National Institute of Virology

Transcription

1 National Institute of Virology Hepatitis 1. Development of candidate vaccine for Hepatitis E Cloning and sequencing of the entire genome of swine 71 HEV and chimeric swine-human HEV clones 3. Generation of infectius cdna clones for swine 72 and human HEV and chimeric swine- human HEV clones 4. Assessment of host/virus factors leading to 73 fulminant hepatitis 5. Determination of occupational risk of hepatitis 75 E virus in animal handlers 6. Assessment of the role HCV HVR1 and host HLA 76 status in influencing progression of hepatitis C and response to antiviral 7. Genomic characterization of HAV strains In-vitro studies on growth and characterization 78 of Indian HAV isolates 9. Additional studies 79

2 Development of a candidate vaccine for hepatitis E TM Deshmukh KS Lole, VA Arankalle varankalle@yahoo.com Hepatitis E is endemic in India and presents in epidemic as well as sporadic forms. Several large-scale epidemics are reported every year from urban as well as rural parts of India. During epidemics, there is considerable mortality among pregnant women. In sporadic settings, fulminant hepatitis E has been observed in men and non-pregnant women. Infection among travellers to endemic countries is common. Hepatitis E outbreaks have also been shown in military establishments. Sewage workers are at a high-risk of HEV infection. Hepatitis E in HBV and HCV carriers may have serious complications. Therefore highlighting the need for hepatitis E vaccine. Objectives Development of a HEV Vaccine Achievements The project dealing with the evaluation of HEV DNA and DNA-prime-protein boost vaccines in rhesus monkeys was approved by the CPCSEA. Twenty rhesus monkeys were ordered from a registered supplier. The region encompassing amino acids within HEV ORF2 protein has been reported to have neutralizing epitopes. Considering utility of this protein (NE-ORF2) in assessing vaccine-induced immune response, the NE-ORF2 was cloned and expressed in baculovirus and bacterial systems. The protein reacted specifically with human serum samples collected during epidemics, monkey experimentally infected with human HEV and mice immunized with HEV DNA vaccine. Both IgM & IgG antibodies were detected in humans. The protein expressed in bacterial system was purified (27Kda protein). Assessment of cellular response in mice immunized with HEV DNA vaccine To assess the cellular responses generated in HEV DNA vaccine immunized inbred and outbred mice, lymphocyte proliferation assay was done using recombinant ORF2 antigen as the recall antigen. Series of experiments were done in immunized Balb/C mice to find out the optimum time and optimum dose of antigen to be used in CD4+ T cell proliferative response assay. 20 ug/ml was found to be the optimum dose. Lymphocyte proliferative responses were done in control as well as inimmunised mice. Of the 4 inbred test mice, 3 had positive proliferative response with stimulation index > 3, where as none of the 5 control mice responded to ORF2 antigen at the T cell level. Similar immune response is being studied for outbred mice immunized with DNA vaccine. 69

3 Cytokine assays were carried out in DNA vaccine immunized mice to observe the involvement of Th1 cytokine genes that will strengthen the shift towards Th1 immunity characterized by in vivo production of specific IgG2 antibody and CTL response or a Th2 cytokine production, that will enhance IgG1 antibody production followed by abrogation of CTL response.. Both mitogens induced and antigen induced cytokines were estimated. 6 Briefly, PBMCs at a density of 1x10.cells/ml were stimulated with Phytohaemagglutinin-P 0 and Phorbol12-myristate 13-Acetate or with ORF-2 antigen and were incubated at 37 C in 5%CO 2. Time course experiments were done to find out the optimum time at which, there was maximum secretion of IL-2, IL-4, IL-10, IL-12 and IFN-. Culture supernatants from cells 0 stimulated with mitogens and antigen were collected and were frozen at 70 C. ELISA will be done to find out the concentrations of different cytokines. Similarly, for each cytokine, time course experiments were done in normal mice. Future plans Challenge experiments in rhesus monkeys. Evaluation of NE-ORF2 based ELISA in assessing neutralizing antibodies in rhesus monkeys during the challenge experiments. 70

4 Cloning and sequencing of the complete genome of swine HEV and expression of ORF-2 & ORF-3 proteins LP Chobe KS Lole, VA Arankalle The full-length genomic sequence of an Indian swine hepatitis E virus (HEV) isolate (IND- SW-00-1) recovered from feces of a pig experimentally infected with swine HEV pool from western India was determined. The genome consisted of 7240 nucleotides, excluding the poly (A) tail of at least 22 residues and contained three open reading frames (ORFs), ORF1 encoding 1707 amino acids, ORF2 encoding 674 amino acids and ORF-3 encoding 114 amino acids. Comparative full-length genome sequence and phylogenetic analyses suggested that the Indian swine HEV represents a distinct variant among the genotype 4 isolates with a divergence of %. Analyses based on ORF-1, 2 and 3 as well as partial ORF-2 (227 nucleotides) yielded similar results. As compared to type 4 HEV isolates, 26 unique amino acid substitutions were recorded, 16 in ORF-1, 8 in ORF-2 and 2 in ORF- 3. IND-SW showed insertion of 'C' at 5159 position while all other type 4 isolates have insertion of 'U' at the same position. Whether these changes contribute towards observed absence of type-4 HEV infections in Indian patients needs to be determined. 71

5 Generation of infectious cdna clones for swine and human HEV and chimeric swine-human HEV clones KS Lole VA Arankalle The generation of infectious cdna clones has proved useful in the study of various hostvirus interactions and mechanisms of viral replication. In the absence of an in-vitro cell culture system the generation of infectious cdna will prove useful in basic studies. Mechanism of species specificity of HEV could be understood. Objectives To generate infectious cdna clones for swine HEV and human HEV To generate chimera of swine & human HEV. Achievement The full genome cloning of human HEV isolate, (PM2000, genotype 1) from western India was undertaken. The complete HEV genome was amplified as five PCR fragments including 5' end and 3' end and were TA-cloned using pgem-t Easy system. The orientation of individual clones was confirmed by sequencing. These clones are being put together to get a single clone with complete genome. Sequence of the full genome was determined. PM2000 showed maximum homology with the HEV genotype-1 isolate from Nepal, TK15/92 (AF051830) with percent nucleotide identity of 97.5% at the full genome level. The homologies were 95.9± 0.23% and 93.3 ± 0.29% with the three Indian isolates reported from other regions and those genotype I isolates from other Asian countries respectively. It showed 89.06% identity with the type I isolate from Morocco (MOR-03). Future plan Once the complete genome length RNA is obtained for swine and human HEV, transfection experiments will be undertaken in different cell lines for further studies. 72

6 Assessment of host-virus factors leading to fulminant hepatitis E and A AS Tripathy MS Chadha, VA Arankalle anuradhastripathy@hotmail.com Our earlier studies have clearly shown that in sporadic settings, HEV and HAV respectively are mainly responsible for fulminant hepatic failure among adults and children. High mortality among pregnant women remains the characteristic feature of HEV epidemics, though a significant proportion of such women experience subclinical infection. Risk factors for development of FHF are yet to be ascertained. Study of mechanism of FHF may lead to development of appropriate treatment protocols and identification of prognostic markers. Objectives Understand the mechanism(s) of fulminant hepatic failure in cases of HEV and HAV Achievements Cytokines in hepatitis A This year, the study was extended from serum to cultured Peripheral Blood mononuclear cells (PBMC). Blood samples from ten children suffering from self-limiting acute hepatitis A were obtained during epidemics of hepatitis A. Both the Th1 (IL-2, IFN-ã) and Th2 (IL-4, IL- 10) cytokine levels were estimated in the supernatants of mitogen stimulated (PHA-P + PMA) supernatants of lymphocyte cultures using ELISA (ELISA SETS, BD Pharmingen, San Diago, USA). IL-2 levels were significantly elevated when compared with IL-4 levels (128 ± 123 vs 15.3 ± 16.1, p=0). IFN- levels were significantly higher when compared with IL- 10 levels (184 ± 313 vs 12.4 ± , p< 0.01). Levels of significance of cytokines were determined using Student's t-test. Overall, all the acute resolving HAV patients (n=32, serum-based assay; n=10, cultured PBMCs) universally and significantly released IFN-ã suggesting its possible involvement in the elimination of HAV by inducing a direct anti-viral effect. Standardization of Real Time PCR-based quantitation of HAV RNA (Dr K S Lole) Primers and probe corresponding to HCV 5'NCR were designed and used to standardize real time RT-PCR assay for HAV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. Standard curve showed linear relationship (r =0.99) from RNA copies/ reaction. This assay was used to assess the viral load in clinical and subclinical cases. 73

7 HAV viral load and antibody titres in different clinical forms In order to understand if clinical and subclinical hepatitis A cases differ in viral load and anti-hav IgM and IgG titres, 25 clinical and 24 subclinical cases were investigated. This is a single point study. Viremia in clinical cases (6.97 X X 10, mean 4.9 X 10 2 copies/ml) was significantly higher (p < ) than in subclinical cases (6.38 X X 10, mean 2.05 X 10 copies/ml. In clinical cases, viral load was significantly higher in feces (1.58 X X 10, mean 1.51 X 10 ) than in serum (p<0.001). No difference in antibody titres was noted. All patients were infected with genotype IIIA. Hepatitis E As a control group to FHF cases, 47 anti-hev IgM patients from three epidemics, eight HEV- IgM positive and two HEV-IgM negative, HEV RNA positive sporadic patients with uneventful recovery were studied. Of the total 16 fulminant hepatic failure (FHF) cases admitted in Sasoon Government hospital, Pune, nine were IgM-anti-HEV positive. Three of these expired (1 male, 2 females). Sequential samples were obtained from 6 FHF-E patients. Liver biopsy was obtained from one death case. To assess the role of host cellular immune responses in differential outcome of HEV infection, ORF 2 or mitogen specific cytokine assay and ORF 2 specific CD4+ T cell proliferation assays were carried out in all the patients. In most of the acute self-limiting cases, IFN, IL-2 and IL-10 levels were below the detection level of the cytokine ELISA SETS. Out of 6 FHF-E cases for whom sequential samples were collected, two patients expired. IL- 10 levels started decreasing during 9-12 days post onset of hepatic encephalopathy in 3 of th 4 recovered cases. In case of fourth case, sample beyond 7 POD was not available. In contrast, IFN- levels increased during 9-12 days of post hepatic encephalopathy in 2 of th th the 4 recovered cases.for two recovered patients, samples beyond 7 and 10 day post encephalopathy were not available. In death cases, both IL-10 and IFN- levels decreased 7-12 days of post hepatic encephalopathy. Similar pattern of L-10 and IFN- was observed. In remaining 3/9 FHF cases examined. HLA analysis was carried out for 4 patients. 74

8 Determination of occupational risk of Hepatitis E Virus in Animal handlers MS Chadha CS Raut, Arankalle VA mscniv@hotmail.com Recent data generated in several countries suggest zoonotic spread of HEV. In developing countries with inadequate sanitation and overburdened public health infrastructures, more than 50% of sporadic cases of viral hepatitis can be attributed to HEV. To study the role of animals in the spread of hepatitis E among humans, it would be important to evaluate the risk of animal handling in exposure to this virus. Similarly, other high-risk populations need to be studied to evolve definite preventive strategies, if necessary. Objectives Determination of occupational risk of HEV infection among Animal handlers To look for different HEV genotypes in acute cases of hepatitis among animal handlers. Achievements To determine the involvement of animals in transmission of HEV, exposure of animal handlers to HEV was studied. Blood samples were obtained from veterinary doctors after recording a questionnaire. Seventy six percent (26/34) veterinary doctors handling>10 animals/day and 31.5% (30/95) handling<10 animals/day were IgG HEV positive. This was significantly higher exposure as compared to age matched urban population. Future plan Further prevalence studies will be carried out. 75

9 Assessment of role of HCV HVR1 and host HLA status in influencing progression of hepatitis C and response to antiviral therapy. S P Shrotri A S Tripathy, M S Chadha, V A Arankalle varankalle@yahoo.com In order to assess the association of genetic factors with HCV infection, distribution of HLA class I and class II alleles in anti-hcv positive individuals (n= 31) was determined using PCR/SSP typing method (Class I allele reported last year). Haplotype DRB1*11-DQB1*03 was significantly increased among HCV infected individuals when compared with the controls (OR, 6., 1p=0.0001). It seems that in an Indian population, HLA class I and class II alleles play vital roles in disease association in context of HCV infection. Work related to HVR1 was temporarily suspended. 76

10 Genomic characterization of HAV strains S D Chitambar M S Joshi Chitambars@hotmail.com An outbreak of hepatitis that occurred in school children from the state of Kerala was investigated. The etiological agent was identified as HAV. Objectives To characterize the HAV strain(s) that caused an outbreak in school children. Achievements RT-PCR performed using primers specific to VP 1/2A junction region detected HAV RNA in four stool samples and three serum samples. Genotype III A was identified on sequencing of the PCR products. In addition to this, full length genome sequencing of HAV strain recovered from hepatitis A patient associated with Guillain Barre Syndrome was undertaken. Sequencing for 5' NCR, 1A,1B, 3A, 3B,3C, partial 3D and VP1 /2A junction was completed. Sequencing of other parts of genome and analyses are being carried out. 77

11 In vitro studies on the growth and characterization of Indian isolates of Hepatitis A virus R S Fadnis S D Chitambar rahul_fadnis@yahoo.co.in Two primary isolates of HAV (NP, PV ) were obtained from stool specimens of acute HAV infected cases. The viruses were adapted in vero E6 cell line and the caracterization of these isolates is reported in the following section. Objectives To characterize Indian HAV isolates (NP,PV) in tissue culture. The full nucleotide sequencing of HAV isolate NIV IN 97 Achievements Indirect immunofluorescence assay (IFA) was performed on Vero E6 cells infected with NP isolate detected intracytoplasmic presence of HAV antigen at passage level 8. The yield of isolate was monitored by antigen detection ELISA. The S/N ratio for this isolate ranged from upto passage 17 with infectivity titre 1:625 in normal Vero E6 cells. The PV isolate adapted to Vero E6 cells showed S/N ratios for passages 5-8. Further studies are being done on this isolate. Full-length nucleotide sequencing of NIV IN 97 strain of hepatitis A virus (HAV) adapted to BGMK cell line was carried out at passage level 28. As described earlier primers for the sequencing were designed on the basis of HAV strains available in the database. The comparison of sequences with strain HM- 175 revealed changes scattered all over the genome. Sixty-one substitutions, one deletion and poly (A) tail of 30 bases at the 3' end of genome were noted. These changes are being analyzed for synonymous/ nonsynonymous mutations at amino acid level. 78

12 Additional Studies Seroepidemiology of Hepatitis A Virus in Healthy Donors S D Chitambar chitambars@hotmail.com Seroprevalence of anti HAV antibodies was determined in healthy donors from Pune. Serum samples from 475 donors collected during blood donation camps were tested for hepatitis A antibodies of M, G and A class by anti HAV IgM, IgG and IgA capture EILSA tests respectively. Positivity to anti HAV IgM, IgG and IgA was 1.89%, 70.14% and 14.69% respectively in age group. One of the anti-hav IgM positive donors showed presence of HAV RNA by RT-PCR indicating possibility of horizontal transmission of HAV to recipients of blood products. Adults > 25 years showed 64.77% positivity to anti HAV IgG and 9.8% positivity to anti-hav IgA. The results indicated declining endemicity of hepatitis A in Pune, western India. Studies on Immunogenicity of Hepatitis A Vaccine MS Chadha mscniv@hotmail.com An outbreak of hepatitis A had been investigated at the CRPF colony at Daund, District Pune. A total of 226 children remained susceptible 1 month after the last case of hepatitis A. Guardians of 172 children agreed to vaccinate their wards. One dose of HAVRIX vaccine (Smith Kline & Becham) was administered. Blood samples of 75 children were taken one month after vaccination. As per the manufacturers instructions, eight months after the first dose, a second dose of vaccine was administered to 130 children. Their blood samples were taken prior to administration of the second dose. To study antibody status, another blood sample was taken one month after the second dose of vaccination and 128 guardians agreed for the same. 79

13 Development of internal control (IC) for the real-time PCR based HBV quantitation assay KS Lole To overcome the problem of PCR inhibitory substances as haemoglobin, heparin etc. from the clinical samples which may adversely affect the amplification of clinical samples, it was thought that in addition to external standards, internal amplification control is essential in the HBV real-time PCR assay. For that a competitor DNA template (phbvqc) was constructed. A competitor construct was obtained by PCR amplification with a set of composite primers, forward primer:5' TAGGAGGCTGTAGGCATAAATTGGTGAACAA GATGGATTGCA-3' and the reverse primer:5'-gcacagcttggaggcttgtcagtca TAGCCGAATAGC-3' (sequences in the primers indicate HBV specific sequences while remaining regions are Neo gene specific) using neomycin phosphotransferase coding gene (804nt) as a template. The amplification region yielded 109 bp product with HBV specific ends and a 66nt Neo gene region in the middle which had similar GC content as that of HBV amplicon. This amplicon was processed for TA-cloning. A second probe with a different fluorophore label was simultaneously used in the real-time PCR assays. This internal control has the same primer sites but different internal sequence and it competes with the virus-derived target. HBV quantitation in clinical samples showed same sensititvity and accuracy after spiking the samples with 1000 copies of the IC. Thus the internal control will be useful in avoiding false negative results due to PCR inhibitors in the samples. 80

14 Cloning and expression of HCV core protein KS Lole HCV core protein was earlier expressed in the baculovirus system. The protein was purified using affinity column chromatography. As yields after purification were low, this protein was expressed in two different bacterial expression systems, pprotet (Clonetech) which has a tetracycline regulated promoter and the second vector was ppet15b which has an IPTG inducible promoter. HCV core gene was cloned in both the vectors and expression was tried in DH5 and BL21 host cells. None showed satisfactory induction levels of the protein. As the C-terminal of the HCV core protein has strong membrane anchoring domain, it probably affects the membrane integrity of the host bacteria and becomes lethal for the cells. This C- terminal was truncated (total protein is 193 amino acids long, after C-terminal truncation, it became 124 amino acids long) and the protein was expressed as a fusion protein along with N-terminal HIS tag in ppet15b system. The optimum induction conditions in BL21 were o found to be 0.4mM IPTG for 2hrs at 37 C. Protein was purified on Ni-agarose column and tested by SDS-PAGE and western blot analysis. The purified protein was used as coating antigen (35ng/ well) and ELISA was performed with previously tested 50 anti-hcv antibody positive sera samples and 44 sera from healthy donors (as negative controls). All negative samples tested negative and 48 positive samples tested positive in the ELISA, while two positive samples showed borderline positivity. Detection of virus (es) in water samples V A Arankalle varankalle@yahoo.com In order to determine the prevalence of enteric viruses in water samples collected year round and to assess the efficacy of water and sewage treatment protocols currently in use, a Method based on membrane filtration at high flow rates for concentration of viruses from water was standardized. Forty litres water could be concentrated to 2 ml in less than 2 hours. The method was used to test water samples for HAV and HEV (nested RT PCR) during epidemics of the diseases with satisfactory results. Real time PCR-based method for the quantitation of HEV RNA is being standardized. 81

15 Detection of HAV and HEV antibodies in animal sera V A Arankalle varankalle@yahoo.com A total of 592 blood samples were collected from various animal species such as dog (105), Cat (82), Horse (107), Chicken (101), Emus (92) and Pigeon (105). Serum samples were screened for the presence of anti-hav IgG and anti-hev IgG antibodies using HEPAVASE A-96 (TMB) qualitative enzyme immunoassay kit (General Biologicals Corp,Taiwan) and in-house ELISA kit respectively. Our results show 3.06%, 20% and 7.4% anti-hav IgG positivity amongst chicken, dogs and horse whereas no positivity was observed in Pigeon, Emus and cats. Blocking anti-hev IgG ELISA showed 13.4% and 9.3% positivity in cat and horse respectively where as other animal species were negative. ICMR funded clinical trial entitled, Therapy in patients with chronic hepatitis C: A randomized control trial of interferon with ribavirin and combination of interferon with Glycyrrhizin. V A Arankalle varankalle@yahoo.com For the above trial, NIV is one of the collaborating centers with responsibility of all the virological monitoring. During the last year, a total of 365 samples for 104 patients were tested for HCV RNA. Core region amplification was done for 51 patients. Sequencing for 42 samples has been completed. The genotypes were 1a (n=4), 1b (n=5), 1c (n=2), 3a (n=16), 3b (n=9), 3f (n=2), 3g (n=1), 3i (n=2). Quantitation of HCV RNA of 81 pre and post therapy samples was carried out using Amplicor HCV Monitor test. 82