulge stem cells. We will then study their division rate using microscopy. II. Characterization of the microenvironment of hair follicles. A. Assessment of elastic parameters of human skin using dynamic elastography. We will perform tissue stiffness measurement of the skin in vivo by sonoelastography and transient elastography. This technique uses Young's modulus as a parameter because it defines local tissue stiffness yielding local, quantitative information. We will use a high resolution device capable of measuring local Young's modulus in very thin layers and devoted to the in vivo evaluation of the elastic properties of human skin. It uses an ultrasonic probe (50 MHz) for tracking the displacements induced by a 300 Hz shear wave generated by a ring surrounding the transducer. B. Microbiota The skin is colonized by a diverse milieu of microorganisms, most of which are harmless or even beneficial to their host. Colonization is driven by the ecology of the skin surface, which is highly variable. We estimate that ~1 billion bacteria inhabit a typical square centimeter of skin covering the surface and extending down into the appendages and glands. Intrinsic factors as well as environmental factors influence the composition of skin microorganism communities. The topography of human skin varies at both microscopic and macroscopic levels. Distinct habitats are characterized by differences in skin thickness and folds and densities of hair follicles and glands. To consider the diversity of this microenvironment, and to test whether it has an impact on the anagen phase, it is necessary to take into account the topography of the environment. The ecosystem will be caracterized by using DNA barcoding, a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, the 16S rrna gene which is universal among prokaryotes.
4 We will use online databases, such as the Ribosomal Database Project (RDP), which catalog hundreds of thousands of validated 16S rrna gene sequences. Thus, sequencing of the 16S rrna gene facilitates identification of bacteria present in a given sample. Taking into account the diversity of these ecosystem implies to investigate what bacteria, fungi and virus are present on this two different environments. Since viruses don t contain a generic barcode gene, it was decided to sequence the whole genome of viruses in this work using Next Generation Sequence Technology. This implies extraction, PCR amplification, sequencing and database research in order to identify virus. III. How does the microenvironment of hair follicles influence their physiology? The first two aims of our project will have identified differences in the specific microenvironment of hair and eyebrow follicles, and differences in the physiology of the bulge cells. The next aim will be to determine if bulge cell physiology can be influenced by the identified parameters of the microenvironment. We will approach this question by using in vitro culture of bulge cells from hair and eyebrows, to specifically control their microenvironment. We will obtain hair stem cells from the brows and hair of the same population studied in the first part. We will culture the cells, and proceed to their sorting using Fluorescent Automated Cell Sorting using CD24 and a6 integrin as specific markers of bulge stem cells. If the first part of our project has revealed a difference in tissue stiffness between the epidermis of hair and brows, we will proceed to the culture of the stem cells on PDMS substrates. Varying the crosslinker concentrations will lead to substrates of different stiffness. We will then monitor the influence of stiffness on hair stem cell physiology, by considering the different parameters that we will have identified in the second part of our work, eg. size, rate of division, timing of differentiation process. We will also test the influence of the microbiome on these parameters by culturing the stem cells in presence of the different populations identified as being different from hair to brows in the previous section. D Scientific Interest in the project of all the participants and beyond The project is fully interdisciplinary and requires a wide range of theorical and technical knowledge. It is at the interface between microbiology, biophysics and physiology, and we will need knowledge in mechanical physics, medicine and chemistry to determine the environments for different hair. It will gather abilities in new methods like Next Generations Sequencing, and new ultrasound techniques. There are numerous challenges that will probably interest developmental biologists : this project will improve the understanding of the influence of the environment on tissue homeostasis medical imaging : the use of high frequency ultrasounds to study tissue mechanics will help improve the technique and will be a proof of concept for its use to study the epidermis
5 society : alopecia for example, a health problem. We may provide new information that could help improve this condition, through surgery or the use of probiotics cosmetic industry : to improve their products, shampoo for example E BUDGET (1 million euro max for 3 years including salaries, equipment, consumables, etc.) Consumables : ,12 /student/year = ,80 NGS : 1999,87 /run x 10 = ,70 Equipment fees (elastography, FACS) : ,00 Travel : 19850,25 x 3 years = ,75 Publications, etc = Staff : /student = Total : ,25
Hair Chemistry. Chapter 1. Hair Relaxers Science, Design, and Application www.alluredbooks.com
Hair Relaxers Science, Design, and Application www.alluredbooks.com Chapter 1 Hair Chemistry We all know that the hair on our head is dead, but underneath the scalp, within the hair follicle, is a surprisingly
no!no! Thermicon: A Novel, Home-based Hair Removal Device Dr. Mira Barki Yavne, Israel Introduction Lasers and intense pulsed light sources have become a popular method for long-term removal of unwanted
Biology Institute: 7 PhD programs Expertise in all areas of biological sciences
Biology Institute: 7 PhD programs Expertise in all areas of biological sciences!" #$%&'()*" '+**$,%' Biology Institute: PhD programs Programs Website: http://www.ib.unicamp.br/pos About the Biology Institute
Biotechnology. Srivatsan Kidambi, Ph.D.
Stem Stem Cell Cell Engineering-What, Biology and it Application Why, How?? to Biotechnology Srivatsan Kidambi, Ph.D. Assistant Professor Department of Chemical & Biomolecular Engineering University of
What is androgenetic alopecia?
What is androgenetic alopecia? Androgenetic alopecia is also called male pattern alopecia. It refers to a symptom that develops after puberty, influenced by the androgen, where thinning and/or loss of
where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results
where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results GOING BALD? HAIR LOSS? THINNING? NO MORE! - HAIR RESTORATION FROM FUECLINICS Hair transplantation involves
All About Human Hair and Hair Loss. 1. Story
All About Human Hair and Hair Loss 1. Story Hair has always been an important sign of beauty. This is especially true for women. Next to the face, hair is one of the main qualities people look for when
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
Getting to the Root of Hair Loss
26 March 2012 MP3 at voaspecialenglish.com Getting to the Root of Hair Loss Reuters An example of male pattern baldness SHIRLEY GRIFFITH: This is SCIENCE IN THE NEWS in VOA Special English. I'm Shirley
PROPERTIES OF THE HAIR AND SCALP
PROPERTIES OF THE HAIR AND SCALP 1. The scientific study of hair, its diseases and care is called: a. dermatology c. biology b. trichology d. cosmetology 2. The two parts of a mature hair strand are the
MASTER OF SCIENCE IN BIOLOGY
MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate
Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner
Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions
BIOLOGICAL SCIENCES REQUIREMENTS [63 75 UNITS]
Biological Sciences Major The Biological Sciences address many of the most important and fundamental questions about our world: What is life? How does our brain produce our ideas and emotions? What are
Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot
Chapter 1 All you need to know about hair almost Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot Typically
Diablo Valley College Catalog 2014-2015
Biological science BIOSC Diablo Valley College is approved by the California Board of Registered Nurses for continuing education credits. Biological Science courses which can be used are BIOSC-119, 120,
FGF-1 as Cosmetic Supplement
FGF-1 as Cosmetic Supplement Ing-Ming Chiu, Ph.D. Professor, Internal Medicine and Molecular and Cellular Biochemistry The Ohio State University Columbus, Ohio, U.S.A. GENTEON USA Fibroblast Growth Factor
It works. Hair loss prevention and hair regeneration study
Hair loss prevention and hair regeneration study Report of the findings of the clinical trial to evaluate the effectiveness of VR6 hair treatment Study conducted by: Centro de Tecnología Capilar, SL Report
INNOVATION PRIZE 2008. PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells
INNOVATION PRIZE 2008 PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells A Revolutionary Technology to Protect
Please visit your examination provider s website for the most current bulletin prior to testing. IMPORTANT INSTRUCTIONS
NATIONAL BARBER THEORY EXAMINATION CANDIDATE INFORMATION BULLETIN Please visit your examination provider s website for the most current bulletin prior to testing. The National Barber Theory Examination
CAN ÇETİN. Adress +90 536 968 4800. Telephone. [email protected]. E- Mail & Skype
CAN ÇETİN Adress Yeditepe University, Faculty of Engineering and Architecture Department of Genetics and Bioengineering Tissue Engineering Laboratory 34755 Kayışdağı - Istanbul Turkey Telephone E- Mail
Notes on Hair Analysis
Notes on Hair Analysis I have found local veterinarians very uncooperative when trying to get samples of dog and cat fur. I have found neighbors, friends and relatives a much better source of fur. There
Master of Science in Biophysics, Biochemistry and Biotechnology
Master of Science in Biophysics, Biochemistry and Biotechnology Tracks: Biophysics Biochemistry and Biotechnology Faculty of Science Faculty of Medicine KU Leuven. Inspiring the outstanding. Discover KU
Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine
Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine January 27, 2009 Dear Professors (representative) of departments, Subject:
Uses of Flow Cytometry
Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
Medical Laboratory Technology Program. Student Learning Outcomes & Course Descriptions with Learning Objectives
Medical Laboratory Technology Program Student Learning Outcomes & Course Descriptions with Learning Objectives Medical Laboratory Technology Student Learning Outcomes All Colorado Mesa University associate
Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
Anatomy PHL 212. By Dr Tajdar Husain Khan
Anatomy PHL 212 By Dr Tajdar Husain Khan Overview of Anatomy Anatomy(from the Greek word anatome,"dissection") is a branch of natural science dealing with the structural organization of living things The
STATISTICAL ANALYSIS OF ULTRASOUND ECHO FOR SKIN LESIONS CLASSIFICATION HANNA PIOTRZKOWSKA, JERZY LITNIEWSKI, ELŻBIETA SZYMAŃSKA *, ANDRZEJ NOWICKI
STATISTICAL ANALYSIS OF ULTRASOUND ECHO FOR SKIN LESIONS CLASSIFICATION HANNA PIOTRZKOWSKA, JERZY LITNIEWSKI, ELŻBIETA SZYMAŃSKA *, ANDRZEJ NOWICKI Institute of Fundamental Technological Research, Department
An Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015)
Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015) Preparatory Subject Matter......56-66 Biological Sciences 2A-2B-2C.....15 Chemistry 2A-2B-2C...15 Chemistry 8A-8B or 118A-118B-118C......6-12
AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data
Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer
Comprehensive Lab Kits & Digital Curriculum for Online Learners
Allied Health Anatomy and Physiology Biology Chemistry Environmental Science Geology Microbiology Pharm Tech Physical Science Physics Comprehensive Lab Kits & Digital Curriculum for Online Learners supports
There are a wide range of factors that can impact on the health of the hair and hair growth.
Welcome to Viviscal Viviscal, one of the best selling hair growth supplement in the US, is now available with TVSN. The Viviscal brand of hair care products is enjoying rapid and substantial growth in
Biotechnical Engineering (BE) Course Description
Biotechnical Engineering (BE) Course Description The major focus of the Biotechnical Engineering TM (BE) course is to expose students to the diverse fields of biotechnology including biomedical engineering,
CAP Accreditation Checklists 2015 Edition
CAP Accreditation Checklists 2015 Edition The College of American Pathologists (CAP) accreditation checklists contain the CAP accreditation program requirements, developed on more than 50 years of insight
Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL
Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL COURSE TITLE: BIOCHEMISTRY COURSE NUMBER: 5104 This course emphasizes biochemical compounds, processes and systems, designed
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Bachelor of Science in Nursing Transfer Admission Information Packet. Preferred Application Deadlines
Bachelor of Science in Nursing Transfer Admission Information Packet Preferred Application Deadlines Spring Semester: December 1 Fall Semester: February 15 Please read this Information Packet carefully
Thick and Thin Evaluating layers of the skin
Overview Thick and Thin Evaluating layers of the skin Understanding the layered structure of skin is essential to understanding how it functions. The focus of this lesson is for students to discover and
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy in Biochemistry FACULTY OF MEDICAL SCIENCE Naresuan University 73 Doctor of Philosophy in Biochemistry The Biochemistry Department at Naresuan University is a leader in lower northern
Advances in scmos Camera Technology Benefit Bio Research
Advances in scmos Camera Technology Benefit Bio Research scmos camera technology is gaining in popularity - Why? In recent years, cell biology has emphasized live cell dynamics, mechanisms and electrochemical
BIOSCIENCES COURSE TITLE AWARD
COURSE TITLE AWARD BIOSCIENCES As a Biosciences undergraduate student at the University of Westminster, you will benefit from some of the best teaching and facilities available. Our courses combine lecture,
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: Suzanne_moore@uml.
Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: [email protected] PROFESSIONAL PROFILE Accomplished career demonstrating consistent
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Notch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
Core Curriculum to the Course:
Core Curriculum to the Course: Basic Human Anatomy Basic Biochemistry General Cellular Biology Introduction to Ecology Basic Ecology General Biophysics and Physiology I General Biophysics and Physiology
AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!
AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square
IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex
Fields of Education. Last updated August 2011
Fields of Education Last updated August 2011 Monash University is required to report to the Department of Education, Employment and Workplace Relations (DEEWR) the number of higher degree by research (HDR)
NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT
1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun
Cell Biology Questions and Learning Objectives
Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate
Pig skin as an alternative to human skin for skin metabolism studies?
Pig skin as an alternative to human skin for skin metabolism studies? H. Osman-Ponchet, A. Lemoine, A. Gaborit, K. Sevin, M. Alriquet, P. Comby, B. Ruty 2 nd Skin Metabolism Meeting October 10-11, 2013
International Stem Cell Registry
International Stem Cell Registry Importance of Stem Cells Stem cells are model systems for the study of development and disease. Pluripotent stem cells offer new tools for drug design and discovery. Pluripotent
UPBM CURRICULAR BROCHURE
UPBM CURRICULAR BROCHURE Undergraduate Program in Biology and Medicine Contents Academic Year 2015-16 About the Undergraduate Program in Biology and Medicine...pg. 1 Undergraduate Majors...pg. 2-3 Getting
BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516
BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516 1. Mission, Aims and Objectives The new BSc (Hons)/ MSc course is a
Medical Laboratory Sciences Department of Biology
Medical Laboratory Sciences Department of Biology mls Why Choose Medical Laboratory Sciences at the University of North Florida? The development of the Medical Laboratory Sciences (MLS) program is a result
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
University of Babylon College of Dentistry Curriculum of first Year
University of Babylon College of Dentistry Curriculum of first Year The Name of Course Medical Chemistery The Number of Course Me. Ch 100 Number of unite 8 Total Hours 5 Theory Hours 3 5% 5% 10% 20% ---
66 BIOLOGY BIOLOGY. Bachelor of Science with a Major in Biology Major Codes BI01-BI10. Reynolds Hall 210 417.625.9376
66 BIOLOGY BIOLOGY Reynolds Hall 210 417.625.9376 Faculty Lemmons - Head, Bay, Creamer, Davis, Dennis, Fletcher, Fraser, Heth, Johnson, Kennedy, Lawson, Messick, Peters, Plucinski, Roettger, Schlink, Wells
Support structure for genetic material
Support structure for genetic material 1 Making proteins in the RER Making copies of humans 2 Making copies of cells Making copies of genetic material 3 Making copies of genetic material Making copies
A.C.N.E. H.E.L.P. Advanced Comedolytic & Normalizing Effect by Heat, Electricity & Light for Prevention & Treatment of Acne.
A.C.N.E. H.E.L.P. Advanced Comedolytic & Normalizing Effect by Heat, Electricity & Light for Prevention & Treatment of Acne. The acne More than 80% of the world population suffers at least once in a lifetime
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 38 credit hours: 1- Basic requirements: 10 credit hours. 150701, 150702, 150703,
A: Nursing Knowledge. Alberta Licensed Practical Nurses Competency Profile 1
A: Nursing Knowledge Alberta Licensed Practical Nurses Competency Profile 1 Competency: A-1 Anatomy and Physiology A-1-1 A-1-2 A-1-3 A-1-4 A-1-5 A-1-6 A-1-7 A-1-8 Identify the normal structures and functions
TOOLS FOR T-RFLP DATA ANALYSIS USING EXCEL
TOOLS FOR T-RFLP DATA ANALYSIS USING EXCEL A collection of Visual Basic macros for the analysis of terminal restriction fragment length polymorphism data Nils Johan Fredriksson TOOLS FOR T-RFLP DATA ANALYSIS
BIOSCIENCE. BIOSC 0070 BIOLOGY LABORATORY 1 1 cr. BIOSC 0080 BIOLOGY LABORATORY 2 1 cr.
BIOSCIENCE BIOSC 0070 BIOLOGY LABORATORY 1 1 cr. Various morphological aspects and physiological processes in plants and animals are investigated. Corequisite: BIOSC 0170. BIOSC 0080 BIOLOGY LABORATORY
Practical Cell Analysis
Practical Cell Analysis Dimitri Pappas Dept of Chemistry & Biochemistry, Texas Tech University, USA WILEY A John Wiley and Sons, Ltd, Publication Contents Preface Acknowledgments xiii xix 1 Getting Started
Veterinary Testing. Classes of Test
Veterinary Testing Classes of Test July 2014 Copyright National Association of Testing Authorities, Australia 2014 This publication is protected by copyright under the Commonwealth of Australia Copyright
The Extension of the DICOM Standard to Incorporate Omics
Imperial College London The Extension of the DICOM Standard to Incorporate Omics Data Richard I Kitney, Vincent Rouilly and Chueh-Loo Poh Department of Bioengineering We stand at the dawn of a new understanding
ALMOFRONT 2 cruise in Alboran sea : Chlorophyll fluorescence calibration
Vol. 3 : 6-11, 2010 Journal of Oceanography, Research and Data ALMOFRONT 2 cruise in Alboran sea : Chlorophyll fluorescence calibration CUTTELOD Annabelle 1,2 and CLAUSTRE Hervé 1,2 1 UPMC, Univ. Paris
STOP HAIR LOSS DR JOYCE LIM DERMATOLOGIST PARAGON MEDICAL CENTRE #11-16/20
STOP HAIR LOSS DR JOYCE LIM DERMATOLOGIST PARAGON MEDICAL CENTRE #11-16/20 HAIR LOSS Types of Hair loss What causes them What are the solutions HAIR LOSS PATCHY HAIR LOSS PATCHY HAIR LOSS Single/ Multiple
On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma
On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma Uber die Entstehung von multinuklearen Reed-Sternberg Riesenzellen und die Rolle von CD4 T-Zellen
Biology (BIO) Courses. University of Illinois Springfield 1
University of Illinois Springfield 1 Biology (BIO) Courses BIO 106. Environmental Biology. 3 Hours. Examines ecological principles in relation to environmental problems. Emphasizes current environmental
5-2008. Plant Stem Cell Extract for Longevity of Skin and Hair. D. Schmid, C. Schürch, P. Blum, E. Belser, F. Zülli:
5-2008 English Edition International Journal for Applied Science Personal Care Detergents Specialties D. Schmid, C. Schürch, P. Blum, E. Belser, F. Zülli: Plant Stem Cell Extract for Longevity of Skin
Two main classes: Epithelial Connective (synovial) Epithelial. Cutaneous Mucous Serous
Two main classes: Epithelial Connective (synovial) Epithelial Cutaneous Mucous Serous Epithelial Membranes = sheet of epithelia + connective tissue base 1. Cutaneous membrane: outer skin layer (stratified
Biological Science (BIOL) UNDERGRADUATE COURSE OFFERINGS
Biological Science (BIOL) UNDERGRADUATE COURSE OFFERINGS BIOL 100 Principles of Biology A lecture course introducing non-science concentrators to major areas of biology, including cell biology, genetics,
Biology Department Competitive Admission Requirements
GENERAL BIOLOGY BACHELOR OF SCIENCE IN BIOLOGY The General Biology option emphasizes breadth of training in Biology. As the most flexible among the options leading to a Science degree in Biology, students
A Correlation of Miller & Levine Biology 2014
A Correlation of Miller & Levine Biology To Ohio s New Learning Standards for Science, 2011 Biology, High School Science Inquiry and Application Course Content A Correlation of, to Introduction This document
OBJECTIVES PROCEDURE. Lab 2- Bio 160. Name:
Lab 2- Bio 160 Name: Prokaryotic and Eukaryotic Cells OBJECTIVES To explore cell structure and morphology in prokaryotes and eukaryotes. To gain more experience using the microscope. To obtain a better
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Biochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!!
Biochemistry Major Talk 2014-15 August 14, 2015 Department of Biochemistry The University of Hong Kong Welcome!!!!!!!!!!!!!! Introduction to Biochemistry A four-minute video: http://www.youtube.com/watch?v=tpbamzq_pue&l
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
Prokaryotic and Eukaryotic Cells
Lab 2- Bio 201 Prokaryotic and Eukaryotic Cells Name: OBJECTIVES To explore cell structure and morphology in prokaryotes and eukaryotes. To gain more experience using the microscope, and in particular,
Stem Cell Quick Guide: Stem Cell Basics
Stem Cell Quick Guide: Stem Cell Basics What is a Stem Cell? Stem cells are the starting point from which the rest of the body grows. The adult human body is made up of hundreds of millions of different
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Computer Modeling. Exciting careers in. * How were computer models involved in making this scene possible? What is it? How does it work? Who uses it?
Computer Modeling Exciting careers in What is it? How does it work? Who uses it? What can I do with it? Where can I learn it? * How were computer models involved in making this scene possible? What is
Biology Department Admission Requirements
GENERAL BIOLOGY BACHELOR OF SCIENCE IN BIOLOGY The General Biology option emphasizes breadth of training in Biology. As the most flexible among the options leading to a Science degree in Biology, students
Master in Biology Faculty of Natural Sciences February 2010
Master in Biology Faculty of Natural Sciences February 2010 University of Ulm There are many good reasons to pursue a master degree at the University of Ulm. One of the most important ones, alongside the
Medical Laboratory Sciences Department of Biology
Medical Laboratory Sciences Department of Biology faqs mls Why Choose Medical Laboratory Sciences at the University of North Florida? The development of the Medical Laboratory Sciences (MLS) program is
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
Version 1 2015. Module guide. Preliminary document. International Master Program Cardiovascular Science University of Göttingen
Version 1 2015 Module guide International Master Program Cardiovascular Science University of Göttingen Part 1 Theoretical modules Synopsis The Master program Cardiovascular Science contains four theoretical
The Cell Teaching Notes and Answer Keys
The Cell Teaching Notes and Answer Keys Subject area: Science / Biology Topic focus: The Cell: components, types of cells, organelles, levels of organization Learning Aims: describe similarities and differences
HyStem. Hydrogels CELLULAR MATRICES FOR TRANSLATIONAL RESEARCH. esibio.com
HyStem Hydrogels CELLULAR MATRICES FOR TRANSLATIONAL RESEARCH HyStem Hydrogel Extracellular Matrices Chemically-defined For use in 2D and 3D formats in vitro and in vivo applications Customizable for many
