Supplemental Information. McBrayer et al. Supplemental Data

Transcription

1 1 Supplemental Information McBrayer et al. Supplemental Data

2 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were cultured in 0.7 mm glucose containing medium for 17 hours and glucose consumption rates were determined (n = 1). (B) MM cell lines were cultured in 1.2 mm glucose containing medium for 3 hours and glucose consumption rates were determined (n 4). (C) L363 cells were incubated in the indicated concentrations of glucose for 48 hours prior to cell viability analysis via AnnexinV/DAPI staining (n = 2). (D) GLUT1 and (E) GLUT4 protein expression was evaluated in MM cell lines and normal B lymphocytes. GAPDH is included as a loading control. Representative blots are shown (n = 2). (F) Cells were transduced with the indicated shrnas and incubated 2 days. Cells were harvested for RNA extraction and GLUT4 expression was analyzed by quantitative real time RT PCR using the same primer/probe set as in Figure 1E (n = 2). (G) Cells were transduced with the indicated shrnas and incubated 2 days. Cells were harvested for RNA extraction and GLUT8 expression was analyzed by quantitative real time RT PCR using the same primer/probe set as in Figure 1E (n = 3). Data in panels B, C, F, and G are means ± SEM.

3 3 Figure S2. GLUT4 expression in myeloma is characterized by an atypical, basal cell surface localization. (A J) CD138+ primary myeloma cells isolated from bone marrow aspirates of three MM patients, five myeloma cell lines and normal B lymphocytes isolated from two healthy donors were immunostained for GLUT4 utilizing a commercial GLUT4 antibody or GLUT4 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase image are included to demarcate cell boundaries while DAPI positive regions indicate nuclei. Merged images validate partial localization of GLUT4 to the cell surface. Phase images were not collected for the MM.1S cell line. (K) JJN3 cells were transduced with one of two distinct GLUT4 targeted shrnas or control (C), non targeted shrna. Cells were incubated for 4 days before cell lysates were prepared and GLUT4 expression was assessed by immunoblot analysis. Representative immunoblot is shown. (L) JJN3 cells from part K were analyzed for growth 4 days after transduction by measurement of viable cell concentrations using trypan blue exclusion. Data in panel L are means ± SEM. For data in panels A,B, E G, and K L, n 3. For primary samples in panels C, D, H J, n = 1. * P <.05 ** P <.01 *** P <.005

4 4 Figure S3. GLUT1 suppression in MM cell lines elicits modest phenotypic effects. (A) Cells were transduced with the indicated shrnas and incubated 2 days before protein extraction and analysis of GLUT1 protein expression was performed. Representative blot is shown. (B) Cells from part A were

5 5 cultured in 5 mm glucose containing medium for 5 hours. Glucose consumption rates and lactate production rates were determined and normalized to control shrna expressing cells. (C E) Cells from part A were analyzed for viability and proliferation. Viable cell densities are expressed as fold change relative to the day 0 reading of control shrna expressing cells. (F G) Cell viability on Day 2 in the experiments in parts C E is plotted. Trypan blue exclusion test was used and values are normalized to control shrna expressing cells. (I K) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained for GLUT1 using a commercial GLUT1 antibody (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. Data in parts B H are means ± SEM. For data in parts A K, n 3. * P <.05 ** P <.01 *** P <.005

6 6 Figure S4. Anti IgM stimulation of normal B lymphocytes is associated with a decline in GLUT1 expression and increased GLUT4 expression and cell surface localization. B lymphocytes isolated from four different healthy volunteers were stimulated to proliferate through incubation with anti human IgM F(ab ) 2 for 15 hours. Cells were then harvested and immunostained for GLUT1 or GLUT4 (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. Representative images are shown (n = 4).

7 7 Figure S5. Knockdown of intracellularly localized GLUT8 with two distinct shrnas supports target specificity; cell cycle arrest induces glucose transport inhibition. (A) KMS11 cells were transduced with the indicated shrnas. Cells were incubated for 2 days before RNA was extracted and GLUT8 expression was analyzed by quantitative real time RT PCR. Expression is normalized to control shrna expressing cells. (B) KMS11 cells from part A were analyzed for growth 4 days after transduction by measurement of viable cell concentrations using trypan blue exclusion. (C) (E) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained for GLUT8 using affinity purified GLUT8

8 8 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Phase images are included to demarcate cell boundaries while DAPI positive regions identify nuclei. (F) KMS11 cells were transduced with GFP or p16 INK4A cdnas and incubated for 3 days before protein extraction and assessment of p16 INK4A expression was performed by immunoblot analysis. GAPDH serves as a loading control. A representative blot is shown. (G) KMS11 cells were transduced on Day 0 as in part F and cell growth was determined by measurement of viable cell densities at Days 0 and 3. (H) GFP and 16 INK4A expressing cells from part F were cultured in 5 mm glucose containing medium for 5 hours and glucose consumption rates were determined. Data in parts A B and G H are means ± SEM. For data in parts B and F H, n = 2. For data in parts A and C E, n 3. * P <.05 ** P <.01 *** P <.005

9 9 Figure S6. Knockdown of exclusively cell surface localized GLUT11 with two distinct shrnas supports target specificity. (A) JJN3 cells were transduced with the indicated shrnas and incubated for 2 days before RNA was extracted and GLUT11 expression was analyzed by quantitative real time RT PCR. Expression is normalized to control shrna expressing cells. (B) JJN3 cells from part A were analyzed for cell death 4 days after transduction via trypan blue exclusion assay (n = 2). (C) KMS11 cells, L363 cells and normal B lymphocytes isolated from healthy donors were immunostained using GLUT11 antiserum (red) and counterstained with DAPI (blue) prior to analysis by confocal immunofluorescence microscopy. Background staining with pre immune serum is included as a control. DAPI staining identifies nuclei. Data in parts A B are means ± SEM. For data in parts A and C, n 3. * P <.05 ** P <.01 *** P <.005

10 10 Figure S7. Ritonavir treatment recapitulates glucose limitation by potentiating doxorubicin cytotoxicity. (A) KMS11 and (B) L363 cells were treated with DMSO (D) vehicle control, 20 µm ritonavir, 25 (L363) or 75 (KMS11) nm doxorubicin or the combination of both drugs for 72 hours. Cell death was assessed by flow cytometric analysis of DAPI staining. Data are means ± SEM (n 3). * P <.05 ** P <.01 *** P <.005

11 11 Supplemental Methods Table S1. Sequences of GLUT specific shrnas. shrna designation NCBI target reference sequence TRC number Sense sequence GLUT4 #1* NM_ TRCN GTGATTGAACAGAGCTACAAT GLUT4 #2 NM_ TRCN CTCCTTCCTCATTGGTATCAT GLUT1 NM_ TRCN CTTCAAAGTTCCTGAGACTAA GLUT8 #1 NM_ TRCN GCTGCTTCTCATGTGCTTCAT GLUT8 #2 NM_ TRCN CCCGGTCTACATCTCCGAAAT GLUT11 #1 NM_ TRCN CGATCACCTAGTCCTGCTTAT GLUT11 #2 NM_ TRCN GCTCATGTGGATCATGCTCAT * shrna used in Figure 2A H shrna used in Figure 4A E shrna used in Figure 4G K

12 12 Table S2. Characterization of GLUT specific primer probe sets used in real time RT PCR experiments Primer probe set cdna target Applied Biosystems TM assay ID NCBI target reference sequence Amplicon GLUT1 Hs _m1 NM_ bp, Exon Boundary 2 3 GLUT2 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT3 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT4 Hs _m1 NM_ bp, Exon Boundary 1 2 GLUT5 Hs _m1 NM_ NR_ NM_ GLUT6 Hs _m1 NM_ NM_ bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary 2 3 GLUT7 Hs _m1 NM_ bp, Exon Boundary GLUT8 Hs _m1 NM_ bp, Exon Boundary 4 5 GLUT9 Hs _m1 NM_ NM_ bp, Exon Boundary bp, Exon Boundary 2 3 GLUT10 Hs _m1 NM_ bp, Exon Boundary 3 4 GLUT11 Hs _m1 NM_ NM_ NM_ bp, Exon Boundary bp, Exon Boundary bp, Exon Boundary 2 3 GLUT11 Alternate* Hs _m1 Genbank mrnas: CR AB BC BC AK bp 104 bp, Exon Boundary bp, Exon Boundary bp 104 bp, Exon Boundary 5 6 GLUT12 Hs _m1 NM_ bp, Exon Boundary 1 2 * Primer probe set only used for KMS11 cells in Figure 4G