Embryonic Stem Cell-Specific MicroRNAs

Transcription

1 Developmental Cell, Vol. 5, , August, 2003, Copyright 2003 by Cell Press Embryonic Stem Cell-Specific MicroRNAs the regulation of development. In plants, mirnas have a striking propensity to target transcription factors in- volved in development (Rhoades et al., 2002), in C. elegans, mutations in lin-4 and let-7 cause heterochronic phenotypes (Lee et al., 1993; Olsen and Ambros, 1999; Reinhart et al., 2000), and, in D. melanogaster, the mirna encoded by the gene bantam is temporally and spatially expressed during development to control cell proliferation and apoptosis (Brennecke et al., 2003). A survey of mirnas cloned from mouse organs revealed that many were organ specific, consistent with roles in development (Lagos-Quintana et al., 2002, 2003). Embryonic stem (ES) cells are totipotent cell lines derived from the inner cell mass (ICM) of the mammalian blastocyst (Smith, 2001). In vitro differentiation of ES cells recapitulates some of the global genomic methyla- tion that takes place shortly after implantation and has been used to study the epigenetic events that accompany X chromosome inactivation during midblastula (Wutz and Jaenisch, 2000). To elucidate the roles of mirnas during these early developmental transitions, we cloned short, nt RNAs from undifferentiated and differentiated ES cells. Hristo B. Houbaviy, 1 Michael F. Murray, 1 and Phillip A. Sharp 1,2, * 1 Center for Cancer Research 2 The McGovern Institute for Brain Research and Department of Biology Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, Massachusetts Summary We have identified micrornas (mirnas) in undifferen- tiated and differentiated mouse embryonic stem (ES) cells. Some of these appear to be ES cell specific, have related sequences, and are encoded by genomic loci clustered within 2.2 kb of each other. Their expression is repressed as ES cells differentiate into em- bryoid bodies and is undetectable in adult mouse organs. In contrast, the levels of many previously described mirnas remain constant or increase upon differentiation. Our results suggest that mirnas may have a role in the maintenance of the pluripotent cell state and in the regulation of early mammalian development. Results and Discussion Introduction mirna Libraries from Undifferentiated and Differentiated ES Cells Cloning of short, nt RNAs from a variety of sources We constructed mirna libraries from three different identified a family of RNA species designated as micrornas sources: (1) ES cells grown on a feeder layer of irradiated (mirnas) (Dostie et al., 2003; Lagos-Quintana et al., mouse embryonic fibroblasts (MEF) and in the presence 2001, 2002, 2003; Lau et al., 2001; Lim et al., 2003a, of 500 U/ml leukemia inhibitory factor (LIF) (library L1), 2003b; Llave et al., 2002a; Mourelatos et al., 2002; Reinpresence of 1000 U/mL LIF (library L2), and (3) differenti- (2) ES cells grown in the absence of feeders and in the hart et al., 2002). Over 200 distinct mirnas have been discovered experimentally, and additional ones have ated ES cells maintained for 4 days in media containing been identified via computational approaches (Lim et al., 100 nmol/l all-trans-retinoic acid (RA) and no LIF (library L3). While library L1 could potentially be contaminated 2003a, 2003b). mirnas are structurally and functionally by MEF-derived mirna sequences, the corresponding related to the short interfering RNAs (sirna) that cause culture should contain the highest fraction of undifferen- RNA silencing (Elbashir et al., 2001a, 2001b; Hamilton tiated ES cells. Conversely, while some differentiation and Baulcombe, 1999; Hammond et al., 2000; Zamore may have occurred in the cell population used to generate et al., 2000). Both mirnas and sirnas are produced by library L2, it should not contain MEF-derived sequences. the RNase III nuclease Dicer, and both depend on the Finally, the sequences of mirnas induced during ES cell PAZ/PIWI domain (PPD) proteins for function and/or differentiation should be present in library L3. stability (Grishok et al., 2001; Hutvagner et al., 2001). To assess the degree of differentiation, we determined mirnas silence gene expression by repressing transthe steady-state levels of Oct4 mrna by Northern analylation or by directing the degradation of mrna. For sis, and the distribution of alternatively spliced isoforms example, mirnas encoded by the C. elegans genes lin-4 of the 6-integrin mrna was analyzed by RT-PCR (Figand let-7 (Lee et al., 1993; Reinhart et al., 2000) bind to ure 1). Oct4 is dramatically downregulated during differpartially complementary sites within their mrna targets entiation (Rosner et al., 1990), and there are quantitative and cause translational repression (Olsen and Ambros, shifts among the splicing isoforms of the 6-integrin 1999; Slack et al., 2000). However, the let-7 mirna can (Cooper et al., 1991). ES cells grown with and without cause mrna degradation in vitro if a perfectly comple- feeders were indistinguishable by both criteria they mentary target site is present (Hutvagner and Zamore, expressed high levels of Oct4 mrna and the short iso- 2002), and, similarly, many plant mirnas cleave mrna form of the 6-integrin message (Figure 1, lanes 1 and in vivo and in vitro (Llave et al., 2002b; Tang et al., 2003; 2). In contrast, after 4 days of growth in the presence Xie et al., 2003). of RA, the Oct4 mrna levels decreased more than 5-fold An important biological function of some mirnas is (Figure 1A, compare lanes 1 and 2 with lane 3), and the culture began to express the long isoform of the 6- *Correspondence: sharppa@mit.edu integrin mrna, consistent with differentiation (Figure

2 Developmental Cell 352 Figure 1. Molecular Markers of Undifferentiated and Differentiated ES Cell Cultures (A) Northern analyses of the expression of Oct4 (top) and the -actin mrna (middle) and 18S rrna (bottom) loading controls in undifferentiated ES cells grown with (lane 1) and without (lane 2) a feeder layer and in ES cells differentiated with RA in monolayer for 4 days (lane 3) or 14 days as embryoid bodies without (lane 4) and with RA (lane 5). (B) Expression of 6-integrin mrna isoforms analyzed by RT-PCR. Bands corresponding to the alternatively spliced variants are indicated by arrows. Lanes 1 5 correspond to lanes 1 5 in (A). Lanes 6 and 7 correspond to samples prepared from NIH/3T3 cells and the MEF feeders, respectively. 1B, lane 3). Moreover, both markers had similar expres- with flanking sequences are listed in Table 1. These sion patterns in the RA-induced monolayer culture and constitute 30% of the nonredundant clones in the in embryoid bodies after 14 days of differentiation (Fig- nt range. ure 1, lanes 3 5). Thus, both undifferentiated ES cell We do not know whether any of the remaining cultures contained a significant proportion of totipotent nt sequences are sirnas. Database searches did not ES cells, and most cells underwent differentiation in reveal clones derived from annotated mrnas. None of monolayer upon treatment with RA. the sequences match the mouse centromeric minor satellite, whose S. pombe counterpart has been implicated Data Analysis and Identification of mirnas in sirna-mediated heterochromatin silencing (Reinhart A total of 681 short RNA clones were isolated and se- and Bartel, 2002; Volpe et al., 2002). Similarly, none of quenced, of which 192 were from L1, 219 were from L2, the clones could be mapped to repetitive elements. and 270 were from L3. The data from the three libraries were pooled, and multiple instances of the same sequence were assigned to the longest clone. This resulted Novel mirnas from ES Cells in a nonredundant dataset comprised of 388 short RNAs. Of the 53 potential mirna clones for which hairpin pre- Most sequences (73%) were observed only once. Thus, cursors could be proposed, 32 were identical to previously the dataset probably does not represent the complete identified mirnas, 5 additional clones were clear pool of short RNAs present in undifferentiated and differ- homologs of known mirnas (mir-34a, mir-34b, mirentiated ES cells. In the final nonredundant dataset, a 106a, mir-106b, and mir-130b), and one (let-7d-as) was total of 179 clones (46%) were between 20 and 24 nt excised from the opposite side of a known mirna hairpin long, as expected for Dicer cleavage products (Elbashir precursor (Table 1). The remaining 15 sequences et al., 2001b; Zamore et al., 2000). Of these 37 matched are unrelated to any previously described mirnas in known rrna and trna sequences. the RFAM database (Ambros et al., 2003) (Table 1; mir- To distinguish mirnas from degradation products 290 mir-302). Interestingly, these mirnas are relatively and potential sirnas, we evaluated the ability of RNA poorly conserved (Table 1). While hairpin folds corre- corresponding to the genomic sequences surrounding sponding to most of them could be found in other mammalian the above 179 nonredundant clones to fold into potential genomes, i.e., human and rat, only one (mir-301) hairpin mirna precursors. This criterion, together with had a conserved hairpin in the fish Fugu rubripes, and phylogenetic conservation of the hairpin fold, is now none had homologs in invertebrates. generally accepted as good evidence for the existence One of the above clones, mir-297, was identical to of an mirna (Ambros et al., 2003; Lim et al., 2003a, 20 genomic segments and varied by one position from 2003b). The 53 candidate mirnas that formed hairpins 81 other loci. These sites overlapped annotated (CA) n,

3 ES Cell-Specific MicroRNAs 353 Table 1. mirnas from Undifferentiated and Differentiated ES Cells Observa- Conservations c Length d tion g ID a Sequence b L1 L2 L3 Average Maximum Minimum Rmsd Hits e Expression f Hs Rn Fr let-7d-as CUAUACGACCUGCUGCCUUUCU S00S0 mir-34a AGGCAGUGUAGUUAGCUGAUUGC mir-34b UAGGCAGUGUAAUUAGCUGAUUG mir-106a CAAAGUGCUAACAGUGCAGGUA mir-106b UAAAGUGCUGACAGUGCAGAU mir-130b CAGUGCAAUGAUGAAAGGGCAU mir-290 CUCAAACUAUGGGGGCACUUUUU Hs Rn mir-291-s CAUCAAAGUGGAGGCCCUCUCU Rn mir-291-as AAAGUGCUUCCACUUUGUGUGCC Rn mir-292-s ACUCAAACUGGGGGCUCUUUUG Hs mir-292-as AAGUGCCGCCAGGUUUUGAGUGU Hs Rn mir-293 AGUGCCGCAGAGUUUGUAGUGU mir-294 AAAGUGCUUCCCUUUUGUGUGU mir-295 AAAGUGCUACUACUUUUGAGUCU Rn mir-296 AGGGCCCCCCCUCAAUCCUGU Hs mir-297 AUGUAUGUGUGCAUGUGCAUG Hs Rn mir-298 GGCAGAGGAGGGCUGUUCUUCC SSSS0 mir-299 UGGUUUACCGUCCCACAUACAU Hs Rn mir-300 UAUGCAAGGGCAAGCUCUCUUC Rn mir-301 CAGUGCAAUAGUAUUGUCAAAGC Hs Rn Fr mir-302 UAAGUGCUUCCAUGUUUUGGUGA Hs let-7c UGAGGUAGUAGGUUGUAUGGUUA S1 mir-15a UAGCAGCACAUAAUGGUUUGUG mir-15b UAGCAGCACAUCAUGGUUUAC mir-16 UAGCAGCACGUAAAUAUUGGCG mir-18 UAAGGUGCAUCUAGUGCAGAUA mir-19b UGUGCAAAUCCAUGCAAAACUGA mir-20 UAAAGUGCUUAUAGUGCAGGUAG mir-21 UAGCUUAUCAGACUGAUGUUGAC mir-22 AAGCUGCCAGUUGAAGAACUGU mir-24 UGGCUCAGUUCAGCAGGAACAG mir-27a UUCACAGUGGCUAAGUUCCGC mir-29a UAGCACCAUCUGAAAUCGGUUA mir-29b UAGCACCAUUUGAAAUCAGUGUU mir-30e UGUAAACAUCCUUGACUGGAAGC mir-31 AGGCAAGAUGCUGGCAUAGCUG mir-92 UAUUGCACUUGUCCCGGCCUG mir-93 CAAAGUGCUGUUCGUGCAGGUAG mir-94 UAAAGUGCUGACAGUGCAGAU mir-96 UUUGGCACUAGCACAUUUUUGCU mir-99b CACCCGUAGAACCGACCUUGCG S00S0 mir-124-a UAAGGCACGCGGUGAAUGCCA mir-127 UCGGAUCCGUCUGAGCUUGGCUA mir-130 CAGUGCAAUGUUAAAAGGGCAU mir-141a UAACACUGUCUGGUAAAGAUGGCC S0 mir-142s CCCAUAAAGUAGAAAGCACUA mir-142-as UGUAGUGUUUCCUACUUUAUGGA mir-143a UGAGAUGAAGCACUGUAGCUCUUA mir-172 UGGCAGUGUCUUAGCUGGUUGUU mir-183 UAUGGCACUGGUAGAAUUCAC SSSS0 mir-193 AACUGGCCUACAAAGUCCCAGU S00S1 mir-199-s CCCAGUGUUCAGACUACCUGUUC mir-199-as ACAGUAGUCUGCACAUUGGUUA a mirnas experimentally determined for the first time in this study are listed first. The letters s and as designate mirnas excised from the 5 and 3 strands of the same hairpin stem respectively, according to Lagos-Quintana et al. (2002). b The longest clone that matches perfectly the mouse genomic sequence is given. c Number of observations in libraries L1, L2, and L3 d Average, maximum and minimum lengths. Rmsd, root-mean-square deviation from the average. e Number of genomic hits. f Expression patterns by Northern analysis. Single digit numbers indicate the approximate relative band intensities as shown in Figure 2 and give no information about the relative levels of different mirnas. S indicates the presence of a smear that precluded detection of the mirna. g For mir-290 mir-302, which do not have previously reported homologs, the presence of conserved stem loops in the human (Hs), rat (Rn), and pufferfish (Fr) genomes is indicated.

4 Developmental Cell 354

5 ES Cell-Specific MicroRNAs 355 (TG) n, SINE, B3, and B4 repeats in the ENSEMBL database. Hairpin mirna precursors could be derived from three of these locations. While it could be argued that stem loop structures would occur by chance in (CA) n, (TG) n -rich sequences, expression data support the exis- tence of mir-297 (discussed below). The remaining 14 potential mirnas map to 12 distinct stem loop precursors. Two of these hairpins (mir-291 and mir-292) yield cloned RNAs corresponding to both strands of the stem (Table 1). Multiple sequence alignment revealed that six pre- mirna precursors (mir-290, mir-291, mir-292, mir- 293, mir-294, and mir-295) have related sequences (Figure 2A). Mature mirnas were processed from both the 5 and the 3 sides of these hairpins (Figure 2A; mirna consensus sequences 5 -ACUCAAANUGGGG GCNCUCUUUU-3 and 5 -AAAGUGCGC(N) 2 4 UUUUGA GUGU-3, respectively), and clones corresponding to the 3 sides were more frequently observed (Table 1). When two mirnas are processed from the opposing strands of the same hairpin stem, it is thought that the more abundant mirna has a biological function, whereas the less abundant species is a nonfunctional byproduct of the reaction catalyzed by Dicer (Lagos- Quintana et al., 2002; Lau et al., 2001). Interestingly, the above six related pre-mirnas map in the same relative orientation within a 2.2 kb region of genomic sequence that has not been assigned a specific chromosomal location in the mouse genome assembly (Figure 2B). Thus, adjacent hairpins in the cluster may be initially synthesized as common primary transcripts (pri-mirna) (Lee et al., 2002). Over 200 mirnas have been cloned from mammalian cell lines and mouse organs, but none have been derived from early embryos. Therefore, the fact that mirnas expressed from the hairpin cluster have not been ob- served previously strongly suggests that they are indeed ES cell specific. To obtain additional support for this conclusion, we searched the expressed sequence tag (EST) database for entries homologous to the 2.2 kb segment containing the cluster of six pre-mirnas. Consistent with the mirna cloning data, the top sevenscoring ESTs (score, 315, and identity, 98%) that map within this genomic segment correspond to cdnas prepared from preimplantation embryos or ES cells (Figure 2B). ESTs derived from preimplantation embryos or ES cells constitute approximately 5% of the total mouse EST data in GenBank. ESTs from the remainder of the database aligned better elsewhere in the mouse genome and/or were homologous to multiple genomic locations (data not shown). Thus, the EST data strongly suggests that expression of the mirna cluster is restricted to preimplantation embryos and ES cells and supports the existence of a large primary transcript encompassing several hairpins (Figure 2B). BLAST searches identified only a single human homolog (mir-hes1, located on chromosome 19) of the six hairpins in the mouse cluster. However, systematic scanning of the genomic region adjacent to mir-hes1 for sequences that can fold into hairpins identified two additional potential human pre-mirnas (mir-hes2 and mir-hes3) related to the members of the mouse cluster (Figures 2A and 2C). Within the corresponding human and mouse genomic segments, the pre-mirna hairpins are the only regions with obvious sequence homology. mirna Expression Patterns during ES Cell Differentiation To confirm expression of mirnas, we performed Northern analyses on samples from undifferentiated and dif- ferentiated ES cell cultures (Figure 3A, lanes 2 4 in all panels) as well as from the MEF feeder layer and NIH/ 3T3 cells (Figure 3A, lanes 1 and 5, respectively). A total of 39 (74%) of the mirnas shown in Table 1 were ana- lyzed. Of these, 30 gave robust bands migrating as RNA of approximately nt in at least one lane (Figure 3A and Table 1). The rest either showed no detectable signal or a smear that made it difficult to determine whether a discrete band was present. Of the 15 clones unrelated to previously described mirnas, we confirmed the expression of 11 by Northern analysis, including at least 1 mature mirna from each of the 6 clustered hairpins (Figure 3A and Table 1). Three of the remaining four clones could not be detected (mir-298, mir-299, and mir-300), and one other clone (mir-291-s) was not tested. Northern analyses showed that mir-29a, mir-29b, mir-193, mir-199-s, and mir-199-as were detectable only in the MEFs and NIH/3T3 cells, but not in undifferen- tiated or differentiated ES cell cultures (Table 1 and data not shown). Thus, library L1 did contain some MEF sequence contamination. mirnas processed from the hairpin cluster (mir-290, mir-291-as, mir-292-as, mir-293, mir-294, and mir- 295) were expressed in ES cells grown with feeders, ES cells grown without feeders, and ES cells differentiated for 4 days in monolayer in the presence of RA, but not in MEFs or NIH/3T3 cells (Figure 3A and Table 1). More importantly, these mirnas were repressed in embryoid bodies prepared by culturing ES cells for 14 days in either the presence or absence of RA (Figure 3B, com- pare lanes 1 and 2 with lanes 3 and 4). Furthermore, Northern analyses failed to detect mirnas from the cluster in adult mouse organs (Figure 3B, lanes 5 12). In contrast, consistent with previous reports, let-7c and mir-16 were readily detectable in many of the organs (Lagos-Quintana et al., 2002, 2003). The above results strongly suggest that expression of the pre-mirna clus- ter is specific for pluripotent ES cells and is either si- lenced or downregulated upon differentiation. This conclusion does not conflict with the expression of the Figure 2. Genomic Organization of the ES Cell-Specific mirna Clusters (A) Multiple sequence alignment of the genomic DNA segments corresponding to the cluster of mouse ES cell-specific pre-mirnas (mir-290, 291, 292, 293, 294, and 295) and their human homologs (mir-hes1, 2, and 3). The positions of mature mirnas that were cloned are highlighted in yellow. Conserved residues are shown in red. The mouse and human clusters are illustrated in (B) and (C), respectively, together with the secondary structures of proposed precursor RNAs. The experimentally determined (B) and hypothetical (C) positions of the mature mirnas are shown in red. Genomic coordinates are given as chromosome:start-end (Un, unmapped sequence space). ESTs that map to the mouse cluster are shown with their GenBank accession numbers in (B).

6 Developmental Cell 356 Figure 3. Northern Analyses of the mirna Expression Patterns In (A) the arrangement of samples is identical in all panels and is as follows: lane 1, feeder layer; lane 2, ES cells grown on feeders; lane 3, ES cells grown without feeders; lane 4, ES cells differentiated in monolayer with RA; lane 5, NIH/3T3 cells. The names of the mirnas analyzed are given above each panel. trna-ile-att serves as a loading control. Because of different exposures, comparisons of the signals between panels are not meaningful. (B) Expression of mirnas in ES cells (lane 1), ES cells differentiated in monolayer in the presence of RA (lane 2), embryoid bodies cultured for 14 days without (lane 3) and with (lane 4) RA, and mouse organs (lanes 5 12). The names of the organs are given on top, and the names of the mirnas are given on the right. above cluster in ES cells differentiated in monolayer. consists of the mirnas processed from the hairpin cluster The half-life of these mirnas may be sufficiently long and, potentially, mir-296. (2) mirnas that are ex- that 4 days of culture might not be adequate for their pressed in ES cell cultures as in (1) but were found in clearance. adult tissues by previous cloning. These are likely to Four other mirnas, unrelated to previously described regulate general aspects of cell physiology. This set sequences, were detected by Northern analyses (mir- consists of mir-15a, mir-16, mir-19b, mir-92, mir-93, 296, mir-297, mir-301, and mir-302). Their expression mir-96, mir-130 and mir-130b. (3) The set of mirnas patterns suggest that only mir-296 could potentially be cloned from undifferentiated ES cells, the expression of ES cell specific (Figure 3A and Table 1). which increases dramatically upon differentiation. Such It is difficult, with the results to date, to conclude that mirnas are almost certainly contributed by the subpopan mirna is expressed in undifferentiated ES cells if ulation of spontaneously differentiated cells in the culture. this same mirna is induced upon differentiation. This Among this set are mir-21 and mir-22. difficulty arises because all ES cell cultures contain a The cluster of ES cell-specific pre-mirnas could have small proportion of spontaneously differentiated cells. important roles in maintaining the pluripotent cell state. In spite of this, it is tempting to group the mirna expres- Short, nt RNAs, either mirnas or sirnas, are sion data into the following three patterns. (1) The set known to regulate gene expression by three different of mirnas, the levels of which remain relatively constant mechanisms. The first is the silencing of a gene by directing in undifferentiated ES cells and in monolayer cultures mrna degradation. This requires extensive differentiated with RA and which were not found in adult complementarity between the short RNA and a target tissues by either Northern analyses or previous cloning. site in the mrna (Doench et al., 2003; Hutvagner and This set is likely to have ES cell-specific functions and Zamore, 2002; Llave et al., 2002b; Tang et al., 2003).

7 ES Cell-Specific MicroRNAs 357 Pertinent to this, none of the mirnas processed from Acknowledgments the hairpin cluster are exactly complementary to known We would like to thank N. Lau and D. Bartel for sharing their mirna mrnas. The second mechanism involves directing inhicloning protocols and D. Bartel, A. Grishok, D. Tantin, D. Dimova, bition of transcription due to either chromatin modifica- C. Novina, J. Doench, C. Petersen, D. Dykxhoorn, C. Cheng, and V. tion or DNA methylation (Hall et al., 2002; Jones et al., Wang for discussions and critical review of the manuscript. This 2001; Mette et al., 2000; Volpe et al., 2002). While the research was supported by fellowship from the Jane Coffin extent of complementarity required for transcriptional Childs Fund for Medical Research to H.B.H., genetics training grant silencing by short RNAs has not been investigated, we T32-GM07748 from the National Institutes of Health to M.F.M., United States Public Health Service MERIT Award R37-GM34277 note that no loci within the mouse genome, other than from the National Institutes of Health, National Science Foundation the actual hairpin precursors, are exactly complemen- Grant , and PO1 grant CA42063 from the National Cancer tary to clones originating from the pre-mirna cluster. Institute to P.A.S., and, partially, by Cancer Center Support (core) The third mechanism is the traditional role of inhibiting grant P30-CA14051 from the National Cancer Institute. translation by mirnas pairing with partial complementarity to 3 untranslated regions of mrnas (Olsen and Received: May 9, 2003 Revised: June 3, 2003 Ambros, 1999; Slack et al., 2000). We believe that this Accepted: June 18, 2003 is the probable role of the ES cell-specific mirnas. As Published online: July 3, 2003 yet, their targets have not been identified. Given that mirnas in this family have conserved consensus se- References quences at their 5 and 3 ends (Figure 2A), it is possible that they pair to the same set of mrna targets. Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C., Since ES cells are derived from the ICM of blastocysts, Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M., et al. (2003). A uniform system for microrna annotation. RNA 9, the cluster of ES cell-specific mirnas is likely to be involved in the regulation of early embryonic develop- Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B., and Cohen, ment. Because the sequence of events that takes place S.M. (2003). Bantam encodes a developmentally regulated miprior to implantation is unique to mammals, our failure crorna that controls cell proliferation and regulates the proapoto identify homologs of the ES cell-specific mirnas in ptotic gene hid in Drosophila. Cell 113, the fish D. rerio and F. rubripes may suggest a role in Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA developmental transitions that only occur in mammals, isolation by acid guanidinium thiocyanate-phenol-chloroform ex- such as the differentiation of the epiblast and tropho- traction. Anal. Biochem. 162, blast lineages in the blastocyst. Alternatively, these ES Cooper, H.M., Tamura, R.N., and Quaranta, V. (1991). The major cell-specific mirnas could be related to the pluripotent laminin receptor of mouse embryonic stem cells is a novel isoform status of the ES cell. In this case, the same mirnas of the alpha 6 beta 1 integrin. J. Cell Biol. 115, Doench, J.G., Petersen, C.P., and Sharp, P.A. (2003). sirnas can might be expressed in adult stem cells, and homologs function as mirnas. Genes Dev. 17, would be present in all vertebrates. Dostie, J., Mourelatos, Z., Yang, M., Sharma, A., and Dreyfuss, G. (2003). Numerous micrornps in neuronal cells containing novel mi- Experimental Procedures crornas. RNA 9, Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., ES Cell Growth and Differentiation and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs mediate J1 ES cells were grown under standard conditions. Differentiation RNA interference in cultured mammalian cells. Nature 411, in monolayer and embryoid bodies was as described (Guan et al., 2001; Wutz and Jaenisch, 2000). Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001b). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, mirna Preparation, Cloning, and Northern Analyses Oct4 was detected with a mixture of radiolabeled RT-PCR products Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., from ES cell total RNA amplified with primer pairs 5 -GTGAACAT Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and CAGGTGCCCACT-3 /5 -GTATCGGGGAATGCTGTCAT-3 and 5 -ACC mechanisms related to RNA interference regulate expression of the AGGCTCAGAGGTATTGG-3 /5 -TTCATGTCCTGGGACTCCTC-3.The small temporal RNAs that control C. elegans developmental timing. -actin and 18S rrna probes were synthesized by random priming Cell 106, of DECAtemplates (Ambion). Guan, K., Chang, H., Rolletschek, A., and Wobus, A.M. (2001). Em- mirnas were extracted via the acid guanidinium method (Chomlineage bryonic stem cell-derived neurogenesis. Retinoic acid induction and czynski and Sacchi, 1987), except that all precipitations were done selection of neuronal cells. Cell Tissue Res. 305, with 3 volumes of ethanol, instead of isopropanol, in order to ensure Hall, I.M., Shankaranarayana, G.D., Noma, K., Ayoub, N., Cohen, the recovery of short oligonucleotides. Northern analysis and clon- A., and Grewal, S.I. (2002). Establishment and maintenance of a ing of short RNAs were performed essentially as previously de- heterochromatin domain. Science 297, scribed (Hamilton and Baulcombe, 1999; Lau et al., 2001). Hamilton, A.J., and Baulcombe, D.C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science Bioinformatics 286, Database searches were performed at the ENSEMBL server ( Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). PERL scripts for the automatic submission of An RNA-directed nuclease mediates post-transcriptional gene siblast jobs and for the retrieval of the search results were based on lencing in Drosophila cells. Nature 404, the standard LWP, HTML, and HTTP PERL modules. Scripts for the Higgins, D.G., and Sharp, P.M. (1988). CLUSTAL: a package for analysis of mirnas against the ENSEMBL genomic annotations performing multiple sequence alignment on a microcomputer. Gene interacted directly with the relational database and relied extensively 73, on the ENSEMBL PERL API. mirna sequence comparisons were performed by multiple sequence alignment with CLUSTALW (Higturnover Hutvagner, G., and Zamore, P.D. (2002). A microrna in a multiple- gins and Sharp, 1988). Folding of mirna precursors was performed RNAi enzyme complex. Science 297, with MFOLD (Zuker et al., 1999). Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T.,

8 Developmental Cell 358 and Zamore, P.D. (2001). A cellular function for the RNA-interference Tang, G., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2003). A enzyme Dicer in the maturation of the let-7 small temporal RNA. biochemical framework for RNA silencing in plants. Genes Dev. 17, Science 293, Jones, L., Ratcliff, F., and Baulcombe, D.C. (2001). RNA-directed Volpe, T.A., Kidner, C., Hall, I.M., Teng, G., Grewal, S.I., and Martienstranscriptional gene silencing in plants can be inherited indepen- sen, R.A. (2002). Regulation of heterochromatic silencing and histone dently of the RNA trigger and requires Met1 for maintenance. Curr. H3 lysine-9 methylation by RNAi. Science 297, Biol. 11, Wutz, A., and Jaenisch, R. (2000). A shift from reversible to irreversible Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. X inactivation is triggered during ES cell differentiation. Mol. (2001). Identification of novel genes coding for small expressed Cell 5, RNAs. Science 294, Xie, Z., Kasschau, K.D., and Carrington, J.C. (2003). Negative Feedback Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, Regulation of Dicer-Like1 in Arabidopsis by microrna-guided W., and Tuschl, T. (2002). Identification of tissue-specific micrornas mrna Degradation. Curr. Biol. 13, from mouse. Curr. Biol. 12, Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel, D.P. (2000). RNAi: Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and double-stranded RNA directs the ATP-dependent cleavage of Tuschl, T. (2003). New micrornas from mouse and human. RNA 9, mrna at 21 to 23 nucleotide intervals. Cell 101, Zuker, M., Mathews, D.H., and Turner, D.H. (1999). Algorithms and Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. (2001). An thermodynamics for RNA secondary structure prediction: a practical abundant class of tiny RNAs with probable regulatory roles in guide. In RNA Biochemistry and Biotechnology, J. Barciszewski, and Caenorhabditis elegans. Science 294, B.F.C. Clark, eds. (Dordrecht, The Netherlands: Kluwer Academic Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, Lee, Y., Jeon, K., Lee, J.T., Kim, S., and Kim, V.N. (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, Lim, L.P., Glasner, M.E., Yekta, S., Burge, C.B., and Bartel, D.P. (2003a). Vertebrate microrna Genes. Science 299, Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B., and Bartel, D.P. (2003b). The micro- RNAs of Caenorhabditis elegans. Genes Dev. 17, Llave, C., Kasschau, K.D., Rector, M.A., and Carrington, J.C. (2002a). Endogenous and silencing-associated small RNAs in plants. Plant Cell 14, Llave, C., Xie, Z., Kasschau, K.D., and Carrington, J.C. (2002b). Cleavage of Scarecrow-like mrna targets directed by a class of Arabidopsis mirna. Science 297, Mette, M.F., Aufsatz, W., van der Winden, J., Matzke, M.A., and Matzke, A.J. (2000). Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19, Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). mirnps: a novel class of ribonucleoproteins containing numerous micrornas. Genes Dev. 16, Olsen, P.H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol. 216, Reinhart, B.J., and Bartel, D.P. (2002). Small RNAs correspond to centromere heterochromatic repeats. Science 297, Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21- nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., and Bartel, D.P. (2002). MicroRNAs in plants. Genes Dev. 16, Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., and Bartel, D.P. (2002). Prediction of plant microrna targets. Cell 110, Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruvkun, G. (2000). The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol. Cell 5, Smith, A. (2001). Embryonic stem cells. In Stem Cell Biology, D.R. Marshak, R.L. Gardner, and D. Gottlieb, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), pp Publishers).