Interplay between microrna and Hepatitis B virus replication. A Thesis. Submitted to the Faculty. Drexel University. Yi Guo

Transcription

1 i Interplay between microrna and Hepatitis B virus replication A Thesis Submitted to the Faculty of Drexel University by Yi Guo in partial fulfillment of the requirements for the degree of Master of Science in Biomedical Science May 2013

2 ii Table of Contents LIST OF TABLES... iv LIST OF FIGURES... v Abstract... vi I. Introduction Hepatocellular Carcinoma Hepatitis B Virus MicroRNA Biogenesis and Function microrna expression profiles in HCC microrna and HBV replication... 8 II METHODS Cell culture Cell transfection and RNA isolation Plasmids Quantitative Reverse Transcription-Polymerase Chain Reaction (qrt-pcr) DNase Treatment of RNA Samples Prior to RT-PCR RT-PCR and Real-Time RT-PCR analysis of gene expression Real-Time data analysis Western Blot Analysis Luciferase Assay HBV replication assay III. Results Up-regulation of mature mir-122 in the HepG2.215 cell line

3 iii 3.2 MiR-122 expression is not significantly altered by HBV Confirmation of relationship between mir-122 expression and HBV Overexpression of mir-122 enhances HBV replication Confirmation of continual function of mir-122 expression plasmid in luciferase reporter system Creation of standard curve with plasmid DNA template for differentiation markers Confirmation of the differentiation state of Primary Rat Hepatocyte IV Discussion Regulation of mir-122 by HBV Overexpression of mir-122 enhances HBV replication Future directions LIST OF REFERENCES... 41

4 iv List of Tables Table 1. Primer Sequence and Annealing Tm of each oligonucleotide Table 2. Primer Sequence and Annealing Tm of each oligonucleotide for primary mirnas Table 3. Primer Sequence and Annealing Tm of each oligonucleotide for qpcr... 14

5 v List of Figures Figure 1. Global distribution of chronic hepatitis B virus infection... 2 Figure 2. Estimated age-standardized incidence of hepatocellular carcinoma (HCC)... 2 Figure 3. Hepatitis B virus genome Figure 4. Hepatitis B Virus life cycle... 5 Figure 5. A schematic of mirna biogenesis Figure 6. Schematic diagram of plasmid construction Figure 7. Overview of competitive C T method Figure 8. Detection of mirna expression in HepG2.215 relative to HepG2 cells by qrt-pcr Figure 9. mir-122 and let-7a expression changes are not induced by HBV transfection Figure 10. Confirmation of HBV protein expression by western blot after HepG2 cell transfection Figure 11. Functional investigation of HBV-mediated regulation of mir Figure 12. Real-time PCR analysis of mir-122 expression levels Figure 13. Detection of functional mir-122 in the context of HBV by luciferase assay Figure 14. MiR-122 enhances HBV replication in HepG2 cells Figure 15. Confirmation of functional mir-122 expression plasmid by luciferase reporter system Figure 16. Construction of standard curve for liver-specific differentiation gene markers Figure 17 Confirmation of differentiated PRH during cell culture by qrt-pcr

6 vi Abstract Interplay between microrna and Hepatitis B virus replication Yi Guo Michael Bouchard, Ph.D. Chronic infection with the hepatitis B virus (HBV), which affects 350 million people worldwide, is an important global health issue. Virus-mediated changes in normal cellular physiology of hepatocytes, the main target cell of HBV, are considered to facilitate persistent and chronic infection of HBV, potentially leading to the development of HBV-associated liver cancer. Recent work with micrornas (mirnas) has shown that many cell types express distinct profiles of mirnas specifically suited for regulating normal cellular function. This is particularly apparent in hepatocytes, where a single mirna, mircorna-122 (mir-122), makes up at least 50% of the total mirnas in the cell. Given the important role of mirnas in regulating cellular function, and the particular importance of mir-122 to hepatocytes, we hypothesize that the levels of mir-122 in the cell may directly influence HBV replication, which may in turn regulate levels of mir-122. To address this hypothesis, the expression levels of mir-122 in HepG2.215 cells, which stably express HBV, were compared to their parental cell line, HepG2. Levels of mir-122 were significantly higher in HepG2.215 cells compared to HepG2. We then measured mir-122 using a luciferase reporter system in which luciferase activity is directly proportional to the amount of functional mir-122. These results, however, indicated minimal alteration of levels of mir-122 between these two cell lines. Also, when HepG2 cells were transfected with a plasmid expressing the HBV genome, HBV failed to elevate mir-122 levels, despite the presence of HBV proteins. On the other hand, exploring the effects of mir-122 expression on HBV replication showed that mir-122 enhanced HBV replication in transfected HepG2 cells in a dose dependent manner. These results may help explain why HBV specifically infects hepatocytes, the only cell

7 vii type known to express significant levels of mir-122. Additionally, an assay was developed to confirm the authenticity of isolated primary rat hepatocytes using real-time reverse transcription-polymerase chain reaction for hepatocyte specific markers. Future work will replicate these mir-122 experiments in this more biologically relevant system. Together, while the effect of HBV infection on mir-122 expression remains controversial, these results do suggest a potential role for mir-122 in enhancing HBV replication.

8 1 I. Introduction 1.1 Hepatocellular Carcinoma Hepatocellular carcinoma (HCC), also known as primary liver cancer, makes up about 90% of the primary malignant tumors of the liver observed in adults. HCC is one of the most common and fatal cancers worldwide [1]. Annually, more than 560,000 people are diagnosed with HCC worldwide, including about 20,000 new cases in the United States [1, 2]. Due to the recent progress in diagnostic methods for early detection and efficient treatments, the short-term prognosis of HCC has improved; however, the long-term prognosis in HCC patients still remains incompletely understood [3, 4]. The incidence rate for HCC has tripled over the past 20 years, while the 5-year survival rate has remained below 12%, making it the most rapidly increasing cause of cancer-associated deaths in the United States [5, 6]. Although HCC is a common cancer, the regional incidence of HCC can vary greatly due to the localized prevalence of risk factors such as infection with hepatotropic viruses like hepatitis B or C viruses. Certain areas such as parts of Asia and sub-saharan Africa that have high hepatitis B infection rates [7] also show a heavy burden of HCC (Figure 1&2). Other risk factors such as obesity, chronic exposure to toxins or alcohol, autoimmune disorders, genetic and epigenetic factors and elevated hepatic iron levels are all linked to the development of hepatocellular carcinoma [1, 8-10]. Most of these risk factors prolong the immunologic response to HBV infection, subjecting hepatocytes to the process of chronic inflammation and persistent cycles of necrosis and regeneration, ultimately leading to liver damage, fibrosis and cirrhosis. Multiple cellular signal transduction pathways are altered in the above processes including the profiles of

9 2 proteins, micrornas and cytokines, each of which may potentially play an important role in the development of HBV-associated HCC [9, 11]. Figure 1. Global distribution of chronic hepatitis B virus infection [12]. Figure 2. Estimated age-standardized incidence of hepatocellular carcinoma (HCC). Number based on rate per 100,000. GLOBOCAN 2008 [5].

10 3 1.2 Hepatitis B Virus Epidemiological studies have shown a strong association between chronic hepatitis B virus (HBV) infection and HCC development [9]. Despite the availability of a highly effective vaccine, million people worldwide are chronically infected with HBV and about 25% -40% of these chronically infected individuals develop HCC [1, 13]. In the United States, the general prevalence of chronic HBV infection is low, but certain populations such as Alaskan natives and Pacific Islanders have a higher prevalence [13]. HBV is a partially double-stranded DNA virus, which belongs to the hepadnaviridae family. It specifically infects hepatocytes and can lead to the development of chronic HBV infection. The virus is enveloped, and contains a compact DNA genome of about 3200 base pairs. It has four overlapping open reading frames, which encode the viral capsid (core), envelope (S antigen), reverse-transcriptase/polymerase (Pol) and HBx proteins [9, 14](Figure 3). While the mechanism of infection is not well understood, recent evidence suggests dependence on a cell-surface receptor and intracellular signaling factors [15, 16]. The mechanism of viral capsid release and genome delivery to the nucleus has not yet been defined. After the partially double-stranded, circular DNA genome enters the nucleus, the single-stranded DNA gaps are repaired and the relaxed circular DNA is converted to covalently-closed-circular DNA (cccdna), which acts as the template for all HBV transcripts (Figure 4). These transcripts are exported out of the nucleus into the cytoplasm where they are translated to the different HBV proteins. The largest HBV RNA transcript is the pregenomic RNA, which serves as the template for viral genome replication. The pgrna is packaged with the reverse transcriptase into viral capsids in the cytosol and is reverse transcribed to generate the partially double-stranded HBV DNA genome. During

11 4 replication the encapsidated viral genome is either recycled back to the nucleus to replenish the pool of cccdna or buds into the endoplasmic reticulum and is enveloped within the hepatitis B surface proteins for secretion from the infected hepatocyte using the host secretory machinery. The molecular mechanisms that link a chronic HBV infection to HCC development are incompletely understood, but are likely subtle considering that HBV-associated HCC occurs in the context of a long-term chronic HBV infection [17]. The mechanisms that are thought to underlie oncogenic transformation of hepatocytes include inflammation-mediated destruction and liver regeneration, integration of HBV DNA into the genome of host cell and the effect of viral proteins. Patients with active HBV replication and high viral loads are believed to be at a higher risk to develop HCC then those with a low viral load [18]. Therefore, HBV replication is considered to be important in carcinogenesis of HBV infected hepatocyte.

12 5 Figure 3. Hepatitis B virus genome. Inner arrows represent open reading frames. Outer arrows represent mrnas. Enhancer (EN); Direct Repeat (DR); Precore (PC); terminal protein (TP); 1/3182 (nucleotide 1 and 3182 of circular genome). Source of Figure: available on request from M. J. Bouchard [9]. Figure 4. Hepatitis B Virus life cycle. Source of Figure: available on request from M. J. Bouchard [9].

13 6 1.3 MicroRNA Biogenesis and Function MicroRNAs (mirnas) are a class of small non-coding RNAs about 22nt in length. Mature mirnas can function as posttranscriptional regulators by interacting with the 3 -untranslated region (3'UTR) of protein-coding genes to cause mrna degradation and inhibition of translation [19]. So far, ~1600 mirnas based on mirbase have been identified in the human genome, each with the potential to regulate multiple protein-coding genes [19]. MiRNAs are either encoded by their own genes containing one (monocistronic) or multiple (polycistronic) stem-loop structures, or are intronic, with the stem-loop structures found within the introns of other genes. They are transcribed as primary micrornas (pri-mirnas), with lengths from hundreds to thousands of nucleotides. The first step in the biogenesis of mature mirnas is recognition in the nucleus of these stem-loop structures within the pri-mirnas by an RNAse microprocessor complex consisting of DGCR8 and Drosha. This complex removes the flanking sequence around the hairpin leaving a ~60-90nt double-stranded hairpin structure known as a precursor mirna (pre-mirna). Then the pre-mirna is transported by the Exportin- 5/Ran-GTPase shuttle from the nucleus to the cytoplasm where it is recognized by another enzyme, Dicer, which further processes it to leave a double-stranded RNA of about 22nt in length. One of these strands is then bound by an argonaute protein, forming the RNA-induced silencing complex (RISC), which is the functional unit that mediates recognition and downregulation of target mrna [19-21].

14 7 Figure 5. A schematic of mirna biogenesis. MicroRNAs are initially transcribed by RNA polymerase enzymes (mainly Pol II) to pri-mirna. Pri-miRNAs are then sequentially cleaved to the precursor hairpin mirna (~60nt) and then the mature mirna (22nt) by dsrna-specific ribonucleases, Drosha and Dicer, respectively. One single strand of this mature mirna duplex is incorporated as part of the RNA-induced silencing complex (RISC) creating a functional complex [22]. 1.4 microrna expression profiles in HCC Growing evidence has revealed that mirnas have been associated with a wide spectrum of cellular processes, including cell proliferation, apoptosis, development, differentiation and the immune response [20, 23, 24]. Furthermore, mirna expression profiling of human cancers has identified numerous mirnas that may play a role in development of tumors, including HCC [25, 26]. Several studies have demonstrated that a panel of mirnas, including, mir-18, mir125a, let- 7a, and mir-122, are aberrantly expressed in HCC tissues when compared to non-tumor tissues.

15 8 This suggests that these mirnas may potentially play a role in cellular and pathological processes of hepatocyte malignant transformation [27, 28]. Previous research comparing mirna expression profiles across five different human cancers demonstrated that over 60% of aberrantly expressed mirnas in HCC do not overlap with breast, colon, prostate, and lung cancer, suggesting that an HCC-related liver mirna signature contain unique characteristics only related to HCC [19]. 1.5 microrna and HBV replication Persistent replication is the hallmark of chronic HBV infection in the liver, and is considered an important risk factor for developing cirrhosis, liver failure and HCC [1, 2, 29, 30]. The mechanisms that underlie the establishment of a life-long infection with HBV, however, remain unclarified. This has led to speculation that the association between viral factors, such as viral proteins, and host specific factors, such has mirna expression, may contribute to the chronic infection with HBV [31]. Recent work has produced controversial results on the relationship between certain mirnas and their potential positive or negative effects on HBV replication [31-34]. For example, mir-122, a liver-specific mirna, accounts for over 50% of the total mirna in a hepatocyte. Recent studies have reported that mir-122 is down-regulated in HCC but upregulated in the serum of chronically infected HBV patients and other studies have suggested mir-122 may potentially be involved in HBV replication [19, 27, 28, 31, 33]. Understanding the mechanism of maintenance of a persistent HBV infection in the liver is essential for developing new strategies against HBV as well as preventing HBV-mediated liver disease, including HBVassociated HCC.

16 9 II METHODS 2.1 Cell culture Human hepatoma cell lines, HepG2 and HepG2.215, were maintained in Minimum Essential Media (MEM) supplemented with 10% FBS, 1X MEM Non-essential amino acids, 1mM sodium pyruvate and 10ug/ml gentamycin and kept at 37 o C in 5% CO 2. The HepG2 cell line was purchased from American Type Culture Collection (Manassas, VA) and the HepG2.215 cell line was a gift from Dr. Laura Steel (Department of Microbiology and Immunology, Drexel University College of Medicine). The HepG2.215 cell line, originally derived from the HepG2 line, stably expresses HBV from two integrated head-to-tail dimers of the HBV genome [35]. Primary rat hepatocytes (PRH) used in these studies were freshly isolated using a two-step perfusion protocol which has been described elsewhere [36]. PRH were seeded in 5X rat-tail collagen-coated 6-well tissue culture plates at approximately cells per well (~80% confluent). Cells were maintained in Williams E medium supplemented with 2.0mM L- glutamine, 1.0mM sodium pyruvate, 4.0ug/mL Insulin/Transferrin/Selenium (ITS), 5.0ug/mL hydrocortisone, 5.0 ng/ml epidermal growth factor (EGF) and kept at 37 o C in 5% CO 2. After plating, PRH were allowed a recovery period to attach to the plate (typically ~2 hours), at which point fresh medium was put on the cells supplemented with 2% dimethyl sulfoxide to aid in maintaining differentiation. The culture medium was replaced every morning until the cells were ready for collection. Expressions of hepatocyte-specific differentiation/de-differentiation marker genes were monitored throughout the time course of the experiments.

17 Cell transfection and RNA isolation HepG2 cells were transfected using X-tremeGENE HP DNA Transfection Reagent (Roche, Indianapolis, IN) according to the manufacturer s protocol. All transfections were performed 24 hours after plating. Total RNA isolation was performed using TRIzol reagent (Life Technologies, Carlsbad, CA) according to the manufacturer s protocol with the exception of an additional acid phenol/chloroform extraction prior to RNA precipitation. 2.3 Plasmids PRH-derived oligo(dt)-primed reverse transcription was performed to prepare differentiation marker cdna, including Albumin (Alb), hepatocyte nuclear factor 4α (HNF4α) and connexin 43 (cx43). These cdna were amplified by PCR using Phusion High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, MA) using primers containing restriction enzyme cleavage sites described below (Table 1). The PCR products were cloned into the BamHI and HindIII sites of the pcdna3.1(-) vector (Life Technologies) (Figure 6). Plasmids were confirmed by sequencing and corresponding PCR amplification. The pcdna-transferrin (TFN) plasmid was constructed by a previous lab member using this same protocol.

18 11 Figure 6. Schematic diagram of plasmid construction. Source from pcdna 3.1( ) user manual, invitrogen Table 1. Primer Sequence and Annealing Tm of each oligonucleotide Primer Name Annealing Tm( ) Sequence 5' to 3' Alb_BamHI_For 68 CAGGGATCCAAAGCACTGGTCGCAGCTGTCCG Alb_HindIII_Rev 68 GCAAGCTTTCGCTGGCTCATACGAGCTACTGCC TFN_BamHI_For 69 GCAAGCTTGGCTCAGGAACACTTTGGC TFN_HindIII_Rev 69 CGGATCCGTTGTTCCAGTTGATGCTGG HNF4α _BamHI_For 68 CAGGATCCAGTGCTGCCTTGGACCCAGCC HNF4α _HindIII_Rev 68 GCAAGCTTGGCACACAGGGCACTGACACC cx43_bamhi_for 64 GCGGATCCGAGGTGCCCAGACATGGGT cx43_hindiii_rev 64 GCAAGCTTAGCACTGACAGCCACACCT *nucleotides in bold are the restriction enzyme cutting site

19 12 The pgemhbv(payw1.2) plasmid, which contains a 130% unit length cdna copy of the HBV genome, has been previously described [37-39]. Transfection pgemhbv in immortalized liver cell lines was used to bypass the infection stages while allowing study of HBV replication and investigation of the interaction between HBV replication and mir-122 expression. The psicheck- 2 vector (Promega, Madison, WI), which contains both the Renilla and firefly luciferase reporter genes, allows the quantitation of levels of functional mirna through mirna-mediated silencing of Renilla expression. The firefly reporter gene is included in this vector as a intraplasmid transfection normalization reporter allowing the Renilla luciferase signal, which will fluctuate, to be normalized to the firefly luciferase signal, which should remain constant. The psicheck-mir- 122 plasmid, which has the reverse complement of the mature mir-122 sequence cloned into the 3 -UTR of Renilla, is used to monitor mir-122 function as changes in the levels of functional mir-122 will result in changes in the amount of silencing of Renilla expression. The puc-u6-mir- 122, a plasmid containing the mir-122 stem-loop sequence, has been shown to effectively express functional mir-122 and was kindly provided by Dr. Laura Steel. 2.4 Quantitative Reverse Transcription-Polymerase Chain Reaction (qrt-pcr) DNase Treatment of RNA Samples Prior to RT-PCR RQ1 RNase-Free DNase (Promega, Madison, WI) that degrades both double-stranded and singlestranded DNA was used to remove residual DNA from RNA samples according to the manufacturer s protocol with the exception that 0.1U/µg RNA was used instead of 1U/µg RNA.

20 RT-PCR and Real-Time RT-PCR analysis of gene expression DNase treated RNA was subjected to reverse transcription (RT) and the resultant cdna was amplified by standard polymerase chain reaction (PCR) or Real-Time PCR (qpcr). Standard RT- PCR was utilized in studies to examine levels of primary mirnas in response to HBV replication. qrt-pcr was applied to quantify Albumin (Alb), transferrin (TFN), hepatocyte nuclear factor 4α (HNF-4α) and connexin 43(CX43) gene expression as markers in differentiated hepatocytes. RT reactions were performed on 3μg total DNase treated RNA using murine muloney-leukemia virus reverse transcriptase and oligo(dt) (New England Biolabs) using a one-step RT protocol (37 C 60min followed by 95 C 10 min). Standard PCR reactions were performed in a final volume of 25 μl with Taq 2X MasterMix (New England Biolabs) and specific primers (Table 2). Thermocycling conditions for these reactions consisted of an initial denaturation step at 95 C for 30 seconds, followed by 30 cycles of 95 C for 15 seconds, primer annealing for 30 seconds, and elongation at 72 C for 30 seconds with a final elongation at 72 C for 10mins and incubation at 4 C. qpcr was performed in a 20ul final volume containing 2X SYBR Green II Master Mix (Life Technologies), 500 nm of each specific primer and 50ng of cdna. PCR amplification was run using the CFX96 TM Real-Time PCR Detection System (BIO-RAD) under the following conditions: initial polymerase activation for 10min at 95 C, followed by 40 cycles of 2-step amplification with 15s at 95 C and 1min at 61 C ~70 C, depending on the primer pair (Table 3). SYBR Green fluorescence was monitored at the end of each cycle to obtain a measure of the amount of PCR product formed. At the end of the amplification protocol, melting curve analysis was added to confirm the specificity of amplification by heating up sample to 95 C at a rate of 0.1 C/s. Each

21 14 PCR product gave rise to a specific melting temperature. All experiments were replicated triplicate for each gene with duplicate sample and no template controls were run for each primer set. Table 2. Primer Sequence and Annealing Tm of each oligonucleotide for primary mirnas Primer Name Annealing Tm( ) Sequence 5' to 3' Product Length(bp) pri-let7a_f 68 AAGTCTGCATTCGTGGATCTAGT 146 pri-let7a_r 68 CTGCCCATTCCCATCATCTAC pri-mir-122_f 62 TTCGTGCGCGACTTGAC 65 pri-mir-122_r 62 ATGACGGAGAGTACATAAGACAAAACTTC Table 3. Primer Sequence and Annealing Tm of each oligonucleotide for qpcr Primer Name Annealing Tm( ) Sequence 5' to 3' Product Length(bp) qpcr_alb For 68 AAAGCACTGGTCGCAGCTGTCCG 105 qpcr_alb_rev 68 TCGCTGGCTCATACGAGCTACTGCC qpcr TFN_For 69 TTACGGGTGCCCCCAAGGATGGACT 127 qpcr_tfn_rev 69 ATTTCACTGGCGCGCTGTCGATGG qpcr_ HNF4α _For 68 AGTGCTGCCTGGACCCAGCCT 138 qpcr_ HNF4α _Rev 68 GGCACACAGGGCACTGACACCC qpcr_cx43_for 64 GAGGTGCCCAGACATGGGT 99 qpcr_cx43_rev 64 AGCACTGACAGCCACACCT

22 15 Because mature mirnas are too short (~22nt) to accommodate an adequate primer pair (>40- nt) in a standard qrt-pcr, we utilized the TaqMan Small RNA Assays (Life Technologies) specifically for mir-122 and let-7a. For these assays, the RT-primer contains 6 complementary nucleotides of the mature mirna sequence and a 44-nt highly stable stem-loop structure which lengthens the target cdna. The forward PCR primer includes appropriate 5 nucleotides to obtain an appropriate Tm. A universal reverse primer derived directly from the sequence within the added stem-loop can be applied for all qpcrs by using the same 44-nt stem-loop sequence for all RT primers. For detection of amplification, a minor groove binder (MGB) is conjugated to mirna-specific probe allowing the specific detection of newly synthesized cdna derived from mature mirna template Real-Time data analysis The raw PCR data were obtained by dividing background fluorescence generated during the cycling process for each sample. Then the amplification cycle at which each sample crossed a set fluorescence threshold was determined by the software. This cycle number, called the C T value for threshold cycle, is inversely proportional to the log of the initial amount of input template. Given that PCR amplification occurs exponentially, a difference of one C T value corresponds to an approximately two-fold difference in relative transcript templates. ΔΔC T method is used for measuring the fold change in mirna expression levels between experimental samples. The results are then expressed as fold change relative to a calibrator. First, we got the raw Ct value, and then we use the Ct value of endogenous control minus CT value of target to obtain ΔC T. snorna, a small non-coding RNAs which is expressed both abundantly and stably was chose as

23 16 endogenous control. ΔΔC T equals to the ΔC T of target minus ΔC T of calibrator sample. The final step is to calculate the relative quantities, RQ, which equals 2 to the power of minus ΔΔC T value. For instance, ΔΔC T =- 2 led to RQ = 4, means there is a 4-fold overexpression of microrna in target sample compared to control (Figure 7). For determining the level of expression of the PRH differentiation marker genes, we applied an absolute quantitation real-time PCR assay in which the target gene expression was determined relative to a standard curve of known copy numbers of the target. This standard curve was based on amplification of the differentiation marker plasmids described in section 2.3 and the relative fold-changes between samples at different time points were compared to each other. GAPDH was used as a reference gene to normalize the amount of input template for each sample. Expression levels of the markers were determined by converting the C T to copy number using the formula for the linear regression of the standard curve. Obtained initial C T values C T >40 is considered undetectable ΔC T = mean C T of endogenous control - mean C T of target Normalized to endogenous control snorna202 is used as endogenous control ΔΔC T = ΔC T of target - ΔC T of calibrator sample EX: Compare HepG2.215 (target)to HepG2 cells (calibrator) RQ = 2-ΔΔC T Relative quantities EX: ΔΔCT = -2, RQ = 4, there is a 4-fold overexpression of microrna in HepG2.215 compared to HepG2 Figure 7. Overview of competitive C T method.

24 Western Blot Analysis Cells were lysed in Radio-Immunoprecipitation Assay (RIPA) Buffer (Sigma, St. Louis, MO) and separated on 12% SDS-polyacrylamide gel. Proteins were then transferred to nitrocellulose membrane (Bio-Rad) and blocked in 5% milk at room temperature for 2 hours. Blots were then incubated overnight at 4 C with primary antibody, followed by washing with 1X Tris-buffered saline (TBS) plus 0.1% Tween-20 (TBST), incubation with appropriate IR-dye conjugated secondary antibody for an hour at room temperature, additional washing with TBST, and analysis using the Odyssey infrared imaging system (Licor Biosciences, Lincoln, NE) according to the manufacturer s instructions. HBV core protein was detected using a 1:1000 dilution of rabbit anti-core polyclonal antibody (Dako, Carpenteria, CA), with a 1:5000 dilution of mouse anti-βactin (Sigma, St. Louis, MO) used to confirm equal protein loading. 2.6 Luciferase Assay Cell lines were co-transfected with psicheck-2 or psicheck-mir-122 and either puc-u6-mir-122 expression plasmid, pgemhbv, or pcdna as a control, where appropriate. Cells were also cotransfected with a dsred expressing plasmid to confirm equal transfection efficiency. Firefly and Renilla luciferase activities were determined using the Promega Dual-Glo Luciferase Assay System (Promega) according to the manufacturer s instructions. Mature mir-122 function was analyzed by relative reporter activity obtained by normalization of Renilla luciferase activity to firefly luciferase activity.

25 HBV replication assay Cytoplasmic core particle-associated HBV DNA was extracted and viral DNA was subjected to Southern blot analysis for HBV DNA replication intermediates (relaxed circular, double stranded, and single stranded DNA) using 32 P-labeled HBV DNA as the probe. The smear visible on the blot represents second strand of the partially double stranded DNA, which is completed to varying lengths.

26 19 III. Results 3.1 Up-regulation of mature mir-122 in the HepG2.215 cell line mir-122, the most abundant liver-specific mirna, has been found to be down-regulated in HBVrelated HCC[19, 40]. However, mir-122 expression in HCC derived cell line remains controversial [40, 41]. To address this question, we attempted to determine mirna expression level differences between HepG2.215 and HepG2 cells by stem-loop qrt-pcr to examine the effect of HBV replication on host mirna levels including mir-122 and let-7a. HepG2.215 cells are an HBVproducing cell line which was initially generated by transfection of HepG2 with pdolthbv-1, a plasmid that contains four 5-3 tandem copies of HBV genome [35, 42]. By comparing HepG2 to HepG2.215 cells, we were able to investigate the HBV-mediated alteration of mir-122 expression levels. As seen in Figure 8, HepG2.215 cells expressed much higher levels of mir-122 than HepG2 cells, but let-7a levels remained unchanged. For mir-122, HepG2.215 cells had a mean fold change of 266 for mir-122 over HepG2 cells (p < 0.05), while the mean fold change was only 2 for let-7a (p >0.05) (Figure 8). These results indicate that expression of mir-122 is higher in HepG2.215 cells relative to their parental cells, HepG2.

27 20 A P < 0.05 B P > 0.05 Figure 8. Detection of mirna expression in HepG2.215 relative to HepG2 cells by qrt-pcr. (A) mir-122 expression in HepG2.215 cells was 266 fold higher than in HepG2 cells. (B) Let-7a expression levels had no significant difference between these two cell lines. Stem-loop RT-qPCR was performed to measure mirna expression levels, and snorna202 was used as endogenous control. Error bars are means +/- SD of three independent experiments including 16 samples. Student s t test was used to calculate the p values.

28 MiR-122 expression is not significantly altered by HBV Although the data implies that mir-122 expression is higher in HepG2.215 cells than HepG2 cell, explanations other than HBV may lead to this result. For example, after decades of differential cell culture, differences may exist between these two cell lines other than simply the expression of HBV, which may suggest that factors other than HBV could affect mirna levels. Because of this, comparing HepG2.215 cells to HepG2 cells, which are already known to express low levels of mir-122, may only be able to provide preliminary information. In addition, because of the continual expression of HBV in HepG2.215 cells, it is impossible to see a direct effect of HBV stimulating expression. To attempt to answer these concerns, we next tested the mir-122 and let-7a expression levels in HepG2 cells at 72 hours after transfection with pgemhbv or a control vector [pcdna3.1(-)] by stem-loop qrt-pcr (Figure 9). The fold change between the samples transfected with pgemhbv and the control transfected cells shows only a slight difference, which indicates that mir-122 and let-7a level were not regulated by HBV in these cells 72hrs after transfection. Importantly, confirmation of HBV viral protein expression was done by western blot for HBV core protein, which was present only in pgemhbv transfected cells (Figure 10).

29 22 Figure 9. mir-122 and let-7a expression changes are not induced by HBV transfection. MiRNA expression levels were measured at 72hrs after transfection with pgemhbv in HepG2 cells by stem-loop qrt-pcr. Normalization was performed using snorna202 and relative mirna levels were calculated compared to pcdna-transfected cells. Error bars represent means +/- SD of two independent experiments including 12 samples. Student s t test was used to calculate the p values. Figure 10. Confirmation of HBV protein expression by western blot after HepG2 cell transfection. HBV core protein was detected only in the pgemhbv transfected samples. β-actin was used as a loading control.

30 Confirmation of relationship between mir-122 expression and HBV The previous results have shown that HepG2.215 cells, which express HBV, have higher levels of mir-122 than HepG2 cells, while transfection of HepG2 cells with pgemhbv fails to increase mir-122 expression. To further explore these contradictory results, a luciferase reporter assay was performed to confirm that HepG2.215 cells express more mir-122 than HepG2 cells and to investigate functional level of mir-122 in the system. Both HepG2 and HepG2.215 cell were co-transfected with psicheck2-mir122-target reporter and either the puc-u6-mir-122 expression plasmid or control vector. In addition, both cell lines were transfected with psicheck-2 as a positive control. This reporter plasmid, with two luciferase reporter genes Renilla and firefly, consistently produces both luciferase signals without regulation by mir-122. On the other hand, psicheck-mir122 target plasmid contains a mir-122 targeting sequence at the 3 UTR of Renilla that is target by mir-122. Treatment with the puc-u6-mir-122 expression plasmid would reduce Renilla luciferase activity of the psicheckmir-122 reporter plasmid without affecting firefly luciferase activity. As shown in Figure.11, both HepG2 and HepG2.215 cells produce the lowest luciferase ratio (Renilla divided by firefly luciferase) when co-transfected with psicheck-mir-122 and puc-u6- mir-122 expression plasmid, which validates that this dual luciferase reporter system is able to detect functional mir-122 in the cell. Interestingly, the ratio remained the same in HepG2.215 cells either transfected with psicheck-2 or psicheck-mir-122, indicating that levels of functional endogenous mir-122 may remain the same in this system. A similar effect was seen with HepG2 cells. Though the ratio detected by psicheck-mir-122 seems to be higher in HepG2 cells than in HepG2.215 cells, the pattern was similar to the difference between these two cell types

31 24 transfected with psicheck-2, suggesting that the difference in luciferase activity may be caused by reasons other than endogenous mir-122 level, such as transfection efficiency. Figure 11. Functional investigation of HBV-mediated regulation of mir-122. Both HepG2.215 and HepG2 cells were co-transfected with either psicheck-mir-122 reporter or psicheck-2 reporter along with puc-u6-mir-122 expression plasmid or pcdna3.1(-) as a control, respectively. The luciferase activities were measured at 24 hours after transfection using a dual luciferase assay kit and renilla luciferase is divided by firefly luciferase to produce the ratio.

32 25 In order to confirm that these results actually represent over-expression of mir-122 from the puc-u6-mir-122 plasmid, we repeated this experiment and performed both luciferase assay and qrt-pcr on the same samples. These results show that the mir-122 level increased in both HepG2 and HepG2.215 cells after over-expressing mir-122 compared to the corresponding cell type only transfected with psicheck-2 (Figure 12). Additionally, after transfection with the equal amount of mir-122 plasmid, the relative level of mir-122 in HepG2 and HepG2.215 cells appeared to be dramatically different (228 fold change and 2.25 of fold change respectively). This result indicates that the endogenous mir-122 level was different in these two cell types, which would explain why after calculating fold change by relative to different endogenous level, the fold change became different even with the same amount of expression. These results verified the successful over-expression of mir-122 in the system and the ability of the luciferase reporter system to test functional mir-122. Together, these data suggest that HepG2.215 cells actually express more endogenous mir-122 but this level may not be enough to cause any functional consequence.

33 Figure 12. Real-time PCR analysis of mir-122 expression levels. ΔΔC T method was applied to generate fold-change of mir-122. All the C T values of samples were normalized to snorna to generate ΔC T and then relative to calibrator samples, psicheck2 to obtain ΔΔC T. A and B represent HepG2 and HepG2.215 cell, respectively. Calibrator samples fold-change was set to be one. Same samples tested as in mir-122 functional assay. 26

34 27 To further confirm the above conclusion, we performed the mir-122 functional assay on HepG2 cells transfected with pgemhbv. All of the cells were transfected with psicheck-mir-122 reporter. However, the system responded to HBV infection in the opposite way in these two independent experiments. Renilla activities were down-regulated after transfection with pgemhbv in figure 13 (A) but were up-regulated in another experiment (B). It is possible that HBx, a protein encoded by HBV, activated both promoters of Renilla gene and firefly gene in different efficiencies in the system, ultimately changing the final ratio of the luciferase luminescence. The luciferase assay could not determine the regulation of HBV on mir-122 expression in HBV-transfected HepG2 cells. A Mean ratio of Renilla/Firefly pcdna 3.1 pgemhbv mir-122 expression

35 28 B Mean ratio of Renilla/Firefly pcdna 3.1 pgemhbv mir-122 expression - - Figure 13. Detection of functional mir-122 in the context of HBV by luciferase assay. All cells were transfected with psicheck-mir-122 plasmid as described in Methods. HepG2 cells were cotransfected with pgemhbv or pcdna as positive control or overexpression of mir-122 as negative control. The background luciferases ratio was shown on sample transfected with pcdna. (A) The ratio has been decreased after transfected with pgemhbv. (B) The ratio has been increase after transfected with pgemhbv as compare to pcdna3.1. Overexpression of mir-122 with or without HBV could repress the luciferase activities. 3.4 Overexpression of mir-122 enhances HBV replication Above results show that mir-122 is expressed more in HepG2.215 cell, while it had not been increased in HBV infected HepG2 cells, which is the discrepant results from previous studies [27, 28, 31], in turn, the influences of mir-122 in HBV replication could also be confounded depending on the conflicting HBV-induced alteration on mir-122 expression level. To further access the impact of mir-122 expression on HBV replication, HepG2 cells were co-transfected with pgemhbv and increasing amounts of themir-122 expression plasmid (0ng/ul, 100ng/ul,

36 29 250ng/ul or 500ng/ul). pcdna3.1 (-) was transfected as the negative control. Cells were collected at four days post-transfection. Southern blot was performed to detect HBV DNA replication intermediates (RC-DS-SS DNA) (Figure 14). The result shows that mir-122 expression to 500ng/ul dramatically up-regulated HBV replication in HepG2 cell as compared to untreated control. Figure 14. MiR-122 enhances HBV replication in HepG2 cells. Dose-dependent analysis of the effect of mir-122 overexpression on HBV replication by southern blot was performed at 4 days post-transfection. HepG2 cell were co-transfected with either pgemhbv or pcdna as negative control, and different amount of mir-122 expression plasmid. Results shown are representative samples from 2 independent experiments performed in duplicate. rcdna, dsdna and ssdna are short form for relaxed circular DNA, double-stranded DNA and single-stranded DNA, respectively.

37 Confirmation of continual function of mir-122 expression plasmid in luciferase reporter system To confirm that mir-122 expression plasmid functions normally for four days post-transfection, the luciferase reporter system was applied to confirm functional mir-122. HepG2 cells were cotransfected with either luciferase reporter plasmid psicheck2 or psicheck-mir-122 plasmid along with increasing amount of mir-122 expression plasmid. Although the luciferase activities decreased slightly as time went on, overexpression of mir-122 in HepG2 cell dramatically reducing Renilla luciferase ratio levels and maintained it at a low level throughout the time frame of the experiment, which indicates mir-122 expressed by our plasmid functions efficiently even in our longest experiment (Figure 15). Additionally, the psicheck2 reporter had equivalent luciferase activities throughout the four days of cell culture without effect of mir-122. These results indicate that the mir-122 expression plasmid consistently function for four days.

38 31 Figure 15. Confirmation of functional mir-122 expression plasmid by luciferase reporter system. HepG2 cells were co-transfected with either psicheck-mir-122 or psicheck2 reporter and increasing amount of mir-122 expression plasmid after 24 hours of plating. Cells were collected every 24 hours for four days post-transfection. This is a representative graph from 2 independent experiments performed in duplicate. Error bars represent the standard deviation. 3.6 Creation of standard curve with plasmid DNA template for differentiation markers We constructed the plasmids that express fragment of four hepatocyte-specific marker genes by cloning specific PCR amplified fragment of each differentiation marker gene into pcdna3.1 (-) shuttle (figure 6). Then, the constructed plasmids were used as the plasmid templates for each marker and diluted over tenth-fold from 300,000 to 30 copy numbers. Plotting the C T value versus the log copy number (copy#) of template to create standard curves and applying a bestfit line to generate the linear regression formula (Figure 6). The formula generated from standard curves for Alb, TFN, HNF4α and cx43 are y = x (Fig 16. A), y = x (Fig 16. B), y = x (Fig 16. C) and y = x (Fig 16. D),

39 32 respectively. R 2 which represents the coefficient of determination for each standard curve, Alb, TFN, HNF4a and cx43, is 0.99, 0.97, 0.99 and 0.99, respectively. The perfect liner regression would have a R 2 value of 1, so that our R 2 values which round 0.99 indicate that the absolute amounts of unknown samples interpreted from our formula were very close to the actual number. A log(copy#) pcdna-alb standard curve y = x Ct Value R² = B log(copy#) pcdna-tfn Standard Curve y = x R² = Ct Value

40 33 C y = x Ct Value R² = log(copy#) pcdna-hnf4a Standard Curve D log(copy#) pcdna-cx43 standard curve y = x Ct Value R² = Figure 16. Construction of standard curve for liver-specific differentiation gene markers. Standard curves were built based on plasmid DNA templates for each differentiation markers genes, Alb, TFN, HNF4α and a dedifferentiation marker, cx43 by qrt-pcr. Each template was diluted over a range of 3X10 6 to 30 copy number and linear regression analysis is applied. The formulas generating from the standard curves are used to interpolate the quantities for the unknown samples in the next experiments. All samples were analyzed in triplicate and experiments were performed in duplicate.

41 Confirmation of the differentiation state of Primary Rat Hepatocyte Freshly isolated primary rat hepatocytes (PRH) are a model system that has been utilized in a number of experiments both in our lab and others. The benefit of using cultured PRH is to obtain the experimental result from a more relevant system that is initiated with normal functional hepatocyte. In order to confirm the authenticity of cultured PRH, it is important to monitor the expression of hepatocyte specific differentiation markers, such as albumin (Alb), transferring (TFN), hepatocyte nuclear factor 4 (HNF4), and a dedifferentiation marker connexin43 (cx43) to ensure the hepatocyte maintain the normal, differentiated state. To confirm that the PRH maintained their differentiated state throughout the time course of cell culture, hepatocyte RNA was isolated and qrt-pcr was performed to measure the expression level of differentiation markers genes, including Alb, TFN, HNF4α, and the dedifferentiation marker, cx43 (TaqMan small RNA assay, Invitrogen, Carlsbad, CA). The fold-changes of differentiation marker gene expression that was obtained by comparing each time course samples (24 hrs, 48hrs and 72hrs) to the 0 hr time point samples were only slightly different. cx43, which is only expressed in other cell types or dedifferentiated hepatocytes, is not expressed or below detectable level (Figure 17). The results of qrt-pcr experiment demonstrate that the cultured primary rat hepatocyte maintained expression of all differentiation genes (Alb, TFN and HNF4α) at a relatively similar level throughout the time frame of the experiments.

42 Fold-Change TFN Alb HNF4a Hr 24Hr 48Hr 72Hr Time courses Figure 17 Confirmation of differentiated PRH during cell culture by qrt-pcr. The relative standard curve method is used for determining the expression level of marker genes relative to an endogenous reference RNA, GAPDH to normalize the amount of input template for each sample. Time point zero was chose to be a calibrator sample and set to be one while calculating fold-changes between samples.

43 36 IV Discussion Chronic infection with the Hepatitis B virus (HBV) has been associated with the development of hepatocellular carcinoma (HCC) [2, 43]. HBV -mediated hepatocarcinogenesis is a multifactorial and multistep process involving dysregulation of various cellular signal transduction pathways as well as genetic and epigenetic alterations over a long period of time. The molecular mechanisms underlying HBV-associated HCC are not entirely understood [2, 9, 44]. MicroRNAs (mirna) that regulate various biological processes, including cell proliferation, apoptosis and differentiation may play a role in the development of HCC [26]. Hepatic mirna, mir-122, is the most abundant mirna in the liver and, is known to increase the levels of hepatitis C virus (HCV) RNA in HCV infection by binding directly to the 5 -UTR of the viral genome [45-47]. However, recent evidence suggests that mir-122 decreases HBV replication in both cultured cells and in HBV infected patients [27, 31, 48]. The interplay between HBV and mir-122 remains incompletely understood and therefore, in the present study, we investigated the role of the highly expressed liver-specific mir-122 in regulating HBV replication and also if HBV replication regulates mir-122 expression. 4.1 Regulation of mir-122 by HBV In the current study, we found that HepG cells, which have an integrated HBV genome and produce HBV, expresses more mir-122 as compared to the HepG2 cells. In a recent study, Nelson et al. showed that mir-122 was up-regulated in both; the serum of HBV-infected

44 37 patients and in chronic HBV infected liver biopsy samples as compared to the healthy serum samples and liver tissue, respectively [33]. Interestingly, in another study, mir-122 expression levels were reported to be higher in the HCC group patients as compared to the healthy group, but the levels of mir-122 were lower in the HCC group patients than the chronically HBV infected patients [49]. The results of both suggest that the levels of mir-122 expression are higher in the context of HBV infection. However, several researches showed that mir-122 was down-regulated in the HepG2.215 cells as compared to the HepG2 cells by qrt-pcr, which is the opposite of what we have shown [31, 48]. The fact is that HepG2 cells express little or no mir- 122 as reported by previous studies [40, 50]; therefore, it is possible that the fold-change of mir-122 expression in HepG2.215 cells relative to in HepG2 cells become inaccurate, and ultimately leading to the difference in experimental results. In our study, we examined the effect of HBV expression on the levels of mir-122 in HepG2 cells. The results demonstrated that HBV expression has a minimal effect on the levels of mir-122 in HepG2 cells. In addition, luciferase assays together with the qrt-pcr data confirmed that HepG2.215, which have an integrated HBV genome have higher expression levels of mir-122 as compared to the HepG2 cells, but both cell lines have similar levels of functional mir-122. Wang et al. showed that the expression of mir-122 was suppressed in HBV-infected patients as compared to healthy individuals and also Huh-7 cells that were transfected with HBV expression plasmid, had lower levels of mir-122. Although mir-122 down-regulation with respect to HBV infection has been reported in many studies, HBV-mediated reduction in the levels of mir-122 remains contradictory. It is possible that HBV infection causes global reduction in mirnas expression in hepatocytes, while mir-122still maintains higher percentage of total mirna in the liver cell [33]. However, the mechanism underlying HBV-mediated mir-122 expression change remains poorly understood.

45 Overexpression of mir-122 enhances HBV replication Currently, it is not completely understood how a persistent level of HBV is maintained in chronically HBV infected individuals in the presence of host defense factors. In case of HCV infection, mir-122 is recognized as an essential host factor for HCV RNA propagation and, thereby is considered to be a target of antiviral therapy for HCV [40, 51]. Lanford et al. showed that suppression of mir-122 induced a long-lasting repression of HCV viremia in chronically infected chimpanzees and Miravirsen, a mir-122 inhibitor is in phase II clinical trials, as a potential therapy for HCV infected patients [52, 53]. Contrary to HCV, several recent reports have demonstrated that mir-122 inhibits HBV replication and transfection of mir-122 mimetic represses HBV gene expression, while inhibition of mir-122 increases HBV replication [27, 31]. These studies proposed several potential mechanisms underlying mir-122 mediated inhibition of HBV replication. Chen et al. suggested that mir-122 binds to a highly conserved sequence of HBV pregenomic RNA, which is a bicistronic mrna encoding the viral polymerase and core protein. The base pairing between mir-122 and HBV pregenomic RNA was shown to suppress HBV pol expression, decreased the stability of pgrna and decreased the synthesis of HBV core protein, which ultimately led to lower HBV production [31]. Interestingly, Gramantieri et al demonstrated that cyclin G1 is one of the targets of mir-122 and that cyclin G1 mrna is down regulated upon mir-122 expression in cells [54]. Wang et al. also reported that p53 inhibits HBV replication by preventing the binding of HBV enhancers to the transcription factor hepatocyte nuclear factors (HNF4α), and the interaction between cyclin G1 and p53 influences the inhibitory effect of p53 on HBV transcription. Thus, they speculated that the mir-122-mediated

46 39 repression of HBV replication is due to targeting of cyclin G1 by mir-122, which in turn exerts its effect through p53 [27]. However, the above-mentioned studies raise an important question, if mir-122 decreases HBV replication, how HBV replicates after initial phase of HBV infection since, the level of mir-122 is high in hepatocytes. Our observation that mir-122 expression in HepG2 cells dramatically increase HBV replication in a dose-dependent manner, suggests that after HBV infection high levels of mir-122 in hepatocytes might actually facilitate HBV replication, and therefore targeting mir-122 may be an effective strategy to limit HBV replication in antiviral therapy. Furthermore, previous studies have demonstrated that mir-122 inhibits HBV replication by blocking the binding of HNF4α to HBV enhancer elements; HNF4 itself regulates the expression of mir-122 in hepatocyte [27, 28, 46, 55, 56]. Accordingly, these observations suggest mir-122 and HBV, both need HNFs to facilitate their transcription. It is counterintuitive that HNF4α would enhance HBV replication and also enhance mir-122 expression in the HBV infected patients, where the down-regulation of mir-122 was reported. In addition, Nelson et al. demonstrated that knockdown of Ago2, an essential component of the RISC (RNA induced silencing complex), inhibits HBV replication. In consideration with the role of mir-122 and Ago2 in enhancing HCV replication, it is possible that mirna-122 plays a similar role in enhancing HBV replication that mir-122 and Ago2 may facilitate HBV RNA stability and translation. Several studies have reported the role of mir-122 in regulating HBV replication and more mir- 122 target genes have been identified, such as CUTL1, serum response factor (SRF), insulin-like growth factor 1 receptor (Igf1R), heme-oxygenase-1 (secondary target), and IFN-stimulated gene, NT5CC3. Therefore, mir-122 still, has unidentified functions that can be exerted through its target genes, which may play an important role in HBV replication [56-60].

47 Future directions The role of HBV in regulating mir-122 expression remains controversial. Previous studies have demonstrated that primary mir-122 levels increase upon HBV infection, but the levels of mature mirna remain low [28]. Therefore by measuring the levels of both primary and mature mir-122 in the same samples, could help to identify how mir-122 expression is regulated by HBV. In addition, to further understand the mechanisms of mir-122 mediated enhancement of HBV replication, it is critical to determine the mir-122 target mrnas that might play a role in regulating HBV replication. To further investigate the relationship between mir-122 and HBV replication, additional experiments have to be conducted in cells that express varying levels of mir-122, such as Huh-7 cells to help elucidate the exact roles of mir-122 in HBV replication. Moreover, the experiments conducted in this study were performed in immortalized cell lines, where normal cellular signal transduction pathways are already altered. In an HBV infection scenario, HBV infects hepatocytes that are not immortalized, are normal and are differentiated. Thus, it will be interesting to further explore the alteration of mir-122 by HBV infection in primary hepatocytes, a more biological relevant model system. Cultured primary rat hepatocytes have been shown to remain differentiated for 4-5 days, so that the results would reflect the regulation of mir-122 by HBV and vise-versa in normal differentiated hepatocytes.

48 41 LIST OF REFERENCES [1] H. B. El-Serag and K. L. Rudolph, "Hepatocellular carcinoma: epidemiology and molecular carcinogenesis," Gastroenterology, vol. 132, pp , Jun [2] H. B. El-Serag, "Hepatocellular carcinoma," N Engl J Med, vol. 365, pp , Sep [3] R. Masuzaki, H. Yoshida, R. Tateishi, S. Shiina, and M. Omata, "Hepatocellular carcinoma in viral hepatitis: improving standard therapy," Best Pract Res Clin Gastroenterol, vol. 22, pp , [4] S. Shiina, R. Tateishi, T. Arano, K. Uchino, K. Enooku, H. Nakagawa, Y. Asaoka, T. Sato, R. Masuzaki, Y. Kondo, T. Goto, H. Yoshida, M. Omata, and K. Koike, "Radiofrequency ablation for hepatocellular carcinoma: 10-year outcome and prognostic factors," Am J Gastroenterol, vol. 107, pp ; quiz 578, Apr [5] S. H. Ferlay J, Bray F, Forman D, Mathers C, Parkin D., "Cancer Incidence and Mortality Worldwide," GLOBOCAN [6] A. Ananthakrishnan, V. Gogineni, and K. Saeian, "Epidemiology of primary and secondary liver cancers," Semin Intervent Radiol, vol. 23, pp , Mar [7] F. X. Bosch, J. Ribes, M. Diaz, and R. Cleries, "Primary liver cancer: worldwide incidence and trends," Gastroenterology, vol. 127, pp. S5-S16, Nov [8] C. Ozen, G. Yildiz, A. T. Dagcan, D. Cevik, A. Ors, U. Keles, H. Topel, and M. Ozturk, "Genetics and epigenetics of liver cancer," N Biotechnol, Feb [9] M. J. Bouchard and S. Navas-Martin, "Hepatitis B and C virus hepatocarcinogenesis: lessons learned and future challenges," Cancer Lett, vol. 305, pp , Jun [10] V. Purohit, R. Rapaka, O. S. Kwon, and B. J. Song, "Roles of alcohol and tobacco exposure in the development of hepatocellular carcinoma," Life Sci, vol. 92, pp. 3-9, Jan [11] H. Nakagawa and S. Maeda, "Inflammation- and stress-related signaling pathways in hepatocarcinogenesis," World J Gastroenterol, vol. 18, pp , Aug [12] D. Lavanchy, "Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures," J Viral Hepat, vol. 11, pp , Mar [13] T. L. Wright, "Introduction to chronic hepatitis B infection," Am J Gastroenterol, vol. 101 Suppl 1, pp. S1-6, [14] Y. F. Liaw and C. M. Chu, "Hepatitis B virus infection," Lancet, vol. 373, pp , Feb

49 42 [15] H. Yan, G. Zhong, G. Xu, W. He, Z. Jing, Z. Gao, Y. Huang, Y. Qi, B. Peng, H. Wang, L. Fu, M. Song, P. Chen, W. Gao, B. Ren, Y. Sun, T. Cai, X. Feng, J. Sui, and W. Li, "Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus," Elife, vol. 1, p. e00049, [16] G. Zhong, H. Yan, H. Wang, W. He, Z. Jing, Y. Qi, L. Fu, Z. Gao, Y. Huang, G. Xu, X. Feng, J. Sui, and W. Li, "Sodium taurocholate cotransporting polypeptide mediates woolly monkey hepatitis B virus infection of Tupaia hepatocytes," J Virol, Apr [17] C. W. Shepard, E. P. Simard, L. Finelli, A. E. Fiore, and B. P. Bell, "Hepatitis B virus infection: epidemiology and vaccination," Epidemiol Rev, vol. 28, pp , [18] M. E. Mendy, T. Welzel, O. A. Lesi, P. Hainaut, A. J. Hall, M. H. Kuniholm, S. McConkey, J. J. Goedert, S. Kaye, S. Rowland-Jones, H. Whittle, and G. D. Kirk, "Hepatitis B viral load and risk for liver cirrhosis and hepatocellular carcinoma in The Gambia, West Africa," J Viral Hepat, vol. 17, pp , Feb [19] C. M. Wong, A. K. Kai, F. H. Tsang, and I. O. Ng, "Regulation of hepatocarcinogenesis by micrornas," Front Biosci (Elite Ed), vol. 5, pp , [20] A. Rybak, H. Fuchs, L. Smirnova, C. Brandt, E. E. Pohl, R. Nitsch, and F. G. Wulczyn, "A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment," Nat Cell Biol, vol. 10, pp , Aug [21] Y. Wang, Y. Lu, S. T. Toh, W. K. Sung, P. Tan, P. Chow, A. Y. Chung, L. L. Jooi, and C. G. Lee, "Lethal-7 is down-regulated by the hepatitis B virus x protein and targets signal transducer and activator of transcription 3," J Hepatol, vol. 53, pp , Jul [22] A. J. Asirvatham, W. J. Magner, and T. B. Tomasi, "mirna regulation of cytokine genes," Cytokine, vol. 45, pp , Feb [23] C. Xiao and K. Rajewsky, "MicroRNA control in the immune system: basic principles," Cell, vol. 136, pp , Jan [24] D. Baek, J. Villen, C. Shin, F. D. Camargo, S. P. Gygi, and D. P. Bartel, "The impact of micrornas on protein output," Nature, vol. 455, pp. 64-U38, Sep [25] Y. Wang, A. T. Lee, J. Z. Ma, J. Wang, J. Ren, Y. Yang, E. Tantoso, K. B. Li, L. L. Ooi, P. Tan, and C. G. Lee, "Profiling microrna expression in hepatocellular carcinoma reveals microrna-224 up-regulation and apoptosis inhibitor-5 as a microrna-224-specific target," J Biol Chem, vol. 283, pp , May [26] Y. Murakami, T. Yasuda, K. Saigo, T. Urashima, H. Toyoda, T. Okanoue, and K. Shimotohno, "Comprehensive analysis of microrna expression patterns in hepatocellular carcinoma and non-tumorous tissues," Oncogene, vol. 25, pp , Apr [27] S. Wang, L. Qiu, X. Yan, W. Jin, Y. Wang, L. Chen, E. Wu, X. Ye, G. F. Gao, F. Wang, Y. Chen, Z. Duan, and S. Meng, "Loss of microrna 122 expression in patients with hepatitis

50 43 B enhances hepatitis B virus replication through cyclin G(1) -modulated P53 activity," Hepatology, vol. 55, pp , Mar [28] C. Li, Y. Wang, S. Wang, B. Wu, J. Hao, H. Fan, Y. Ju, Y. Ding, L. Chen, X. Chu, W. Liu, X. Ye, and S. Meng, "Hepatitis B virus mrna-mediated mir-122 inhibition upregulates PTTG1- binding protein, which promotes hepatocellular carcinoma tumor growth and cell invasion," J Virol, vol. 87, pp , Feb [29] D. Ganem and H. E. Varmus, "The molecular biology of the hepatitis B viruses," Annu Rev Biochem, vol. 56, pp , [30] M. S. De Mitri, R. Cassini, and M. Bernardi, "Hepatitis B virus-related hepatocarcinogenesis: molecular oncogenic potential of clear or occult infections," Eur J Cancer, vol. 46, pp , Aug [31] Y. Chen, A. Shen, P. J. Rider, Y. Yu, K. Wu, Y. Mu, Q. Hao, Y. Liu, H. Gong, Y. Zhu, F. Liu, and J. Wu, "A liver-specific microrna binds to a highly conserved RNA sequence of hepatitis B virus and negatively regulates viral gene expression and replication," FASEB J, vol. 25, pp , Dec [32] W. Hu, X. Wang, X. Ding, Y. Li, X. Zhang, P. Xie, J. Yang, and S. Wang, "MicroRNA-141 represses HBV replication by targeting PPARA," PLoS One, vol. 7, p. e34165, [33] C. N. Hayes, S. Akamatsu, M. Tsuge, D. Miki, R. Akiyama, H. Abe, H. Ochi, N. Hiraga, M. Imamura, S. Takahashi, H. Aikata, T. Kawaoka, Y. Kawakami, W. Ohishi, and K. Chayama, "Hepatitis B virus-specific mirnas and Argonaute2 play a role in the viral life cycle," PLoS One, vol. 7, p. e47490, [34] T. Shirasaki, M. Honda, T. Shimakami, R. Horii, T. Yamashita, Y. Sakai, A. Sakai, H. Okada, R. Watanabe, S. Murakami, M. Yi, S. M. Lemon, and S. Kaneko, "MicroRNA-27a Regulates Lipid Metabolism and Inhibits Hepatitis C Virus Replication in Human Hepatoma Cells," J Virol, vol. 87, pp , May [35] M. A. Sells, M. L. Chen, and G. Acs, "Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA," Proc Natl Acad Sci U S A, vol. 84, pp , Feb [36] A. J. Clippinger and M. J. Bouchard, "Hepatitis B virus HBx protein localizes to mitochondria in primary rat hepatocytes and modulates mitochondrial membrane potential," J Virol, vol. 82, pp , Jul [37] M. Melegari, P. P. Scaglioni, and J. R. Wands, "Cloning and characterization of a novel hepatitis B virus x binding protein that inhibits viral replication," J Virol, vol. 72, pp , Mar [38] P. P. Scaglioni, M. Melegari, and J. R. Wands, "Biologic properties of hepatitis B viral genomes with mutations in the precore promoter and precore open reading frame," Virology, vol. 233, pp , Jul

51 44 [39] P. P. Scaglioni, M. Melegari, and J. R. Wands, "Posttranscriptional regulation of hepatitis B virus replication by the precore protein," J Virol, vol. 71, pp , Jan [40] C. L. Jopling, M. Yi, A. M. Lancaster, S. M. Lemon, and P. Sarnow, "Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA," Science, vol. 309, pp , Sep [41] D. Goergen and M. Niepmann, "Stimulation of Hepatitis C Virus RNA translation by microrna-122 occurs under different conditions in vivo and in vitro," Virus Res, vol. 167, pp , Aug [42] K. W. Livezey, D. Negorev, and D. Simon, "Hepatitis B virus-transfected Hep G2 cells demonstrate genetic alterations and de novo viral integration in cells replicating HBV," Mutat Res, vol. 452, pp , Sep [43] A. M. Di Bisceglie, "Hepatitis B and hepatocellular carcinoma," Hepatology, vol. 49, pp. S56-60, May [44] S. Ahmad, "Hepatocellular carcinoma," N Engl J Med, vol. 328, p. 65, Jan [45] C. L. Jopling, "Regulation of hepatitis C virus by microrna-122," Biochem Soc Trans, vol. 36, pp , Dec [46] H. Sendi, "Dual Role of mir-122 in Molecular Pathogenesis of Viral Hepatitis," Hepat Mon, vol. 12, pp , May [47] S. Ura, M. Honda, T. Yamashita, T. Ueda, H. Takatori, R. Nishino, H. Sunakozaka, Y. Sakai, K. Horimoto, and S. Kaneko, "Differential microrna expression between hepatitis B and hepatitis C leading disease progression to hepatocellular carcinoma," Hepatology, vol. 49, pp , Apr [48] C. G. Fan, C. M. Wang, C. Tian, Y. Wang, L. Li, W. S. Sun, R. F. Li, and Y. G. Liu, "mir-122 inhibits viral replication and cell proliferation in hepatitis B virus-related hepatocellular carcinoma and targets NDRG3," Oncol Rep, vol. 26, pp , Nov [49] J. Zhou, L. Yu, X. Gao, J. Hu, J. Wang, Z. Dai, J. F. Wang, Z. Zhang, S. Lu, X. Huang, Z. Wang, S. Qiu, X. Wang, G. Yang, H. Sun, Z. Tang, Y. Wu, H. Zhu, and J. Fan, "Plasma microrna panel to diagnose hepatitis B virus-related hepatocellular carcinoma," J Clin Oncol, vol. 29, pp , Dec [50] C. Coulouarn, V. M. Factor, J. B. Andersen, M. E. Durkin, and S. S. Thorgeirsson, "Loss of mir-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties," Oncogene, vol. 28, pp , Oct [51] J. I. Henke, D. Goergen, J. Zheng, Y. Song, C. G. Schuttler, C. Fehr, C. Junemann, and M. Niepmann, "microrna-122 stimulates translation of hepatitis C virus RNA," EMBO J, vol. 27, pp , Dec

52 45 [52] R. E. Lanford, E. S. Hildebrandt-Eriksen, A. Petri, R. Persson, M. Lindow, M. E. Munk, S. Kauppinen, and H. Orum, "Therapeutic silencing of microrna-122 in primates with chronic hepatitis C virus infection," Science, vol. 327, pp , Jan [53] H. L. Janssen, H. W. Reesink, E. J. Lawitz, S. Zeuzem, M. Rodriguez-Torres, K. Patel, A. J. van der Meer, A. K. Patick, A. Chen, Y. Zhou, R. Persson, B. D. King, S. Kauppinen, A. A. Levin, and M. R. Hodges, "Treatment of HCV infection by targeting microrna," N Engl J Med, vol. 368, pp , May [54] L. Gramantieri, M. Ferracin, F. Fornari, A. Veronese, S. Sabbioni, C. G. Liu, G. A. Calin, C. Giovannini, E. Ferrazzi, G. L. Grazi, C. M. Croce, L. Bolondi, and M. Negrini, "Cyclin G1 is a target of mir-122a, a microrna frequently down-regulated in human hepatocellular carcinoma," Cancer Res, vol. 67, pp , Jul [55] Z. Y. Li, Y. Xi, W. N. Zhu, C. Zeng, Z. Q. Zhang, Z. C. Guo, D. L. Hao, G. Liu, L. Feng, H. Z. Chen, F. Chen, X. Lv, D. P. Liu, and C. C. Liang, "Positive regulation of hepatic mir-122 expression by HNF4alpha," J Hepatol, vol. 55, pp , Sep [56] H. Xu, J. H. He, Z. D. Xiao, Q. Q. Zhang, Y. Q. Chen, H. Zhou, and L. H. Qu, "Liver-enriched transcription factors regulate microrna-122 that targets CUTL1 during liver development," Hepatology, vol. 52, pp , Oct [57] L. Qiu, H. Fan, W. Jin, B. Zhao, Y. Wang, Y. Ju, L. Chen, Y. Chen, Z. Duan, and S. Meng, "mir-122-induced down-regulation of HO-1 negatively affects mir-122-mediated suppression of HBV," Biochem Biophys Res Commun, vol. 398, pp , Aug [58] J. Hao, W. Jin, X. Li, S. Wang, X. Zhang, H. Fan, C. Li, L. Chen, B. Gao, G. Liu, and S. Meng, "Inhibition of alpha interferon (IFN-alpha)-induced microrna-122 negatively affects the anti-hepatitis B virus efficiency of IFN-alpha," J Virol, vol. 87, pp , Jan [59] S. Bai, M. W. Nasser, B. Wang, S. H. Hsu, J. Datta, H. Kutay, A. Yadav, G. Nuovo, P. Kumar, and K. Ghoshal, "MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib," J Biol Chem, vol. 284, pp , Nov [60] C. Zeng, R. Wang, D. Li, X. J. Lin, Q. K. Wei, Y. Yuan, Q. Wang, W. Chen, and S. M. Zhuang, "A novel GSK-3 beta-c/ebp alpha-mir-122-insulin-like growth factor 1 receptor regulatory circuitry in human hepatocellular carcinoma," Hepatology, vol. 52, pp , Nov 2010.