Making transgenic plants

Transcription

1 5 November 2008 Ljublijana, Slovenia Cost Exploratory Workshop: What role of GM technology in future competitiveness of European agri-food sector? contribution by Ann Depicker VIB, Ghent University, Belgium Making transgenic plants

2 GM technology: Where do we come from? the teams of Jef Schell and Marc Van Montagu understanding crown gall induction 1978 This people are what we called the Ghent Crown gall group

3 1982 Three bacterial elements were found to be required for T-DNA T transfer to plants: Chromosomal genes Virulence genes T-DNA border sequences Genes in the T-DNA are required for tumor growth and opine synthesis but not for T-DNA transfer: therefore, the whole interior part of the T-DNA could be deleted and substituted with any other DNA sequence. UNIVERSITEIT GENT

4 Right terminal repeat = RB Left terminal repeat = LB tggcaggatatataccgttgtaat accgtcctatatatggcaacatta cggcaggatatattcaattgtaaa gcc gtcctatataagttaacattt LB T-DNA RB vir region ori UNIVERSITEIT GENT

5 1983 the first transgenic plants the first selectable markers: kanamycin and chloramphenicol resistance

6

7

8 late 80 s: Binary T-DNA vectors Border sequences are cloned into a repliconthat can replicateinto E. colifor T-DNA construction and into Agrobacteriumfor mobilisationof the constructed T-DNA via a virplasmid to the plant cell Border sequences : Right border (RB) and left border (LB) regions Consists of outer and inner border region RB outerregion contains an overdrive sequence, enhancing T-DNA initiation at the RB Border repeat LB T-DNA RB

9 mid 90s: first GM crops focus on insect resistance: BT variants herbicide resistance UNIVERSITEIT GENT

10 2000 till now: world wide spread and increasing use of GM crops except in Europe Not to grow GM crops in Europe except in Spain is a political decision: Import of approved GM crops is allowed in Europe but commercial production of approved GM crops is not allowed The consumer has a choice: labeling of GM crop derived food/feed is obligatory. However separation of the chains will become more and more costly UNIVERSITEIT GENT

11 Many more GM crops to come. Pest tolerance (viruses, fungi, nematodes..) A biotic stress tolerance (drought, salt, high light..) Yield stability Improved nitrogen uptake efficiency Growth in alkaline or Fe-restricted soils Food quality cfr Cathie Martin Bio-energy production Molecular farming cfr Eva Stoger oils, pharmaceuticals, high value proteins.. Phytoremediation

12 What do we have to make transgenic plants? a series of vector systems various transgene elements a selection system a target plant The use of the transgenic plant determines which criteria are used to screen for a best GM

13 Techniques for plant transformation Agrobacterium-mediated transformation Direct gene transfer Tissue culture * Root * Leaf * Tissue explants * Embryogeniccallus In planta * Seed transformation * Vacuum infiltration * Floral dip Particle bombardement (= Biolistics) Polyethylene glycol (PEG) Electroporation

14 Transgene construction promoter exon1 intron1 exon2 intron2 exon3 terminator mrna 5 UTR AUG coding sequence UAAUAGUGA AAUAAA poly A 3 UTR or cdna 1. promoter and terminator: transcriptional control 2. 5 UTR and 3 UTR: where the transcriptional fusions are made 3. introns are present if a genomic sequence is used 4. coding sequence: especially the codon usage: optimizing the gene sequence can increase protein expression levels several fold

15 What are the transformation frequencies? This is relevant for the question whether selection for a transformed plant is needed or whether a transformed cell could be screened for? If transformation frequencies are far below 1 %, a selection marker is needed. This is no problem for research but there is a lot of opposition to the use of resistance markers in transgenic crops. The main reason is the fear for spread of antibiotic resistance genes.

16 Cocultivation with Agrobacterium and nonselective regeneration transformation of root explants of Arabidopsis thaliana 0 transformants /172 plants transformation of protoplasts of Nicotiana tabacum 26 transformants /140 plants(18%) Conclusion: After cocultivation with Agrobacterium, selection is required to obtain Arabidopsis root explant transformants, but no selection is required to obtain tobacco protoplasts transformants =>different tissues or types of cells have a different competence for transformation

17 Transfer and integration frequencies in Arabidopsis root cells Regenerated plants Number Isolated 84 With a transiently expressed C T-DNA 4/84 (5%) With an integrated C T-DNA (transformation) 0/84 (<1%) Selection is essential to obtain transgenic Arabidopsis plants after root transformation The T-DNA transfer frequency is approximately 5% and thus more than 10-fold above the T-DNA integration frequency

18 Cotransformation frequencies are much higher than expected from the transformation frequencies: this means that especially the integration is limiting the transformation frequencies Co-transformed T-DNAs often co-integrate at the same site and this results in Inverted and tandem repests of integrated T-DNAs

19 Transformation frequencies are determined by: accessibility of the plant cell to be transformed Agrobacterium attachment efficiency and T-DNA transfer competence of the plant cell for T-DNA integration division of the transformed cell

20 Selectable marker genes on the T-DNA Plant transformation is, in many cases, a very-low frequency event; therefore, selection is needed. In most cases, selection is based on the inclusion into the culture medium of a substance that is toxic to plants. The classical selectable markers confer resistance to antibiotics and herbicides. The recent alternatives are metabolic selection markers (eg. pmi and dao) and easily screenable visual markers (eg. dsred, gfp).

21 for instance: a new selectable marker gene on the T-DNA The P35S-dao1 gene (from yeast Rhodotorula gracilis) catalyzes the oxidative deamination of a range of D-amino acids => provides positive and negative selection The marker has been successfully established in Arabidopsis thaliana, and proven to be versatile, rapidly yielding unambiguous results, and allowing selection immediately after germination

22 A gene useful as reporter for transformation: the Green Fluorescent protein (GFP) Advantage of GFP: the assay is non-destructive WT

23 Also seed specific Dsred expression allows to pick immediately the transformed Arabidopsis seeds without any other selection

24 Removal of the selectable marker? Different ways: cotransformation and subsequent segregation, removal via site specific recombination, or screening via PCR based methods for transformants Why remove the selectable marker? Primarily to avoid problems with horizontal gene transfer to pathogenic bacteria. However, this does not seem to happen. Also to allow subsequent transformation with additional transgenes: can be circumvented with crossing and PCR screening.

25 T-DNA integration D T-DNA integration occurs through illegitimate recombination: First, the T-strand is made double stranded in the plant cell Then the ds DNA is integrated at random positions Parallels are seen with double strand break repair (DSB) and non-homologous end joining (NHEJ) via single strand annealing mechanism => T-DNA integration makes use of the plant DNA double strand break repair system

26 plant DNA preinsertion site Target site deletion T-DNA LB junction RB junction 69 T-DNA plant DNA recombination sites were sequenced and subdivided in 3 classes: - 10 % end to end ligations - 50 % junctions with microhomology - 40 % junctions with filler DNA

27 T-DNA integration: integration site can not (yet) be controlled T-DNA: random integration: in genes and between genes - no homology between the T-DNA ends and the plant DNA target - preference for open chromatin regions plant target DNA shows a deletion of approximately 10 to 100 basepairs the ends of the T-DNA are often processed (truncated) up to about 100 basepairs => sequence the integration site and subsequent T-DNA plant junctions to enrich for clean events in between genes

28 T-DNA integration Some transformants contain a single T-DNA copy; however most transformants contain many T-DNA copies at one locus or at 2 or 3 loci Truncated copies may be present and also non-t-dna or vector DNA may occur (skipping of the border sequences) Many transformants contain unlinked point mutations; translocations occur in 10 to 20 % of the transformants and also aneuploidy is found more often then expected. => screen for transformants with a single T-DNA copy and and inbreed this event for several generations

29 PCR analysis T-DNA a b - Allows to screen transgenic plants for integration of T-DNAs that do not contain a selection marker - Allows to screen transgenic plants for the presence of silenced T-DNAs - Allows to screen mixture of plants/crops or food/feed for the presence of GM plants - PCR reaction for internal T-DNA fragments does not allow the determination of copy number of the integrated T-DNAs - Different transformants with the same T-DNA can not be distinguished

30 Identification of transgenic plants by Southern analysis Simple transgene insert T-DNA T1 T2T3T4 T5T6 probe T-DNA / plant junctions The T-DNA plant junctions are different in every transformant; the number of fragments indicates the number of T-DNA copies

31 PCR ANALYSIS CLEAN TRANSGENE 1 1 SCREENING AND DETECTION 2 2 CONSTRUCT SPECIFIC DETECTION 3 3 EVENT SPECIFIC DETECTION

32 Transgene expression variation

33 Determination of GUS activity in 5 T2 plants of 100 transformants obtained after floral dip transformation transgenic plants obtained from 4 different experiments 1000 fold variation in expression of the same transgene

34 Characterization of the T- DNA integration position in 19 single-copy transformants chri FK24 F2D T22J CK2L129 T4K F2K3 CK2L36 CK2L102 CK2L72 F14J T18A F14J CK2L111 F12P F5A CK2L6 CK2L129 F2K16 F2I F14B chrii CK2L148 CK2L107 F21A CK2L94 F4F F13A F2Hsb21 Integration in an intergenic region : 9 Integration in a transcribed annotated gene: 10 events chriii chriv F5E CK2L70 F2Hsb20 F8B In an exon: 7 In an intron: 3 chrv F2Hsb22 F12B CK2L7 MQM F14M FH33 L23H F2Hsb31

35 Conclusions 21 single copy T-DNA transformants, selected on the expression of an antibiotic resistance marker, were identified and characterized In 19/21 single copy lines, gus expression was similar and not silenced; in 2/21 lines transgene expression was more than 20-fold lower - In one of those lines, methylation of the transgene was clearly demonstrated Integration into an intergenic or genic region, into an exon or an intron, in sense or antisense orientation, did not result in differential transgene expression The presence of binary vector sequences in 2 single copy lines did not have a negative influence on transgene expression

36 Conclusions Single-copy transformants were not the highest expressers This implies that multicopy loci are not always inducing transgene silencing. What is triggering the silencing in multicopy loci is not known Only very few transformants have no expression of the GUS reporter gene: this means that complete silencing of a transgene in the first generation is rather rare. The silencing degree varies in different transformants and is in leaves typically between 20 and 200 fold.

37 Last part: in search of the genes encoding agronomic traits What to use? How to find the genes? Expression data, mutant phenotypes, yeast complementation, functional assays, prediction, Functional genomics in planta screens Endogenous genes Heterologous genes Bacterial Yeast Physcomitrella patens

38 New generation of GM plants: fi drought tolerance

39

40 Plate-based screen of > 1,500 overexpressed transcription factors Drought assay (soil grown) ~ 40 different transcription factors regulate drought tolerance NF-YB (Nelson et al., 2007) Survival assay Improved drought physiology

41 Field efficacy trials Molecular phenotyping indicates New mode of action Healthier transgenics: Less leaf rolling Higher chlorophyll index Higher photosynthesis rate Cooler leaf temperature Higher stomatal conductance Nelson et al., 2007 Mendel Biotechnology & Monsanto

42

43 Increased ABA sensitivity No effect on photosynthetic yield Molecular phenotyping: > 80 at least 2.1 fold upregulated. Enrichment for Osmotic Adjustment genes

44 Functional equivalence in cyanobacteria and diatoms between ferredoxin and flavodoxin under iron deficiency Photosynthetic microorganisms compensate Fd decline by inducing Flavodoxins. Flds: ~19kDa with 1 noncovalently bound flavin mononucleotide as prosthetic group Not sensitive to oxidative conditions Efficient replacement of Fd in NADP+ reduction, nitrogen fixation, sulfite reduction,. Flds are restricted to prokaryotes and some eukaryotic algae. Lost in evolution to vascular plants (~Fe abundance in coastal regions). Other Fd-dependent reactions Fld

45 Plants expressing a cyanobacterial flavodoxin in chloroplasts develop increased tolerance to various sources of environmental stress 18 h at 500 µmol quanta m-2 s-1 and 40 o C 3-day water deprivation regime 20 days at 500 µmol quanta m -2 s -1 and 9 o C 20 min to UV-C radiation 18 h to a focused light beam of 2,000 µmol quanta m -2 s -1 1,200 µmol quanta m -2 s -1 for 24 h pfld12-4 pfld4-2 UV-AB radiation for 24 h

46 Future of GM plants in Europe? will depend on the sound and flexible re-evaluation of the legal framework this will determine whether there is a market for GM crops in Europe Anyway, the technology is available to introduce a variety of traits the perspectives promise a future which plant biotechnology optimists have dreamed of since many years