Transcription, Translation & Protein Synthesis
|
|
|
- Chastity Janice Parker
- 7 years ago
- Views:
Transcription
1 Transcription, Translation & Protein Synthesis
2 Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make, and some we can t There are infinite combinations of amino acids Can be hundreds or thousands monomers long These long chains are called polypeptide chains
3 Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus in the cytoplasm. Houston, we have a problem.
4 Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA RNA is used to carry these messages.
5 Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mrna carries a message from the DNA to the cytoplasm 2. trna transports amino acids to the mrna to make a protein 3. rrna make up ribosomes, which make protein.
6 Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name ) Contains uracil instead of thymine. RNA is single-stranded, not double-stranded (usually )
7 Ribonucleic Acids (RNA)
8 Protein Synthesis Occurs in TWO steps: 1.Transcription the genetic information from a strand of DNA is copied into a strand of mrna 2.Translation the mrna, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mrna.
9 The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N
10 Step One: Transcription 1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? 3. New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.
11 Step One: Transcription Watch this simplified animation: mat/molgenetics/transcription.swf Watch the more complex animation! ion/gene/gene_a2.html
12 Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT
13 Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA
14 Step 1½: RNA Editing An mrna molecule has to be edited in order to be useful. There s a lot of unnecessary information that needs to be removed. An mrna sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.
15 Step 1½: RNA Editing DNA pre-rna (in nucleus) transcription exon 1 interon exon 2 interon exon 3 RNA editing interon interon RNA (in cytoplasm) exon 1 exon 2 exon 3
16 Step Two: Translation to decode or decipher the meaning of Now that our mrna molecule has been made, it s time for its message to be made into a protein sequence. How does the mrna sequence translate into an amino acid sequence?
17 Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. A T C G phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly
18 Step Two: Translation Watch this simplified animation: mat/molgenetics/translation.swf Watch the more complex animation! ion/gene/gene_a3.html
19 Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mrna sequence into codons. As you just saw and heard, codons are three-base sections of mrna: AUG CGU ACU GAU CGU UCA GAU UGA
20 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA?
21 The Genetic Code
22 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met?
23 The Genetic Code
24 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met arg thr asp arg ser asp???
25 The Genetic Code
26 Step Two: Translation 2. Since each 3-letter combination codes for an amino acid, you need to figure out what amino acid matches up with each codon: AUG CGU ACU GAU CGU UCA GAU UGA met met thr asp arg ser asp STOP
27 RECAP: 1. DNA is transcribed into mrna in the nucleus. 2. The mrna leaves the nucleus and enters the cytoplasm. 3. The protein is translated from the mrna sequence using trna and amino acids.
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Academic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.
Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Nucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Hiding Data in DNA. 1 Introduction
Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA
Modeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process
v vi vii viii ix 1 2 for high school students. For this, research needed to be done to to find a popular and engaging style of animation for this age group. The third step was to design the animation so
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
Molecular Facts and Figures
Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are
Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
Hands on Simulation of Mutation
Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their
Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?
Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their
Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
T C T G G C C G A C C T;
1. (a) Gene is a (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code/read in three s; On sense/coding strand; Triplet coding for amino acid; Degenerate code; non-overlapping;
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
Chapter 17: From Gene to Protein
AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
Proteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS
UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is
The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH
Introduction: The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH In the Puzzle of Life activity, students will demonstrate how the
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
3120-1 - Page 1. Name:
Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.
Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are
Translation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences
Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of
Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water
Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
The Molecules of Cells
The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates
CHAPTER 30: PROTEIN SYNTHESIS
CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino
Chapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464
Call for action: Paradigm shift in teaching microbiology in a community colleges Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Project Course:
Chapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
Chapter 3: Biological Molecules. 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids
Chapter 3: Biological Molecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids Elements in Biological Molecules Biological macromolecules are made almost entirely of just 6 elements: Carbon (C)
Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)
Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)
Insulin mrna to Protein Kit
Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
STRUCTURES OF NUCLEIC ACIDS
CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building
Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell
Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php
Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?
Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.
4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose
1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen
The Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw
Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010
Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277
Lab Next Week Announcements Help Session: Monday 6pm LSS 277 Office Hours Chapter 15 and Translation Proteins: Function Proteins: Function Enzymes Transport Structural Components Regulation Communication
Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
Protein Physics. A. V. Finkelstein & O. B. Ptitsyn LECTURE 1
Protein Physics A. V. Finkelstein & O. B. Ptitsyn LECTURE 1 PROTEINS Functions in a Cell MOLECULAR MACHINES BUILDING BLOCKS of a CELL ARMS of a CELL ENZYMES - enzymatic catalysis of biochemical reactions
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
How To Understand The Chemistry Of Organic Molecules
CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which
CHAPTER 15: ANSWERS TO SELECTED PROBLEMS
CHAPTER 15: ANSWERS T SELECTED PRBLEMS SAMPLE PRBLEMS ( Try it yourself ) 15.1 ur bodies can carry out the second reaction, because it requires less energy than we get from breaking down a molecule of