Supplemental Information. McBrayer et al. Supplemental Data

Size: px
Start display at page:

Download "Supplemental Information. McBrayer et al. Supplemental Data"

Transcription

1 1 Supplemental Information McBrayer et al. Supplemental Data

2 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were cultured in 0.7 mm glucose containing medium for 17 hours and glucose consumption rates were determined (n = 1). (B) MM cell lines were cultured in 1.2 mm glucose containing medium for 3 hours and glucose consumption rates were determined (n 4). (C) L363 cells were incubated in the indicated concentrations of glucose for 48 hours prior to cell viability analysis via AnnexinV/DAPI staining (n = 2). (D) GLUT1 and (E) GLUT4 protein expression was evaluated in MM cell lines and normal B lymphocytes. GAPDH is included as a loading control. Representative blots are shown (n = 2). (F) Cells were transduced with the indicated shrnas and incubated 2 days. Cells were harvested for RNA extraction and GLUT4 expression was analyzed by quantitative real time RT PCR using the same primer/probe set as in Figure 1E (n = 2). (G) Cells were transduced with the indicated shrnas and incubated 2 days. Cells were harvested for RNA extraction and GLUT8 expression was analyzed by quantitative real time RT PCR using the same primer/probe set as in Figure 1E (n = 3). Data in panels B, C, F, and G are means ± SEM.

3 3 Figure S2. GLUT4 expression in myeloma is characterized by an atypical, basal cell surface localization. (A J) CD138+ primary myeloma cells isolated from bone marrow aspirates of three MM patients, five myeloma cell lines and normal B lymphocytes isolated from two healthy donors were immunostained for GLUT4 utilizing a commercial GLUT4 antibody or GLUT4 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase image are included to demarcate cell boundaries while DAPI positive regions indicate nuclei. Merged images validate partial localization of GLUT4 to the cell surface. Phase images were not collected for the MM.1S cell line. (K) JJN3 cells were transduced with one of two distinct GLUT4 targeted shrnas or control (C), non targeted shrna. Cells were incubated for 4 days before cell lysates were prepared and GLUT4 expression was assessed by immunoblot analysis. Representative immunoblot is shown. (L) JJN3 cells from part K were analyzed for growth 4 days after transduction by measurement of viable cell concentrations using trypan blue exclusion. Data in panel L are means ± SEM. For data in panels A,B, E G, and K L, n 3. For primary samples in panels C, D, H J, n = 1. * P <.05 ** P <.01 *** P <.005

4 4 Figure S3. GLUT1 suppression in MM cell lines elicits modest phenotypic effects. (A) Cells were transduced with the indicated shrnas and incubated 2 days before protein extraction and analysis of GLUT1 protein expression was performed. Representative blot is shown. (B) Cells from part A were

5 5 cultured in 5 mm glucose containing medium for 5 hours. Glucose consumption rates and lactate production rates were determined and normalized to control shrna expressing cells. (C E) Cells from part A were analyzed for viability and proliferation. Viable cell densities are expressed as fold change relative to the day 0 reading of control shrna expressing cells. (F G) Cell viability on Day 2 in the experiments in parts C E is plotted. Trypan blue exclusion test was used and values are normalized to control shrna expressing cells. (I K) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained for GLUT1 using a commercial GLUT1 antibody (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. Data in parts B H are means ± SEM. For data in parts A K, n 3. * P <.05 ** P <.01 *** P <.005

6 6 Figure S4. Anti IgM stimulation of normal B lymphocytes is associated with a decline in GLUT1 expression and increased GLUT4 expression and cell surface localization. B lymphocytes isolated from four different healthy volunteers were stimulated to proliferate through incubation with anti human IgM F(ab ) 2 for 15 hours. Cells were then harvested and immunostained for GLUT1 or GLUT4 (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. Representative images are shown (n = 4).

7 7 Figure S5. Knockdown of intracellularly localized GLUT8 with two distinct shrnas supports target specificity; cell cycle arrest induces glucose transport inhibition. (A) KMS11 cells were transduced with the indicated shrnas. Cells were incubated for 2 days before RNA was extracted and GLUT8 expression was analyzed by quantitative real time RT PCR. Expression is normalized to control shrna expressing cells. (B) KMS11 cells from part A were analyzed for growth 4 days after transduction by measurement of viable cell concentrations using trypan blue exclusion. (C) (E) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained for GLUT8 using affinity purified GLUT8

8 8 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. (F) KMS11 cells were transduced with GFP or p16 INK4A cdnas and incubated for 3 days before protein extraction and assessment of p16 INK4A expression was performed by immunoblot analysis. GAPDH serves as a loading control. A representative blot is shown. (G) KMS11 cells were transduced on Day 0 as in part F and cell growth was determined by measurement of viable cell densities at Days 0 and 3. (H) GFP and 16 INK4A expressing cells from part F were cultured in 5 mm glucose containing medium for 5 hours and glucose consumption rates were determined. Data in parts A B and G H are means ± SEM. For data in parts B and F H, n = 2. For data in parts A and C E, n 3. * P <.05 ** P <.01 *** P <.005

9 9 Figure S6. Knockdown of exclusively cell surface localized GLUT11 with two distinct shrnas supports target specificity. (A) JJN3 cells were transduced with the indicated shrnas and incubated for 2 days before RNA was extracted and GLUT11 expression was analyzed by quantitative real time RT PCR. Expression is normalized to control shrna expressing cells. (B) JJN3 cells from part A were analyzed for cell death 4 days after transduction via trypan blue exclusion assay (n = 2). (C) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained using GLUT11 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Background staining with pre immune serum is included as a control. DAPI staining identifies nuclei. Data in parts A B are means ± SEM. For data in parts A and C, n 3. * P <.05 ** P <.01 *** P <.005

10 10 Figure S7. Ritonavir treatment recapitulates glucose limitation by potentiating doxorubicin cytotoxicity. (A) KMS11 and (B) L363 cells were treated with DMSO (D) vehicle control, 20 µm ritonavir, 25 (L363) or 75 (KMS11) nm doxorubicin or the combination of both drugs for 72 hours. Cell death was assessed by flow cytometric analysis of DAPI staining. Data are means ± SEM (n 3). * P <.05 ** P <.01 *** P <.005

11 11 Supplemental Methods Table S1. Sequences of GLUT specific shrnas. shrna designation NCBI target reference sequence TRC number Sense sequence GLUT4 #1* NM_ TRCN GTGATTGAACAGAGCTACAAT GLUT4 #2 NM_ TRCN CTCCTTCCTCATTGGTATCAT GLUT1 NM_ TRCN CTTCAAAGTTCCTGAGACTAA GLUT8 #1 NM_ TRCN GCTGCTTCTCATGTGCTTCAT GLUT8 #2 NM_ TRCN CCCGGTCTACATCTCCGAAAT GLUT11 #1 NM_ TRCN CGATCACCTAGTCCTGCTTAT GLUT11 #2 NM_ TRCN GCTCATGTGGATCATGCTCAT * shrna used in Figure 2A H shrna used in Figure 4A E shrna used in Figure 4G K

12 12 Table S2. Characterization of GLUT specific primer probe sets used in real time RT PCR experiments Primer probe set cdna target Applied Biosystems TM assay ID NCBI target reference sequence Amplicon GLUT1 Hs _m1 NM_ bp, Exon Boundary 2 3 GLUT2 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT3 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT4 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT5 Hs _m1 NM_ NR_ NM_ GLUT6 Hs _m1 NM_ NM_ bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary 2 3 GLUT7 Hs _m1 NM_ bp, Exon Boundary GLUT8 Hs _m1 NM_ bp, Exon Boundary 4 5 GLUT9 Hs _m1 NM_ NM_ bp, Exon Boundary bp, Exon Boundary 2 3 GLUT10 Hs _m1 NM_ bp, Exon Boundary 3 4 GLUT11 Hs _m1 NM_ NM_ NM_ bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary 2 3 GLUT11 Alternate* Hs _m1 Genbank mrnas: CR AB BC BC AK bp 104 bp, Exon Boundary bp, Exon Boundary bp 104 bp, Exon Boundary 5 6 GLUT12 Hs _m1 NM_ bp, Exon Boundary 1 2 * Primer probe set only used for KMS11 cells in Figure 4G

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

Multiple Myeloma and Colorectal Cancer

Multiple Myeloma and Colorectal Cancer Multiple Myeloma and Colorectal Cancer From Systems Immunology to Single Cells Leo Hansmann Mark M. Davis Lab Department of Microbiology&Immunology Stanford University Multiple Myeloma Monoclonal disease

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

Investigating the role of a Cryptosporidium parum apyrase in infection

Investigating the role of a Cryptosporidium parum apyrase in infection Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase

More information

Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage

Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage Developmental Cell Supplemental Information Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage Christina D. Cota and Brad Davidson Supplemental Figures S1-S7 S1.

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating

More information

SUPPLEMENTARY DATA 1

SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut

More information

About Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR

About Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR About Our Products Purified Infectious/Inactivated Agents ABI produces a variety of specialized reagents, allowing researchers to choose the best preparations for their studies. Available reagents include

More information

Head of College Scholars List Scheme. Summer Studentship. Report Form

Head of College Scholars List Scheme. Summer Studentship. Report Form Head of College Scholars List Scheme Summer Studentship Report Form This report should be completed by the student with his/her project supervisor. It should summarise the work undertaken during the project

More information

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

Protein Analysis. -Detection and quantification. Toby M Holmes

Protein Analysis. -Detection and quantification. Toby M Holmes Protein Analysis -Detection and quantification Toby M Holmes Clinical Research Unit UCD school of Medicine and Medical Sciences Mater Misericordiae University Hospital Dublin Protein structure General

More information

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked

More information

Supplemental Material. Methods

Supplemental Material. Methods Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.

More information

Application Note No. 2 / July 2012. Quantitative Assessment of Cell Quality, Viability and Proliferation. System

Application Note No. 2 / July 2012. Quantitative Assessment of Cell Quality, Viability and Proliferation. System Application Note No. 2 / July 2012 Quantitative Assessment of Cell Quality, Viability and Proliferation System Quantitative Assessment of Cell Quality, Viability and Proliferation Introduction In vitro

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

Chapter 6: Antigen-Antibody Interactions

Chapter 6: Antigen-Antibody Interactions Chapter 6: Antigen-Antibody Interactions I. Strength of Ag-Ab interactions A. Antibody Affinity - strength of total noncovalent interactions between single Ag-binding site on an Ab and a single epitope

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Human Leukocyte Antigens - HLA

Human Leukocyte Antigens - HLA Human Leukocyte Antigens - HLA Human Leukocyte Antigens (HLA) are cell surface proteins involved in immune function. HLA molecules present antigenic peptides to generate immune defense reactions. HLA-class

More information

Chapter 3.2» Custom Monoclonal

Chapter 3.2» Custom Monoclonal 198 3 3.2 Custom Monoclonal 199 Mouse monoclonal antibody development Chapter 3.2» Custom Monoclonal 200 In vitro monoclonals expression service 201 Mouse monoclonal antibody additional services 202 Magnetic

More information

The cell lines used in this study were obtained from the American Type Culture

The cell lines used in this study were obtained from the American Type Culture Supplementary materials and methods Cell culture and drug treatments The cell lines used in this study were obtained from the American Type Culture Collection (ATCC) and grown as previously described.

More information

A novel polarized cell culture model to study HCV infection

A novel polarized cell culture model to study HCV infection A novel polarized cell culture model to study HCV infection Sandrine Belouzard Centre d Infection et d Immunité de Lille 15 ième réunion du réseau national hépatites Paris- 30 janvier 2015 HCV entry and

More information

Chapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions

Chapter 6. Antigen-Antibody Properties 10/3/2012. Antigen-Antibody Interactions: Principles and Applications. Precipitin reactions Chapter 6 Antigen-Antibody Interactions: Principles and Applications Antigen-Antibody Properties You must remember antibody affinity (single) VS avidity (multiple) High affinity: bound tightly and longer!

More information

TABLE OF CONTENT. Page ACKNOWLEDGEMENTS. iii ENGLISH ABSTRACT THAI ABSTRACT. vii LIST OF TABLES LIST OF FIGURES. xvi ABBREVIATIONS.

TABLE OF CONTENT. Page ACKNOWLEDGEMENTS. iii ENGLISH ABSTRACT THAI ABSTRACT. vii LIST OF TABLES LIST OF FIGURES. xvi ABBREVIATIONS. x TABLE OF CONTENT ACKNOWLEDGEMENTS ENGLISH ABSTRACT THAI ABSTRACT LIST OF TABLES LIST OF FIGURES ABBREVIATIONS iii iv vii xv xvi xviii CHAPTER I: INTRODUCTION 1.1 Statement of problems 1 1.2 Literature

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables Abstract Abbreviations List of figures CONTENT I-VI VII-VIII IX-XII List of tables XIII Chapter 1 Review of Literature 1. Vaccination against intracellular pathogens 1-34 1.1 Role of different immune responses

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

International Beryllium Conference, Montreal, Canada March 10, 2005

International Beryllium Conference, Montreal, Canada March 10, 2005 Alternative Lymphocyte Proliferation Tests: BrdU and Flow Cytometry Based Tests International Beryllium Conference, Montreal, Canada March 10, 2005 Tim K. Takaro Department of Environmental and Occupational

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Cell Viability Assays: Microtitration (MTT) Viability Test Live/Dead Fluorescence Assay. Proliferation Assay: Anti-PCNA Staining

Cell Viability Assays: Microtitration (MTT) Viability Test Live/Dead Fluorescence Assay. Proliferation Assay: Anti-PCNA Staining Cell Viability Assays: Microtitration (MTT) Viability Test Live/Dead Fluorescence Assay Proliferation Assay: Anti-PCNA Staining Spring 2008 1 Objectives To determine the viability of cells under different

More information

Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the

Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the Supplemental Data 1 Online supplemental information Statistical analysis Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the groups were performed using repeated measures

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Services and Prices Rabbit Polyclonal Antibody Service Package Number Description Package Contents Time Price Polyclonal package 1 (From protein to antiserum) Polyclonal package 2

More information

CFSE Cell Division Assay Kit

CFSE Cell Division Assay Kit CFSE Cell Division Assay Kit Item No. 10009853 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

Basic Science in Medicine

Basic Science in Medicine Medical Journal of th e Islamic Republic of Iran Volume 18 Number 3 Fall 1383 November 2004 Basic Science in Medicine ] EXPANSION OF HUMAN CORD BLOOD PRIMITIVE PROGENITORS IN SERUM-FREE MEDIA USING HUMAN

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

PROTOCOL. Immunostaining for Flow Cytometry. Background. Materials and equipment required.

PROTOCOL. Immunostaining for Flow Cytometry. Background. Materials and equipment required. PROTOCOL Immunostaining for Flow Cytometry 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 Rev.0 Background The combination of single cell analysis using flow cytometry and the specificity of antibody-based

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein

More information

HiPerFect Transfection Reagent Handbook

HiPerFect Transfection Reagent Handbook Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the

More information

3D Cell Culture mimsys G

3D Cell Culture mimsys G 3D Cell Culture mimsys G xeno-free & nutrient permeable hydrogel for 3D cell culture mimsys G is a xeno-free and non-immunogenic, easy to handle hydrogel for cell encapsulation in 3D experiments in vitro

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood

Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood Application Note Primary Cell Analysis Enumeration and Viability of Nucleated Cells from Bone Marrow, Cord Blood, and Mobilized Peripheral Blood Cell Viability Introduction: Bone Marrow, Cord Blood, Stem

More information

Pulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic

Pulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic Pulling the Plug on Cancer Cell Communication Stephen M. Ansell, MD, PhD Mayo Clinic Why do Waldenstrom s cells need to communicate? Waldenstrom s cells need activating signals to stay alive. WM cells

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

Fighting the Battles: Conducting a Clinical Assay

Fighting the Battles: Conducting a Clinical Assay Fighting the Battles: Conducting a Clinical Assay 6 Vocabulary: In Vitro: studies in biology that are conducted using components of an organism that have been isolated from their usual biological surroundings

More information

LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES

LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES Introduction to immunology. LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES Today we will get to know: The antibodies How antibodies are produced, their classes and their maturation processes Antigen recognition

More information

Outline. 1. Experiment. 2. Sample analysis and storage. 3. Image analysis and presenting data. 4. Probemaker

Outline. 1. Experiment. 2. Sample analysis and storage. 3. Image analysis and presenting data. 4. Probemaker Tips and tricks Note: this is just an informative document with general recommendations. Please contact [email protected] should you have any queries. Document last reviewed 2011-11-17 Outline 1. Experiment

More information

Introduction to flow cytometry

Introduction to flow cytometry Introduction to flow cytometry Flow cytometry is a popular laser-based technology. Discover more with our introduction to flow cytometry. Flow cytometry is now a widely used method for analyzing the expression

More information

Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma

Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma Anti-CD38 anti-cd3 bispecific antibody in multiple myeloma David E. Szymkowski Senior Director, Biotherapeutics Proteins by Design 1960s...1980s...2000s... Where are the bispecific antibody drugs? J Exp.

More information

Chapter 8. Summary and Perspectives

Chapter 8. Summary and Perspectives Chapter 8 Summary and Perspectives 131 Chapter 8 Summary Overexpression of the multidrug resistance protein MRP1 confer multidrug resistance (MDR) to cancer cells. The contents of this thesis describe

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2010 Bad Schandau Methods additional genetic information transgenic mouse line gene inactivation gene-deficient knockout mouse line Jak2

More information

The Costimulatory Molecule CD27 Maintains Clonally

The Costimulatory Molecule CD27 Maintains Clonally Immunity, Volume 35 Supplemental Information The Costimulatory Molecule CD7 Maintains Clonally Diverse CD8 + T Cell Responses of Low Antigen Affinity to Protect against Viral Variants Klaas P.J.M. van

More information

A customizable ADCC assay service for antibodies & fusion proteins.

A customizable ADCC assay service for antibodies & fusion proteins. Antibody Dependent Cell- Mediated Cytotoxicity (ADCC) Assay A customizable ADCC assay service for antibodies & fusion proteins. Our ADCC assay service accurately detects cell lysis based on LDH-release.

More information

UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO [email protected] Gundersen Health System Center for Cancer and

UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO [email protected] Gundersen Health System Center for Cancer and Blood Disorders La Crosse, WI UNDERSTANDING MULTIPLE

More information

Cell Viability Measurement

Cell Viability Measurement Cell Viability Measurement Viability is a measure of the metabolic state of a cell population which is indicative of the potential for growth Most common method: membrane integrity Trypan blue exclusion:

More information

Figure S1. SDS-PAGE of purified rtmd proteins Figure S2. rtmd1 interferes with chemotaxis of HUVECs induced by rtmd23

Figure S1. SDS-PAGE of purified rtmd proteins Figure S2. rtmd1 interferes with chemotaxis of HUVECs induced by rtmd23 Figure S1. SDS-PAGE of purified rtmd proteins SDS-polyacrylamide gel electrophoresis was performed using a 10% separation gel. One microgram of each rtmd protein was applied. Detection was performed with

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

P4 Distribution of Cetuximab in Models of Human Lung Cancer

P4 Distribution of Cetuximab in Models of Human Lung Cancer Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, University of Tübingen, Robert Bosch Foundation Stuttgart, Germany FORSYS Partner Project Predictive Cancer Therapy Project Meeting 14.10.09

More information

Proteomics Research with BIOCHAIN

Proteomics Research with BIOCHAIN Proteomics Research with IOCHIN Protein Extraction CNMCS Compartmental Protein Extraction Kit Cytoplasmic, Nuclear, Membrane, and Cytoskeleton Protein One kit isolates four different proteins sequentially

More information

Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 -

Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 - Supplemental Experimental Procedures Cell culture and Sensor Ping-Pong assay. Ecotropic Phoenix HEK293T cells and Trp53 - /- MEFs (1) were grown in DMEM supplemented with 10% fetal bovine serum (FBS),

More information

Human CD4+T Cell Care Manual

Human CD4+T Cell Care Manual Human CD4+T Cell Care Manual INSTRUCTION MANUAL ZBM0067.02 SHIPPING CONDITIONS Human CD4+T Cells, cryopreserved Cryopreserved human CD4+T cells are shipped on dry ice and should be stored in liquid nitrogen

More information

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production

More information

Activation and effector functions of HMI

Activation and effector functions of HMI Activation and effector functions of HMI Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 25 August 2015 ว ตถ ประสงค หล งจากช วโมงบรรยายน แล วน กศ กษาสามารถ

More information

SureSilencing shrna Plasmids

SureSilencing shrna Plasmids User Manual BIOMOL GmbH Waidmannstr. 35 22769 Hamburg [email protected] www.biomol.de Phone:+49-40-8532600 or 0800-2466651 (D) Fax: +49-40-85326022 or 0800-2466652 (D) SureSilencing shrna Plasmids Genome-Wide

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

Reconsideration Code 86386. Reconsideration Code Description Nuclear Matrix Protein 22 (NMP22), qualitative

Reconsideration Code 86386. Reconsideration Code Description Nuclear Matrix Protein 22 (NMP22), qualitative Calendar Year 2013 Centers for Medicare and Medicaid Services (CMS) New and Reconsidered Clinical Laboratory Fee Schedule (CLFS) Test Codes And Final Payment Determinations Reconsideration Code 86386 Reconsideration

More information

RNA Viruses. A Practical Approac h. Alan J. Cann

RNA Viruses. A Practical Approac h. Alan J. Cann RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the

More information

Supporting Information

Supporting Information Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).

More information

Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy

Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy CASE STUDY High Content Image Analysis Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy Dr. Nataša Anastasov leads the Personalized Radiation Therapy Group within the

More information

Laboratory Techniques I Oncology for Scientists I

Laboratory Techniques I Oncology for Scientists I Laboratory Techniques I Oncology for Scientists I September 9 th, 2015 Hayley Affronti, PhD Student [email protected] Dr. Sheila Figel too! When we first hit the lab there are so many things

More information

RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method)

RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Immune Tolerance Network RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Author: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

CyTOF2. Mass cytometry system. Unveil new cell types and function with high-parameter protein detection

CyTOF2. Mass cytometry system. Unveil new cell types and function with high-parameter protein detection CyTOF2 Mass cytometry system Unveil new cell types and function with high-parameter protein detection DISCOVER MORE. IMAGINE MORE. MASS CYTOMETRY. THE FUTURE OF CYTOMETRY TODAY. Mass cytometry resolves

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Molecular Diagnosis of Hepatitis B and Hepatitis D infections

Molecular Diagnosis of Hepatitis B and Hepatitis D infections Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication

More information

Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology

Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Principles of Immunohistochemistry Queen s Laboratory For Molecular Pathology Table of Contents POLYCLONAL VERSUS MONOCLONAL ANTIBODIES...PAGE 3 DIRECT & INDIRECT ASSAYS.PAGE 4 LABELS..PAGE 5 DETECTION...PAGE

More information

Immunophenotyping peripheral blood cells

Immunophenotyping peripheral blood cells IMMUNOPHENOTYPING Attune Accoustic Focusing Cytometer Immunophenotyping peripheral blood cells A no-lyse, no-wash, no cell loss method for immunophenotyping nucleated peripheral blood cells using the Attune

More information

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule AAGPs TM Anti-Aging Glyco Peptides Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule 1 Acknowledgements This presentation was prepared by Dr. Samer Hussein

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and

SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Supplemental Material: Western blot: SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Analysis (NIH). Quantitative

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Secondary Antibodies and Conjugates

Secondary Antibodies and Conjugates biodescriptor biomolecules Full image -- Remove color from text box when placing image Secondary Antibodies and Conjugates Initiative Descriptor Primary Cover Header Popular Reagents for Quality Secondary

More information

LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials

LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational

More information