Embryonic Stem Cell-Specific MicroRNAs

Save this PDF as:

Size: px
Start display at page:

Download "Embryonic Stem Cell-Specific MicroRNAs"


1 Developmental Cell, Vol. 5, , August, 2003, Copyright 2003 by Cell Press Embryonic Stem Cell-Specific MicroRNAs the regulation of development. In plants, mirnas have a striking propensity to target transcription factors in- volved in development (Rhoades et al., 2002), in C. elegans, mutations in lin-4 and let-7 cause heterochronic phenotypes (Lee et al., 1993; Olsen and Ambros, 1999; Reinhart et al., 2000), and, in D. melanogaster, the mirna encoded by the gene bantam is temporally and spatially expressed during development to control cell proliferation and apoptosis (Brennecke et al., 2003). A survey of mirnas cloned from mouse organs revealed that many were organ specific, consistent with roles in development (Lagos-Quintana et al., 2002, 2003). Embryonic stem (ES) cells are totipotent cell lines derived from the inner cell mass (ICM) of the mammalian blastocyst (Smith, 2001). In vitro differentiation of ES cells recapitulates some of the global genomic methyla- tion that takes place shortly after implantation and has been used to study the epigenetic events that accompany X chromosome inactivation during midblastula (Wutz and Jaenisch, 2000). To elucidate the roles of mirnas during these early developmental transitions, we cloned short, nt RNAs from undifferentiated and differentiated ES cells. Hristo B. Houbaviy, 1 Michael F. Murray, 1 and Phillip A. Sharp 1,2, * 1 Center for Cancer Research 2 The McGovern Institute for Brain Research and Department of Biology Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, Massachusetts Summary We have identified micrornas (mirnas) in undifferen- tiated and differentiated mouse embryonic stem (ES) cells. Some of these appear to be ES cell specific, have related sequences, and are encoded by genomic loci clustered within 2.2 kb of each other. Their expression is repressed as ES cells differentiate into em- bryoid bodies and is undetectable in adult mouse organs. In contrast, the levels of many previously described mirnas remain constant or increase upon differentiation. Our results suggest that mirnas may have a role in the maintenance of the pluripotent cell state and in the regulation of early mammalian development. Results and Discussion Introduction mirna Libraries from Undifferentiated and Differentiated ES Cells Cloning of short, nt RNAs from a variety of sources We constructed mirna libraries from three different identified a family of RNA species designated as micrornas sources: (1) ES cells grown on a feeder layer of irradiated (mirnas) (Dostie et al., 2003; Lagos-Quintana et al., mouse embryonic fibroblasts (MEF) and in the presence 2001, 2002, 2003; Lau et al., 2001; Lim et al., 2003a, of 500 U/ml leukemia inhibitory factor (LIF) (library L1), 2003b; Llave et al., 2002a; Mourelatos et al., 2002; Reinpresence of 1000 U/mL LIF (library L2), and (3) differenti- (2) ES cells grown in the absence of feeders and in the hart et al., 2002). Over 200 distinct mirnas have been discovered experimentally, and additional ones have ated ES cells maintained for 4 days in media containing been identified via computational approaches (Lim et al., 100 nmol/l all-trans-retinoic acid (RA) and no LIF (library L3). While library L1 could potentially be contaminated 2003a, 2003b). mirnas are structurally and functionally by MEF-derived mirna sequences, the corresponding related to the short interfering RNAs (sirna) that cause culture should contain the highest fraction of undifferen- RNA silencing (Elbashir et al., 2001a, 2001b; Hamilton tiated ES cells. Conversely, while some differentiation and Baulcombe, 1999; Hammond et al., 2000; Zamore may have occurred in the cell population used to generate et al., 2000). Both mirnas and sirnas are produced by library L2, it should not contain MEF-derived sequences. the RNase III nuclease Dicer, and both depend on the Finally, the sequences of mirnas induced during ES cell PAZ/PIWI domain (PPD) proteins for function and/or differentiation should be present in library L3. stability (Grishok et al., 2001; Hutvagner et al., 2001). To assess the degree of differentiation, we determined mirnas silence gene expression by repressing transthe steady-state levels of Oct4 mrna by Northern analylation or by directing the degradation of mrna. For sis, and the distribution of alternatively spliced isoforms example, mirnas encoded by the C. elegans genes lin-4 of the 6-integrin mrna was analyzed by RT-PCR (Figand let-7 (Lee et al., 1993; Reinhart et al., 2000) bind to ure 1). Oct4 is dramatically downregulated during differpartially complementary sites within their mrna targets entiation (Rosner et al., 1990), and there are quantitative and cause translational repression (Olsen and Ambros, shifts among the splicing isoforms of the 6-integrin 1999; Slack et al., 2000). However, the let-7 mirna can (Cooper et al., 1991). ES cells grown with and without cause mrna degradation in vitro if a perfectly comple- feeders were indistinguishable by both criteria they mentary target site is present (Hutvagner and Zamore, expressed high levels of Oct4 mrna and the short iso- 2002), and, similarly, many plant mirnas cleave mrna form of the 6-integrin message (Figure 1, lanes 1 and in vivo and in vitro (Llave et al., 2002b; Tang et al., 2003; 2). In contrast, after 4 days of growth in the presence Xie et al., 2003). of RA, the Oct4 mrna levels decreased more than 5-fold An important biological function of some mirnas is (Figure 1A, compare lanes 1 and 2 with lane 3), and the culture began to express the long isoform of the 6- *Correspondence: integrin mrna, consistent with differentiation (Figure

2 Developmental Cell 352 Figure 1. Molecular Markers of Undifferentiated and Differentiated ES Cell Cultures (A) Northern analyses of the expression of Oct4 (top) and the -actin mrna (middle) and 18S rrna (bottom) loading controls in undifferentiated ES cells grown with (lane 1) and without (lane 2) a feeder layer and in ES cells differentiated with RA in monolayer for 4 days (lane 3) or 14 days as embryoid bodies without (lane 4) and with RA (lane 5). (B) Expression of 6-integrin mrna isoforms analyzed by RT-PCR. Bands corresponding to the alternatively spliced variants are indicated by arrows. Lanes 1 5 correspond to lanes 1 5 in (A). Lanes 6 and 7 correspond to samples prepared from NIH/3T3 cells and the MEF feeders, respectively. 1B, lane 3). Moreover, both markers had similar expres- with flanking sequences are listed in Table 1. These sion patterns in the RA-induced monolayer culture and constitute 30% of the nonredundant clones in the in embryoid bodies after 14 days of differentiation (Fig- nt range. ure 1, lanes 3 5). Thus, both undifferentiated ES cell We do not know whether any of the remaining cultures contained a significant proportion of totipotent nt sequences are sirnas. Database searches did not ES cells, and most cells underwent differentiation in reveal clones derived from annotated mrnas. None of monolayer upon treatment with RA. the sequences match the mouse centromeric minor satellite, whose S. pombe counterpart has been implicated Data Analysis and Identification of mirnas in sirna-mediated heterochromatin silencing (Reinhart A total of 681 short RNA clones were isolated and se- and Bartel, 2002; Volpe et al., 2002). Similarly, none of quenced, of which 192 were from L1, 219 were from L2, the clones could be mapped to repetitive elements. and 270 were from L3. The data from the three libraries were pooled, and multiple instances of the same sequence were assigned to the longest clone. This resulted Novel mirnas from ES Cells in a nonredundant dataset comprised of 388 short RNAs. Of the 53 potential mirna clones for which hairpin pre- Most sequences (73%) were observed only once. Thus, cursors could be proposed, 32 were identical to previously the dataset probably does not represent the complete identified mirnas, 5 additional clones were clear pool of short RNAs present in undifferentiated and differ- homologs of known mirnas (mir-34a, mir-34b, mirentiated ES cells. In the final nonredundant dataset, a 106a, mir-106b, and mir-130b), and one (let-7d-as) was total of 179 clones (46%) were between 20 and 24 nt excised from the opposite side of a known mirna hairpin long, as expected for Dicer cleavage products (Elbashir precursor (Table 1). The remaining 15 sequences et al., 2001b; Zamore et al., 2000). Of these 37 matched are unrelated to any previously described mirnas in known rrna and trna sequences. the RFAM database (Ambros et al., 2003) (Table 1; mir- To distinguish mirnas from degradation products 290 mir-302). Interestingly, these mirnas are relatively and potential sirnas, we evaluated the ability of RNA poorly conserved (Table 1). While hairpin folds corre- corresponding to the genomic sequences surrounding sponding to most of them could be found in other mammalian the above 179 nonredundant clones to fold into potential genomes, i.e., human and rat, only one (mir-301) hairpin mirna precursors. This criterion, together with had a conserved hairpin in the fish Fugu rubripes, and phylogenetic conservation of the hairpin fold, is now none had homologs in invertebrates. generally accepted as good evidence for the existence One of the above clones, mir-297, was identical to of an mirna (Ambros et al., 2003; Lim et al., 2003a, 20 genomic segments and varied by one position from 2003b). The 53 candidate mirnas that formed hairpins 81 other loci. These sites overlapped annotated (CA) n,

3 ES Cell-Specific MicroRNAs 353 Table 1. mirnas from Undifferentiated and Differentiated ES Cells Observa- Conservations c Length d tion g ID a Sequence b L1 L2 L3 Average Maximum Minimum Rmsd Hits e Expression f Hs Rn Fr let-7d-as CUAUACGACCUGCUGCCUUUCU S00S0 mir-34a AGGCAGUGUAGUUAGCUGAUUGC mir-34b UAGGCAGUGUAAUUAGCUGAUUG mir-106a CAAAGUGCUAACAGUGCAGGUA mir-106b UAAAGUGCUGACAGUGCAGAU mir-130b CAGUGCAAUGAUGAAAGGGCAU mir-290 CUCAAACUAUGGGGGCACUUUUU Hs Rn mir-291-s CAUCAAAGUGGAGGCCCUCUCU Rn mir-291-as AAAGUGCUUCCACUUUGUGUGCC Rn mir-292-s ACUCAAACUGGGGGCUCUUUUG Hs mir-292-as AAGUGCCGCCAGGUUUUGAGUGU Hs Rn mir-293 AGUGCCGCAGAGUUUGUAGUGU mir-294 AAAGUGCUUCCCUUUUGUGUGU mir-295 AAAGUGCUACUACUUUUGAGUCU Rn mir-296 AGGGCCCCCCCUCAAUCCUGU Hs mir-297 AUGUAUGUGUGCAUGUGCAUG Hs Rn mir-298 GGCAGAGGAGGGCUGUUCUUCC SSSS0 mir-299 UGGUUUACCGUCCCACAUACAU Hs Rn mir-300 UAUGCAAGGGCAAGCUCUCUUC Rn mir-301 CAGUGCAAUAGUAUUGUCAAAGC Hs Rn Fr mir-302 UAAGUGCUUCCAUGUUUUGGUGA Hs let-7c UGAGGUAGUAGGUUGUAUGGUUA S1 mir-15a UAGCAGCACAUAAUGGUUUGUG mir-15b UAGCAGCACAUCAUGGUUUAC mir-16 UAGCAGCACGUAAAUAUUGGCG mir-18 UAAGGUGCAUCUAGUGCAGAUA mir-19b UGUGCAAAUCCAUGCAAAACUGA mir-20 UAAAGUGCUUAUAGUGCAGGUAG mir-21 UAGCUUAUCAGACUGAUGUUGAC mir-22 AAGCUGCCAGUUGAAGAACUGU mir-24 UGGCUCAGUUCAGCAGGAACAG mir-27a UUCACAGUGGCUAAGUUCCGC mir-29a UAGCACCAUCUGAAAUCGGUUA mir-29b UAGCACCAUUUGAAAUCAGUGUU mir-30e UGUAAACAUCCUUGACUGGAAGC mir-31 AGGCAAGAUGCUGGCAUAGCUG mir-92 UAUUGCACUUGUCCCGGCCUG mir-93 CAAAGUGCUGUUCGUGCAGGUAG mir-94 UAAAGUGCUGACAGUGCAGAU mir-96 UUUGGCACUAGCACAUUUUUGCU mir-99b CACCCGUAGAACCGACCUUGCG S00S0 mir-124-a UAAGGCACGCGGUGAAUGCCA mir-127 UCGGAUCCGUCUGAGCUUGGCUA mir-130 CAGUGCAAUGUUAAAAGGGCAU mir-141a UAACACUGUCUGGUAAAGAUGGCC S0 mir-142s CCCAUAAAGUAGAAAGCACUA mir-142-as UGUAGUGUUUCCUACUUUAUGGA mir-143a UGAGAUGAAGCACUGUAGCUCUUA mir-172 UGGCAGUGUCUUAGCUGGUUGUU mir-183 UAUGGCACUGGUAGAAUUCAC SSSS0 mir-193 AACUGGCCUACAAAGUCCCAGU S00S1 mir-199-s CCCAGUGUUCAGACUACCUGUUC mir-199-as ACAGUAGUCUGCACAUUGGUUA a mirnas experimentally determined for the first time in this study are listed first. The letters s and as designate mirnas excised from the 5 and 3 strands of the same hairpin stem respectively, according to Lagos-Quintana et al. (2002). b The longest clone that matches perfectly the mouse genomic sequence is given. c Number of observations in libraries L1, L2, and L3 d Average, maximum and minimum lengths. Rmsd, root-mean-square deviation from the average. e Number of genomic hits. f Expression patterns by Northern analysis. Single digit numbers indicate the approximate relative band intensities as shown in Figure 2 and give no information about the relative levels of different mirnas. S indicates the presence of a smear that precluded detection of the mirna. g For mir-290 mir-302, which do not have previously reported homologs, the presence of conserved stem loops in the human (Hs), rat (Rn), and pufferfish (Fr) genomes is indicated.

4 Developmental Cell 354

5 ES Cell-Specific MicroRNAs 355 (TG) n, SINE, B3, and B4 repeats in the ENSEMBL database. Hairpin mirna precursors could be derived from three of these locations. While it could be argued that stem loop structures would occur by chance in (CA) n, (TG) n -rich sequences, expression data support the exis- tence of mir-297 (discussed below). The remaining 14 potential mirnas map to 12 distinct stem loop precursors. Two of these hairpins (mir-291 and mir-292) yield cloned RNAs corresponding to both strands of the stem (Table 1). Multiple sequence alignment revealed that six pre- mirna precursors (mir-290, mir-291, mir-292, mir- 293, mir-294, and mir-295) have related sequences (Figure 2A). Mature mirnas were processed from both the 5 and the 3 sides of these hairpins (Figure 2A; mirna consensus sequences 5 -ACUCAAANUGGGG GCNCUCUUUU-3 and 5 -AAAGUGCGC(N) 2 4 UUUUGA GUGU-3, respectively), and clones corresponding to the 3 sides were more frequently observed (Table 1). When two mirnas are processed from the opposing strands of the same hairpin stem, it is thought that the more abundant mirna has a biological function, whereas the less abundant species is a nonfunctional byproduct of the reaction catalyzed by Dicer (Lagos- Quintana et al., 2002; Lau et al., 2001). Interestingly, the above six related pre-mirnas map in the same relative orientation within a 2.2 kb region of genomic sequence that has not been assigned a specific chromosomal location in the mouse genome assembly (Figure 2B). Thus, adjacent hairpins in the cluster may be initially synthesized as common primary transcripts (pri-mirna) (Lee et al., 2002). Over 200 mirnas have been cloned from mammalian cell lines and mouse organs, but none have been derived from early embryos. Therefore, the fact that mirnas expressed from the hairpin cluster have not been ob- served previously strongly suggests that they are indeed ES cell specific. To obtain additional support for this conclusion, we searched the expressed sequence tag (EST) database for entries homologous to the 2.2 kb segment containing the cluster of six pre-mirnas. Consistent with the mirna cloning data, the top sevenscoring ESTs (score, 315, and identity, 98%) that map within this genomic segment correspond to cdnas prepared from preimplantation embryos or ES cells (Figure 2B). ESTs derived from preimplantation embryos or ES cells constitute approximately 5% of the total mouse EST data in GenBank. ESTs from the remainder of the database aligned better elsewhere in the mouse genome and/or were homologous to multiple genomic locations (data not shown). Thus, the EST data strongly suggests that expression of the mirna cluster is restricted to preimplantation embryos and ES cells and supports the existence of a large primary transcript encompassing several hairpins (Figure 2B). BLAST searches identified only a single human homolog (mir-hes1, located on chromosome 19) of the six hairpins in the mouse cluster. However, systematic scanning of the genomic region adjacent to mir-hes1 for sequences that can fold into hairpins identified two additional potential human pre-mirnas (mir-hes2 and mir-hes3) related to the members of the mouse cluster (Figures 2A and 2C). Within the corresponding human and mouse genomic segments, the pre-mirna hairpins are the only regions with obvious sequence homology. mirna Expression Patterns during ES Cell Differentiation To confirm expression of mirnas, we performed Northern analyses on samples from undifferentiated and dif- ferentiated ES cell cultures (Figure 3A, lanes 2 4 in all panels) as well as from the MEF feeder layer and NIH/ 3T3 cells (Figure 3A, lanes 1 and 5, respectively). A total of 39 (74%) of the mirnas shown in Table 1 were ana- lyzed. Of these, 30 gave robust bands migrating as RNA of approximately nt in at least one lane (Figure 3A and Table 1). The rest either showed no detectable signal or a smear that made it difficult to determine whether a discrete band was present. Of the 15 clones unrelated to previously described mirnas, we confirmed the expression of 11 by Northern analysis, including at least 1 mature mirna from each of the 6 clustered hairpins (Figure 3A and Table 1). Three of the remaining four clones could not be detected (mir-298, mir-299, and mir-300), and one other clone (mir-291-s) was not tested. Northern analyses showed that mir-29a, mir-29b, mir-193, mir-199-s, and mir-199-as were detectable only in the MEFs and NIH/3T3 cells, but not in undifferen- tiated or differentiated ES cell cultures (Table 1 and data not shown). Thus, library L1 did contain some MEF sequence contamination. mirnas processed from the hairpin cluster (mir-290, mir-291-as, mir-292-as, mir-293, mir-294, and mir- 295) were expressed in ES cells grown with feeders, ES cells grown without feeders, and ES cells differentiated for 4 days in monolayer in the presence of RA, but not in MEFs or NIH/3T3 cells (Figure 3A and Table 1). More importantly, these mirnas were repressed in embryoid bodies prepared by culturing ES cells for 14 days in either the presence or absence of RA (Figure 3B, com- pare lanes 1 and 2 with lanes 3 and 4). Furthermore, Northern analyses failed to detect mirnas from the cluster in adult mouse organs (Figure 3B, lanes 5 12). In contrast, consistent with previous reports, let-7c and mir-16 were readily detectable in many of the organs (Lagos-Quintana et al., 2002, 2003). The above results strongly suggest that expression of the pre-mirna clus- ter is specific for pluripotent ES cells and is either si- lenced or downregulated upon differentiation. This conclusion does not conflict with the expression of the Figure 2. Genomic Organization of the ES Cell-Specific mirna Clusters (A) Multiple sequence alignment of the genomic DNA segments corresponding to the cluster of mouse ES cell-specific pre-mirnas (mir-290, 291, 292, 293, 294, and 295) and their human homologs (mir-hes1, 2, and 3). The positions of mature mirnas that were cloned are highlighted in yellow. Conserved residues are shown in red. The mouse and human clusters are illustrated in (B) and (C), respectively, together with the secondary structures of proposed precursor RNAs. The experimentally determined (B) and hypothetical (C) positions of the mature mirnas are shown in red. Genomic coordinates are given as chromosome:start-end (Un, unmapped sequence space). ESTs that map to the mouse cluster are shown with their GenBank accession numbers in (B).

6 Developmental Cell 356 Figure 3. Northern Analyses of the mirna Expression Patterns In (A) the arrangement of samples is identical in all panels and is as follows: lane 1, feeder layer; lane 2, ES cells grown on feeders; lane 3, ES cells grown without feeders; lane 4, ES cells differentiated in monolayer with RA; lane 5, NIH/3T3 cells. The names of the mirnas analyzed are given above each panel. trna-ile-att serves as a loading control. Because of different exposures, comparisons of the signals between panels are not meaningful. (B) Expression of mirnas in ES cells (lane 1), ES cells differentiated in monolayer in the presence of RA (lane 2), embryoid bodies cultured for 14 days without (lane 3) and with (lane 4) RA, and mouse organs (lanes 5 12). The names of the organs are given on top, and the names of the mirnas are given on the right. above cluster in ES cells differentiated in monolayer. consists of the mirnas processed from the hairpin cluster The half-life of these mirnas may be sufficiently long and, potentially, mir-296. (2) mirnas that are ex- that 4 days of culture might not be adequate for their pressed in ES cell cultures as in (1) but were found in clearance. adult tissues by previous cloning. These are likely to Four other mirnas, unrelated to previously described regulate general aspects of cell physiology. This set sequences, were detected by Northern analyses (mir- consists of mir-15a, mir-16, mir-19b, mir-92, mir-93, 296, mir-297, mir-301, and mir-302). Their expression mir-96, mir-130 and mir-130b. (3) The set of mirnas patterns suggest that only mir-296 could potentially be cloned from undifferentiated ES cells, the expression of ES cell specific (Figure 3A and Table 1). which increases dramatically upon differentiation. Such It is difficult, with the results to date, to conclude that mirnas are almost certainly contributed by the subpopan mirna is expressed in undifferentiated ES cells if ulation of spontaneously differentiated cells in the culture. this same mirna is induced upon differentiation. This Among this set are mir-21 and mir-22. difficulty arises because all ES cell cultures contain a The cluster of ES cell-specific pre-mirnas could have small proportion of spontaneously differentiated cells. important roles in maintaining the pluripotent cell state. In spite of this, it is tempting to group the mirna expres- Short, nt RNAs, either mirnas or sirnas, are sion data into the following three patterns. (1) The set known to regulate gene expression by three different of mirnas, the levels of which remain relatively constant mechanisms. The first is the silencing of a gene by directing in undifferentiated ES cells and in monolayer cultures mrna degradation. This requires extensive differentiated with RA and which were not found in adult complementarity between the short RNA and a target tissues by either Northern analyses or previous cloning. site in the mrna (Doench et al., 2003; Hutvagner and This set is likely to have ES cell-specific functions and Zamore, 2002; Llave et al., 2002b; Tang et al., 2003).

7 ES Cell-Specific MicroRNAs 357 Pertinent to this, none of the mirnas processed from Acknowledgments the hairpin cluster are exactly complementary to known We would like to thank N. Lau and D. Bartel for sharing their mirna mrnas. The second mechanism involves directing inhicloning protocols and D. Bartel, A. Grishok, D. Tantin, D. Dimova, bition of transcription due to either chromatin modifica- C. Novina, J. Doench, C. Petersen, D. Dykxhoorn, C. Cheng, and V. tion or DNA methylation (Hall et al., 2002; Jones et al., Wang for discussions and critical review of the manuscript. This 2001; Mette et al., 2000; Volpe et al., 2002). While the research was supported by fellowship from the Jane Coffin extent of complementarity required for transcriptional Childs Fund for Medical Research to H.B.H., genetics training grant silencing by short RNAs has not been investigated, we T32-GM07748 from the National Institutes of Health to M.F.M., United States Public Health Service MERIT Award R37-GM34277 note that no loci within the mouse genome, other than from the National Institutes of Health, National Science Foundation the actual hairpin precursors, are exactly complemen- Grant , and PO1 grant CA42063 from the National Cancer tary to clones originating from the pre-mirna cluster. Institute to P.A.S., and, partially, by Cancer Center Support (core) The third mechanism is the traditional role of inhibiting grant P30-CA14051 from the National Cancer Institute. translation by mirnas pairing with partial complementarity to 3 untranslated regions of mrnas (Olsen and Received: May 9, 2003 Revised: June 3, 2003 Ambros, 1999; Slack et al., 2000). We believe that this Accepted: June 18, 2003 is the probable role of the ES cell-specific mirnas. As Published online: July 3, 2003 yet, their targets have not been identified. Given that mirnas in this family have conserved consensus se- References quences at their 5 and 3 ends (Figure 2A), it is possible that they pair to the same set of mrna targets. Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C., Since ES cells are derived from the ICM of blastocysts, Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M., et al. (2003). A uniform system for microrna annotation. RNA 9, the cluster of ES cell-specific mirnas is likely to be involved in the regulation of early embryonic develop- Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B., and Cohen, ment. Because the sequence of events that takes place S.M. (2003). Bantam encodes a developmentally regulated miprior to implantation is unique to mammals, our failure crorna that controls cell proliferation and regulates the proapoto identify homologs of the ES cell-specific mirnas in ptotic gene hid in Drosophila. Cell 113, the fish D. rerio and F. rubripes may suggest a role in Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA developmental transitions that only occur in mammals, isolation by acid guanidinium thiocyanate-phenol-chloroform ex- such as the differentiation of the epiblast and tropho- traction. Anal. Biochem. 162, blast lineages in the blastocyst. Alternatively, these ES Cooper, H.M., Tamura, R.N., and Quaranta, V. (1991). The major cell-specific mirnas could be related to the pluripotent laminin receptor of mouse embryonic stem cells is a novel isoform status of the ES cell. In this case, the same mirnas of the alpha 6 beta 1 integrin. J. Cell Biol. 115, Doench, J.G., Petersen, C.P., and Sharp, P.A. (2003). sirnas can might be expressed in adult stem cells, and homologs function as mirnas. Genes Dev. 17, would be present in all vertebrates. Dostie, J., Mourelatos, Z., Yang, M., Sharma, A., and Dreyfuss, G. (2003). Numerous micrornps in neuronal cells containing novel mi- Experimental Procedures crornas. RNA 9, Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., ES Cell Growth and Differentiation and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs mediate J1 ES cells were grown under standard conditions. Differentiation RNA interference in cultured mammalian cells. Nature 411, in monolayer and embryoid bodies was as described (Guan et al., 2001; Wutz and Jaenisch, 2000). Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001b). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, mirna Preparation, Cloning, and Northern Analyses Oct4 was detected with a mixture of radiolabeled RT-PCR products Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., from ES cell total RNA amplified with primer pairs 5 -GTGAACAT Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and CAGGTGCCCACT-3 /5 -GTATCGGGGAATGCTGTCAT-3 and 5 -ACC mechanisms related to RNA interference regulate expression of the AGGCTCAGAGGTATTGG-3 /5 -TTCATGTCCTGGGACTCCTC-3.The small temporal RNAs that control C. elegans developmental timing. -actin and 18S rrna probes were synthesized by random priming Cell 106, of DECAtemplates (Ambion). Guan, K., Chang, H., Rolletschek, A., and Wobus, A.M. (2001). Em- mirnas were extracted via the acid guanidinium method (Chomlineage bryonic stem cell-derived neurogenesis. Retinoic acid induction and czynski and Sacchi, 1987), except that all precipitations were done selection of neuronal cells. Cell Tissue Res. 305, with 3 volumes of ethanol, instead of isopropanol, in order to ensure Hall, I.M., Shankaranarayana, G.D., Noma, K., Ayoub, N., Cohen, the recovery of short oligonucleotides. Northern analysis and clon- A., and Grewal, S.I. (2002). Establishment and maintenance of a ing of short RNAs were performed essentially as previously de- heterochromatin domain. Science 297, scribed (Hamilton and Baulcombe, 1999; Lau et al., 2001). Hamilton, A.J., and Baulcombe, D.C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science Bioinformatics 286, Database searches were performed at the ENSEMBL server ( Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). PERL scripts for the automatic submission of An RNA-directed nuclease mediates post-transcriptional gene siblast jobs and for the retrieval of the search results were based on lencing in Drosophila cells. Nature 404, the standard LWP, HTML, and HTTP PERL modules. Scripts for the Higgins, D.G., and Sharp, P.M. (1988). CLUSTAL: a package for analysis of mirnas against the ENSEMBL genomic annotations performing multiple sequence alignment on a microcomputer. Gene interacted directly with the relational database and relied extensively 73, on the ENSEMBL PERL API. mirna sequence comparisons were performed by multiple sequence alignment with CLUSTALW (Higturnover Hutvagner, G., and Zamore, P.D. (2002). A microrna in a multiple- gins and Sharp, 1988). Folding of mirna precursors was performed RNAi enzyme complex. Science 297, with MFOLD (Zuker et al., 1999). Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T.,

8 Developmental Cell 358 and Zamore, P.D. (2001). A cellular function for the RNA-interference Tang, G., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2003). A enzyme Dicer in the maturation of the let-7 small temporal RNA. biochemical framework for RNA silencing in plants. Genes Dev. 17, Science 293, Jones, L., Ratcliff, F., and Baulcombe, D.C. (2001). RNA-directed Volpe, T.A., Kidner, C., Hall, I.M., Teng, G., Grewal, S.I., and Martienstranscriptional gene silencing in plants can be inherited indepen- sen, R.A. (2002). Regulation of heterochromatic silencing and histone dently of the RNA trigger and requires Met1 for maintenance. Curr. H3 lysine-9 methylation by RNAi. Science 297, Biol. 11, Wutz, A., and Jaenisch, R. (2000). A shift from reversible to irreversible Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. X inactivation is triggered during ES cell differentiation. Mol. (2001). Identification of novel genes coding for small expressed Cell 5, RNAs. Science 294, Xie, Z., Kasschau, K.D., and Carrington, J.C. (2003). Negative Feedback Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, Regulation of Dicer-Like1 in Arabidopsis by microrna-guided W., and Tuschl, T. (2002). Identification of tissue-specific micrornas mrna Degradation. Curr. Biol. 13, from mouse. Curr. Biol. 12, Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel, D.P. (2000). RNAi: Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and double-stranded RNA directs the ATP-dependent cleavage of Tuschl, T. (2003). New micrornas from mouse and human. RNA 9, mrna at 21 to 23 nucleotide intervals. Cell 101, Zuker, M., Mathews, D.H., and Turner, D.H. (1999). Algorithms and Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. (2001). An thermodynamics for RNA secondary structure prediction: a practical abundant class of tiny RNAs with probable regulatory roles in guide. In RNA Biochemistry and Biotechnology, J. Barciszewski, and Caenorhabditis elegans. Science 294, B.F.C. Clark, eds. (Dordrecht, The Netherlands: Kluwer Academic Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, Lee, Y., Jeon, K., Lee, J.T., Kim, S., and Kim, V.N. (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, Lim, L.P., Glasner, M.E., Yekta, S., Burge, C.B., and Bartel, D.P. (2003a). Vertebrate microrna Genes. Science 299, Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B., and Bartel, D.P. (2003b). The micro- RNAs of Caenorhabditis elegans. Genes Dev. 17, Llave, C., Kasschau, K.D., Rector, M.A., and Carrington, J.C. (2002a). Endogenous and silencing-associated small RNAs in plants. Plant Cell 14, Llave, C., Xie, Z., Kasschau, K.D., and Carrington, J.C. (2002b). Cleavage of Scarecrow-like mrna targets directed by a class of Arabidopsis mirna. Science 297, Mette, M.F., Aufsatz, W., van der Winden, J., Matzke, M.A., and Matzke, A.J. (2000). Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19, Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). mirnps: a novel class of ribonucleoproteins containing numerous micrornas. Genes Dev. 16, Olsen, P.H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol. 216, Reinhart, B.J., and Bartel, D.P. (2002). Small RNAs correspond to centromere heterochromatic repeats. Science 297, Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21- nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., and Bartel, D.P. (2002). MicroRNAs in plants. Genes Dev. 16, Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., and Bartel, D.P. (2002). Prediction of plant microrna targets. Cell 110, Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruvkun, G. (2000). The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol. Cell 5, Smith, A. (2001). Embryonic stem cells. In Stem Cell Biology, D.R. Marshak, R.L. Gardner, and D. Gottlieb, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), pp Publishers).

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

Considerable evidence now indicates that small noncoding

Considerable evidence now indicates that small noncoding MicroRNAs and small interfering RNAs can inhibit mrna expression by similar mechanisms Yan Zeng*, Rui Yi, and Bryan R. Cullen* *Howard Hughes Medical Institute and Department of Molecular Genetics and

More information

Analytical Study of Hexapod mirnas using Phylogenetic Methods

Analytical Study of Hexapod mirnas using Phylogenetic Methods Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,

More information

sirnas can function as mirnas

sirnas can function as mirnas RESEARCH COMMUNICATION sirnas can function as mirnas John G. Doench, 1,3 Christian P. Petersen, 1,3 and Phillip A. Sharp 1,2,4 1 Center for Cancer Research, Department of Biology, and 2 McGovern Institute

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

MicroRNAs: something important between the genes Allison C Mallory 1 and Hervé Vaucheret 2

MicroRNAs: something important between the genes Allison C Mallory 1 and Hervé Vaucheret 2 MicroRNAs: something important between the genes Allison C Mallory 1 and Hervé Vaucheret 2 Non-coding small endogenous RNAs, of 21 24 nucleotides in length, have recently emerged as important regulators

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific antiviral defense mechanism in plants. has parallels

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

RNAi History, Mechanism and Application

RNAi History, Mechanism and Application DRUG DISCOVERY AND DEVELOPMENT RNAi History, Mechanism and Application Shuo Gu The History of RNAi About the author: Dr. Shuo Gu is currently a Postdoctoral Scholar at Stanford University, School of Medicine.

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

MicroRNAs: key participants in gene regulatory networks Commentary Xi-Song Ke, Chang-Mei Liu, De-Pei Liu and Chih-Chuan Liang

MicroRNAs: key participants in gene regulatory networks Commentary Xi-Song Ke, Chang-Mei Liu, De-Pei Liu and Chih-Chuan Liang 516 MicroRNAs: key participants in gene regulatory networks Commentary Xi-Song Ke, Chang-Mei Liu, De-Pei Liu and Chih-Chuan Liang micrornas (mirnas) are a newly identified and surprisingly large class

More information

In silico evidence of the relationship between mirnas and sirnas

In silico evidence of the relationship between mirnas and sirnas In silico evidence of the relationship between mirnas and sirnas In silico evidence of the relationship between mirnas and sirnas Ludovica Montanucci 1, Piero Fariselli 1*, Pier Luigi Martelli 1, Ivan

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

The microrna world: small is mighty

The microrna world: small is mighty 534 The microrna world: small is mighty Peter Nelson 1, Marianthi Kiriakidou 1,2, Anup Sharma 1, Elsa Maniataki 1 and Zissimos Mourelatos 1 1 Department of Pathology, University of Pennsylvania School

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information

Characterization of a highly variable eutherian microrna gene

Characterization of a highly variable eutherian microrna gene Characterization of a highly variable eutherian microrna gene HRISTO B. HOUBAVIY, 1 LUCAS DENNIS, 2,3 RUDOLF JAENISCH, 2,3 and PHILLIP A. SHARP 1,2 1 Center for Cancer Research and 2 Department of Biology,

More information

Depletion of human microrna mir-125b reveals that it is critical for. the proliferation of differentiated cells but not for the down-regulation

Depletion of human microrna mir-125b reveals that it is critical for. the proliferation of differentiated cells but not for the down-regulation JBC Papers in Press. Published on February 18, 2005 as Manuscript M412247200 Depletion of human microrna mir-125b reveals that it is critical for the proliferation of differentiated cells but not for the

More information

Expanding roles for mirnas and sirnas in cell regulation Kenji Nakahara and Richard W Carthew 1

Expanding roles for mirnas and sirnas in cell regulation Kenji Nakahara and Richard W Carthew 1 Expanding roles for mirnas and sirnas in cell regulation Kenji Nakahara and Richard W Carthew 1 The role of small RNAs as key regulators of mrna turnover and translation has been well established. Recent

More information

PART 3.3: MicroRNA and Cancer

PART 3.3: MicroRNA and Cancer BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway

More information

Inducing RNAi in Mammalian Cells

Inducing RNAi in Mammalian Cells Inducing RNAi in Mammalian Cells Ambion, Inc. www.ambion.com techserv@ambion.com sirna localized to the perinuclear space View at: www.ambion.com/techlib/presentations Important Applications of RNAi Ascertain

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Functional RNAs; RNA catalysts, mirna,

Functional RNAs; RNA catalysts, mirna, Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other

More information

A MicroRNA in a Multiple-Turnover RNAi Enzyme Complex

A MicroRNA in a Multiple-Turnover RNAi Enzyme Complex A MicroRNA in a Multiple-Turnover RNAi Enzyme Complex György Hutvágner and Phillip D. Zamore* Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Lazare Research

More information

micrornas Contents Introduction

micrornas Contents Introduction micrornas Contents Introduction... 1 Structure and Function of mirnas... 2 Plant mirnas... 4 mirna Biosynthesis... 5 Evolution of mirnas... 6 Conclusions... 9 References and Resources... 9 Introduction

More information

In Silico Evidence of the Relationship Between mirnas and sirnas

In Silico Evidence of the Relationship Between mirnas and sirnas The Open Applied Informatics Journal, 2008, 2, 9-13 9 In Silico Evidence of the Relationship Between mirnas and sirnas L. Montanucci 1, P. Fariselli *,1, P.L. Martelli 1, I. Rossi 1,2 and R. Casadio 1

More information

sirna Duplexes & RNAi Explorer

sirna Duplexes & RNAi Explorer P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01

More information

missing LINKS: mirnas and plant development Christine Hunter and R Scott Poethig

missing LINKS: mirnas and plant development Christine Hunter and R Scott Poethig 372 missing LINKS: mirnas and plant development Christine Hunter and R Scott Poethig The discovery of hundreds of plant micro RNAs (mirnas) has triggered much speculation about their potential roles in

More information


!!!!!!!!!!!!!!!!!!!!!!!!!! Figure S7 cdl-1 3'UTR gld-1 binding site (4..10) let-7 binding site (326..346) Figure Legends Figure S1. gld-1 genetically interacts with nhl-2 and vig-1 during germline development. (A) nhl-2(ok818) enhances

More information

Current Topics in RNAi

Current Topics in RNAi Current Topics in RNAi Essays on current, confusing, controversial, or otherwise interesting topics in the field of RNA interference Why Rational Pooling of sirnas is SMART Mike Straka, PhD, and Queta

More information

Controls Over Genes. Chapter 15

Controls Over Genes. Chapter 15 Controls Over Genes Chapter 15 Impacts, Issues: Between You and Eternity Mutations in some genes predispose individuals to develop certain kinds of cancer; mutations in BRAC genes cause breast cancer normal

More information

V22: involvement of micrornas in GRNs

V22: involvement of micrornas in GRNs What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,

More information


MicroRNAs: SMALL RNAs WITH A BIG ROLE IN GENE REGULATION MicroRNAs: SMALL RNAs WITH A BIG ROLE IN GENE REGULATION Lin He and Gregory J. Hannon MicroRNAs are a family of small, non-coding RNAs that regulate gene expression in a sequence-specific manner. The two

More information

RNA interference: Silencing in the cytoplasm and nucleus Nathaniel R Dudley & Bob Goldstein*

RNA interference: Silencing in the cytoplasm and nucleus Nathaniel R Dudley & Bob Goldstein* 113 RNA interference: Silencing in the cytoplasm and nucleus Nathaniel R Dudley & Bob Goldstein* Address Biology Department University of North Carolina 616 Fordham Hall Chapel Hill NC 27599-3280 USA Email:

More information

Functional sirnas and mirnas Exhibit Strand Bias

Functional sirnas and mirnas Exhibit Strand Bias Cell, Vol. 115, 209 216, October 17, 2003, Copyright 2003 by Cell Press Functional sirnas and mirnas Exhibit Strand Bias Anastasia Khvorova, 1,2 Angela Reynolds, 1,2 Hutvágner et al., 2001; Ketting et

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Report. RNA Secondary Structural Determinants of mirna Precursor Processing in Arabidopsis

Report. RNA Secondary Structural Determinants of mirna Precursor Processing in Arabidopsis Current Biology 20, 37 41, January 12, 2010 ª2010 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2009.10.076 RNA Secondary Structural Determinants of mirna Precursor Processing in Arabidopsis Report

More information

srnas of Plants Small, Non-coding RNAs of Plants microrna ( mirnas small interfering RNA ( sirnas Plant mirnas MIR

srnas of Plants Small, Non-coding RNAs of Plants microrna ( mirnas small interfering RNA ( sirnas Plant mirnas MIR srnas of Plants Small, Non-coding RNAs of Plants Regulatory RNAs that act through gene silencing Two classes of small RNAs (srnas) o microrna (mirnas) Encoded by genes in the genome o small interfering

More information

sirna and mirna: an insight into RISCs

sirna and mirna: an insight into RISCs Review TRENDS in Biochemical Sciences Vol.30 No.2 February 2005 sirna and mirna: an insight into s Guiliang Tang Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical

More information

Complexity in life, multicellular organisms and micrornas

Complexity in life, multicellular organisms and micrornas Complexity in life, multicellular organisms and micrornas Ohad Manor Abstract In this work I would like to discuss the question of defining complexity, and to focus specifically on the question of defining

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

Plant and animal micrornas: similarities and differences

Plant and animal micrornas: similarities and differences Funct Integr Genomics (2005) 5: 129 135 DOI 10.1007/s10142-005-0145-2 REVIEW Anthony A. Millar. Peter M. Waterhouse Plant and animal micrornas: similarities and differences Received: 21 November 2004 /

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

What makes cells different from each other? How do cells respond to information from environment?

What makes cells different from each other? How do cells respond to information from environment? What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which

More information

Determinants of targeting by endogenous and exogenous micrornas and sirnas

Determinants of targeting by endogenous and exogenous micrornas and sirnas Determinants of targeting by endogenous and exogenous micrornas and sirnas CYDNEY B. NIELSEN, 1,3 NOAM SHOMRON, 1,3 RICKARD SANDBERG, 1 ERAN HORNSTEIN, 2,4 JACOB KITZMAN, 1,5 and CHRISTOPHER B. BURGE 1

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Alternative Splicing in Higher Plants. Just Adding to Proteomic Diversity or an Additional Layer of Regulation?

Alternative Splicing in Higher Plants. Just Adding to Proteomic Diversity or an Additional Layer of Regulation? in Higher Plants Just Adding to Proteomic Diversity or an Additional Layer of Regulation? Alternative splicing is nearly ubiquitous in eukaryotes It has been found in plants, flies, worms, mammals, etc.

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Sequence requirements for micro RNA processing and function in human cells

Sequence requirements for micro RNA processing and function in human cells Sequence requirements for micro RN processing and function in human cells YN ZENG 1 and BRYN R. ULLEN 1,2 1 Howard Hughes Medical Institute, 2 Department of Molecular Genetics and Microbiology, Duke University

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

"Supplemental Research Data" http://www.genome.org/cgi/content/full/gr.6539108/dc1

Supplemental Research Data http://www.genome.org/cgi/content/full/gr.6539108/dc1 Xenopus microrna genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation Guo-Qing Tang and E. Stuart Maxwell Genome Res.

More information

Expression analysis of Drosophila melanogaster micrornas

Expression analysis of Drosophila melanogaster micrornas Expression analysis of Drosophila melanogaster micrornas Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultäten der Georg-August-Universität zu Göttingen vorgelegt

More information

The Small RNA World (TTPB5) Teaching Guide

The Small RNA World (TTPB5) Teaching Guide The Plant Cell, May 2013, www.plantcell.org 2013 American Society of Plant Biologists The Small RNA World (TTPB5) Teaching Guide Overview Small RNAs confer specificity to a set of pathways collectively

More information

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22 Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker

More information

The role of micrornas in synaptic development and function

The role of micrornas in synaptic development and function BMB reports Mini Review The role of micrornas in synaptic development and function Rachel Corbin #, Katherine Olsson-Carter # & Frank Slack * Department of Molecular, Cellular and Developmental Biology,

More information


P E R S P E C T I V E Approaches to microrna discovery Eugene Berezikov, Edwin Cuppen & Ronald H A Plasterk MicroRNAs (mirnas) are noncoding RNAs that can regulate gene expression. Several hundred genes encoding mirnas have

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

Tutorial. Getting started with Ensembl Module 1 Introduction

Tutorial. Getting started with Ensembl  Module 1 Introduction Tutorial Getting started with Ensembl www.ensembl.org Ensembl provides genes and other annotation such as regulatory regions, conserved base pairs across species, and mrna protein mappings to the genome.

More information

If you need additional information please contact me at 609 9 19-0275 or esc8@,comcast.net).

If you need additional information please contact me at 609 9 19-0275 or esc8@,comcast.net). UMDNT SCHOOLOF 0 STEOPATH IC Page 1 of2 University of Medicine & Dentistry of New Jersey Office of Research and Sponsored Programs June 4,2007 Division of Nuclear Materials Safety US Nuclear Regulatory

More information

Biosafety considerations of new dsrna molecules

Biosafety considerations of new dsrna molecules Biosafety considerations of new dsrna molecules GM-free Europe Conference 2015 May 6-8 Berlin, Germany Dr. Sarah Agapito Current GMOs Plant transformed to produce new protein A G C U G G C A A U G U C

More information

Comparative epigenomic analysis between model plant and crop

Comparative epigenomic analysis between model plant and crop The 19 th Crucifer Genetics Workshop and Brassica 2014 Genetic Improvement of Brassicaceae Crops in the Era of Genomics Comparative epigenomic analysis between model plant and crop Xiaofeng Cao Institute

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information


CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information


http://www.springer.com/3-540-23372-5 http://www.springer.com/3-540-23372-5 Chromatin Remodeling Factors and DNA Replication Patrick Varga-Weisz Abstract Chromatin structures have to be precisely duplicated during DNA replication to maintain

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

MatureBayes: A Probabilistic Algorithm for Identifying the Mature mirna within Novel Precursors

MatureBayes: A Probabilistic Algorithm for Identifying the Mature mirna within Novel Precursors MatureBayes: A Probabilistic Algorithm for Identifying the Mature mirna within Novel Precursors Katerina Gkirtzou 1,2, Ioannis Tsamardinos 1,2, Panagiotis Tsakalides 1,2, Panayiota Poirazi 3 * 1 Computer

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Year 3 Pharm.D Dr. V. Chitra

Year 3 Pharm.D Dr. V. Chitra Year 3 Pharm.D Dr. V. Chitra RNA processing CENTRAL DOGMA DNA RNA PROTEIN DNA is the genetic material, located in the nucleus. mrna carries a faithful copy of a gene into the cytoplasm for protein synthesis.

More information


EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

THE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California

THE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California VOLUME THIRTY TWO THE ENZYMES Eukaryotic RNases and their Partners in RNA Degradation and Biogenesis, Part B Edited by FENG GUO Department of Biological Chemistry, David Geffen School of Medicine, Molecular

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information


DNA METHYLATION AND THE CONCEPT OF EPIGENETICS DNA METHYLATION AND THE CONCEPT OF EPIGENETICS The term Epigenetics describes heritable genetic modifications that are not attributable to changes in the primary DNA sequence. Epigenetic modifications

More information

A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang

A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Department of Biology Sample

Department of Biology Sample Syllabus BIOTECHNOLOGY Spring 2013 Instructor: Atanu Duttaroy, Professor Tel: 202-806-5362 Email: aduttaroy@howard.edu Office: Room 336, Just Hall Teaching Assistant: Mr. Subhas Mukherjee Lecture: Room

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Cell Division Mitosis and the Cell Cycle

Cell Division Mitosis and the Cell Cycle Cell Division Mitosis and the Cell Cycle A Chromosome and Sister Chromatids Key Points About Chromosome Structure A chromosome consists of DNA that is wrapped around proteins (histones) and condensed Each

More information

MicroRNA maturation: stepwise processing and subcellular localization

MicroRNA maturation: stepwise processing and subcellular localization The EMBO Journal Vol. 21 No. 17 pp. 4663±4670, 2002 MicroRNA maturation: stepwise processing and subcellular localization Yoontae Lee 1, Kipyoung Jeon 2, Jun-Tae Lee 1, Sunyoung Kim 1,2 and V.Narry Kim

More information

SCI 102. HUMAN GENOME Transcription / Translation 24/03/2015 HUMAN GENOME PROJECT. Human Genome Project (HGP) Whose DNA samples were sequenced in HGP?

SCI 102. HUMAN GENOME Transcription / Translation 24/03/2015 HUMAN GENOME PROJECT. Human Genome Project (HGP) Whose DNA samples were sequenced in HGP? SCI 102 HUMAN GENOME Transcription / Translation HUMAN GENOME PROJECT 26 June 2000; announcement for the completion of the first draft Prof. MÜGE TÜRET Bill Clinton (USA President), Francis Collins (HUGO-international

More information