Python course in Bioinformatics

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Python course in Bioinformatics"

Transcription

1 March 31, 2009

2

3 Why Python? Scripting language, raplid applications Minimalistic syntax Powerful Flexiablel data structure Widely used in Bioinformatics, and many other domains

4 Where to get Python and learn more? Main source of information: Tutorial: Biopython: Page

5 Invoking Python To start: type python in command line It will look like Python (r252:60911, Mar , 00:12:33) [GCC (Gentoo p1.0.2)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> You can now type commands in the line denoted by >>> To leave: type end-of-file character ctrl-d on Unix, ctrl-z on Windows This is called interactive mode

6 Appetizer Example Task: Print all numbers in a given file File: numbers.txt Code: print.py # Note: the code lines begin in the first column of the file. In # Python code indentation *is* syntactically relevant. Thus, the # hash # (which is a comment symbol, everything past a hash is # ignored on current line) marks the first column of the code data = open("numbers.txt", "r") for d in data: print d data.close()

7 Appetizer Example cont d Task: Print the sum of all the data in the file Code: sum.py data = open("numbers.txt", "r") s = 0 for d in data: s = s + float(d) print s data.close()

8 Interative Mode prompt >>> allows to enter command command is ended by newline variables need not be initialized or declared a colon : opens a block... prompt denotes that block is expected no prompt means python output a block is indented by ending indentation, block is ended

9 Differences to Java or C can be used interatively. This makes it much easier to test programs and to debug no declaration of variables no brackets denote block, just indentation (Emacs supports the style) a comment begins with a #. Everything after that is ignored.

10 Numbers >>> >>> # This is a comment >>> 2+2 # and a comment on the same line as code 4 >>> (50-5*6)/4 5 >>> # Integer division returns the floor:... 7/3 2 >>> 7/-3-3

11 Numbers cont d >>> width = 20 >>> height = 5*9 >>> width * height 900 >>> # Variables must be defined (assigned a value) before they can be >>> # used, or an error will occur: >>> # try to access an undefined variable... n Traceback (most recent call last): File "<stdin>", line 1, in <module> NameError: name n is not defined

12 Strings Strings can be enclosed in single quotes or double quotes >>> spam eggs spam eggs >>> doesn\ t "doesn t" >>> "doesn t" "doesn t" >>> "Yes," he said. "Yes," he said. >>> "\"Yes,\" he said." "Yes," he said. >>> "Isn\ t," she said. "Isn\ t," she said.

13 Strings cont d Strings can be surrounded in a pair of matching triple-quotes: """ or. End of lines do not need to be escaped when using triple-quotes, but they will be included in the string. print """ Usage: thingy [OPTIONS] -h Display this usage message -H hostname Hostname to connect to """

14 Strings cont d Strings can be concatenated (glued together) with the + operator, and repeated with *: >>> word = Help + A >>> word HelpA >>> < + word*5 + > <HelpAHelpAHelpAHelpAHelpA> >>> str ing # <- This is ok string >>> str.strip() + ing # <- This is ok string

15 Strings cont d Strings can be subscripted (indexed); like in C, the first character of a string has subscript (index) 0. There is no separate character type; a character is simply a string of size one. Substrings can be specified with the slice notation: two indices separated by a colon. >>> word = Help + A >>> word[4] A >>> word[0:2] He >>> word[:2] # The first two characters He >>> word[2:] # Everything except the first two characters lpa

16 Strings cont d Unlike a C string, Python strings cannot be changed. Assigning to an indexed position in the string results in an error: >>> word[0] = x Traceback (most recent call last): File "<stdin>", line 1, in? TypeError: object doesn t support item assignment >>> x + word[1:] xelpa >>> Splat + word[4] SplatA

17 Strings cont d >>> from string import * >>> dna = gcatgacgttattacgactctg >>> len(dna) 22 >>> n in dna False >>> count(dna, a ) 5 >>> replace(dna, a, A ) gcatgacgttattacgactctg Exercise: Calculate GC percent of dna

18 Strings cont d Solution: Calculate GC percent >>> gc = (count(dna, c ) + count(dna, g )) / float(len(dna)) * 100 >>> "%.2f" % gc 64.08

19 Strings cont d Exercise: Calculate the complement of DNA A - T C - G

20 Lists A list of comma-separated values (items) between square brackets. List items need not all have the same type (compund data types) >>> a = [ spam, eggs, 100, 1234] >> a[0] spam >>> a[3] 1234 >>> a[-2] 100 >>> a[1:-1] [ eggs, 100] >>> a[:2] + [ bacon, 2*2] [ spam, eggs, bacon, 4] >>> 3*a[:3] + [ Boo! ] [ spam, eggs, 100, spam, eggs, 100, spam, eggs, 100, Boo! ]

21 Lists cont d Unlike strings, which are immutable, it is possible to change individual elements of a list Assignment to slices is also possible, and this can even change the size of the list or clear it entirely >>> a [ spam, eggs, 100, 1234] >>> a[2] = a[2] + 23 >>> a[0:2] = [1, 12] # Replace some items: >>> a[0:2] = [] # Remove some: >>> a [123, 1234] >>> a[1:1] = [ bletch, xyzzy ] # Insert some: >>> a [123, bletch, xyzzy, 1234]

22 Lists cont d Functions returning a list >>> range(3) [0, 1, 2] >>> range(10,20,2) [10, 12, 14, 16, 18] >>> range(5,2,-1) [5, 4, 3] >>> aas = "ALA TYR TRP SER GLY".split() >>> aas [ ALA, TYR, TRP, SER, GLY ] >>> " ".join(aas) ALA TYR TRP SER GLY >>> l = list( atgatgcgcccacgtacga ) [ a, t, g, a, t, g, c, g, c, c, c, a, c, g, t, a, c, g, a ]

23 Dictionaries A dictionary is an unordered set of key: value pairs, with the requirement that the keys are unique A pair of braces creates an empty dictionary:. Placing a comma-separated list of key:value pairs within the braces adds initial key:value pairs to the dictionary The main operations on a dictionary are storing a value with some key and extracting the value given the key >>> tel = { jack : 4098, sape : 4139} >>> tel[ guido ] = 4127 >>> tel { sape : 4139, guido : 4127, jack : 4098} >>> tel[ jack ] 4098

24 Dictionaries cont d >>> tel = { jack : 4098, sape : 4139, guido = 4127} >>> del tel[ sape ] >>> tel[ irv ] = 4127 >>> tel { guido : 4127, irv : 4127, jack : 4098} >>> tel.keys() [ guido, irv, jack ] >>> guido in tel True

25 a, b = 3, 4 if a > b: print a + b else: print a - b

26 cont d >>> # Fibonacci series:... # the sum of two elements defines the next... a, b = 0, 1 >>> while b < 10:... print b... a, b = b, a+b

27 features multiple assignment: rhs evaluated before anything on the left, and (in rhs) from left to right while loop executes as long as condition is True (non-zero, not the empty string, not None) block indentation must be the same for each line of block need empty line in interactive mode to indicate end of block (not required in edited code) use of print

28 Printing >>> i = 256*256 >>> print The value of i is, i The value of i is 65536

29 Flow control x = 35 if x < 0: x = 0 print Negative changed to zero elif x == 0: print Zero elif x == 1: print Single else: print More

30 Iteration Python for iterates over sequence (string, list, generated sequence) a = [ cat, window, defenestrate ] for x in a: print x, len(x)

31 Iteration Python for iterates over sequence (string, list, generated sequence) a = [ cat, window, defenestrate ] for x in a: print x, len(x)

32 Definiting functions def fib(n): # write Fibonacci series up to n """Print a Fibonacci series up to n.""" a, b = 0, 1 while b < n: print b, a, b = b, a+b # Now call the function we just defined: fib(2000) # will return: #

33 Reverse Complement of DNA Excercise: Find the reverse complement of a DNA sequence 5 - ACCGGTTAATT 3 : forward strand 3 - TGGCCAATTAA 5 : reverse strand So the reverse complement of ACCGGTTAATT is AATTAACCGGA

34 Reverse Complement of DNA Solution: Find the reverse complement of a DNA sequence from string import * def revcomp(dna): """ reverse complement of a DNA sequence """ comp = dna.translate(maketrans("agctagct", "TCGAtcga")) lcomp = list(comp) lcomp.reverse() return join(lcomp, "")

35 Translate a DNA sequence Excercise: Translate a DNA sequence to an amino acid sequence Genetic code standard = { ttt : F, tct : S, tat : Y, tgt : C, ttc : F, tcc : S, tac : Y, tgc : C, tta : L, tca : S, taa : *, tca : *, ttg : L, tcg : S, tag : *, tcg : W, ctt : L, cct : P, cat : H, cgt : R, ctc : L, ccc : P, cac : H, cgc : R, cta : L, cca : P, caa : Q, cga : R, ctg : L, ccg : P, cag : Q, cgg : R, att : I, act : T, aat : N, agt : S, atc : I, acc : T, aac : N, agc : S, ata : I, aca : T, aaa : K, aga : R, atg : M, acg : T, aag : K, agg : R, gtt : V, gct : A, gat : D, ggt : G, gtc : V, gcc : A, gac : D, ggc : G, gta : V, gca : A, gaa : E, gga : G, gtg : V, gcg : A, gag : E, ggg : G }

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Python Loops and String Manipulation

Python Loops and String Manipulation WEEK TWO Python Loops and String Manipulation Last week, we showed you some basic Python programming and gave you some intriguing problems to solve. But it is hard to do anything really exciting until

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Python Tutorial. Release 3.2.3. Guido van Rossum Fred L. Drake, Jr., editor. June 18, 2012. Python Software Foundation Email: docs@python.

Python Tutorial. Release 3.2.3. Guido van Rossum Fred L. Drake, Jr., editor. June 18, 2012. Python Software Foundation Email: docs@python. Python Tutorial Release 3.2.3 Guido van Rossum Fred L. Drake, Jr., editor June 18, 2012 Python Software Foundation Email: docs@python.org CONTENTS 1 Whetting Your Appetite 3 2 Using the Python Interpreter

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

Python Tutorial. Release 2.6.4. Guido van Rossum Fred L. Drake, Jr., editor. January 04, 2010. Python Software Foundation Email: docs@python.

Python Tutorial. Release 2.6.4. Guido van Rossum Fred L. Drake, Jr., editor. January 04, 2010. Python Software Foundation Email: docs@python. Python Tutorial Release 2.6.4 Guido van Rossum Fred L. Drake, Jr., editor January 04, 2010 Python Software Foundation Email: docs@python.org CONTENTS 1 Whetting Your Appetite 3 2 Using the Python Interpreter

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Biopython Tutorial and Cookbook

Biopython Tutorial and Cookbook Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................

More information

Exercise 1: Python Language Basics

Exercise 1: Python Language Basics Exercise 1: Python Language Basics In this exercise we will cover the basic principles of the Python language. All languages have a standard set of functionality including the ability to comment code,

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

PYTHON Basics http://hetland.org/writing/instant-hacking.html

PYTHON Basics http://hetland.org/writing/instant-hacking.html CWCS Workshop May 2009 PYTHON Basics http://hetland.org/writing/instant-hacking.html Python is an easy to learn, modern, interpreted, object-oriented programming language. It was designed to be as simple

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

We will learn the Python programming language. Why? Because it is easy to learn and many people write programs in Python so we can share.

We will learn the Python programming language. Why? Because it is easy to learn and many people write programs in Python so we can share. LING115 Lecture Note Session #4 Python (1) 1. Introduction As we have seen in previous sessions, we can use Linux shell commands to do simple text processing. We now know, for example, how to count words.

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Intermediate Python Tutorial

Intermediate Python Tutorial Intermediate Python Tutorial Python is free software and is an easy to learn powerful programming language. It has efficient high-level data structures and a simple but effective approach to object-oriented

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

Introduction to Bioinformatics (Master ChemoInformatique)

Introduction to Bioinformatics (Master ChemoInformatique) Introduction to Bioinformatics (Master ChemoInformatique) Roland Stote Institut de Génétique et de Biologie Moléculaire et Cellulaire Biocomputing Group 03.90.244.730 rstote@igbmc.fr Biological Function

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

Python Basics. S.R. Doty. August 27, 2008. 1 Preliminaries 4 1.1 What is Python?... 4 1.2 Installation and documentation... 4

Python Basics. S.R. Doty. August 27, 2008. 1 Preliminaries 4 1.1 What is Python?... 4 1.2 Installation and documentation... 4 Python Basics S.R. Doty August 27, 2008 Contents 1 Preliminaries 4 1.1 What is Python?..................................... 4 1.2 Installation and documentation............................. 4 2 Getting

More information

Introduction to Python

Introduction to Python WEEK ONE Introduction to Python Python is such a simple language to learn that we can throw away the manual and start with an example. Traditionally, the first program to write in any programming language

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

Chapter 2 Writing Simple Programs

Chapter 2 Writing Simple Programs Chapter 2 Writing Simple Programs Charles Severance Textbook: Python Programming: An Introduction to Computer Science, John Zelle Software Development Process Figure out the problem - for simple problems

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

http://hdl.handle.net/10197/2727

http://hdl.handle.net/10197/2727 Provided by the author(s) and University College Dublin Library in accordance with publisher policies. Please cite the published version when available. Title Performance of DNA data embedding algorithms

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics Table of Contents Innovative Solutions for Proteomics...........................................................................

More information

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

The String Data Structure and Intro to for Loops

The String Data Structure and Intro to for Loops The String Data Structure and Intro to for Loops June 16, 2015 Brian A. Malloy Slide 1 of 15 1. A string is an indexed data structure consisting of a sequence of characters The characters can be anything

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour

More information

Computational Mathematics with Python

Computational Mathematics with Python Boolean Arrays Classes Computational Mathematics with Python Basics Olivier Verdier and Claus Führer 2009-03-24 Olivier Verdier and Claus Führer Computational Mathematics with Python 2009-03-24 1 / 40

More information

Chapter 3 Writing Simple Programs. What Is Programming? Internet. Witin the web server we set lots and lots of requests which we need to respond to

Chapter 3 Writing Simple Programs. What Is Programming? Internet. Witin the web server we set lots and lots of requests which we need to respond to Chapter 3 Writing Simple Programs Charles Severance Unless otherwise noted, the content of this course material is licensed under a Creative Commons Attribution 3.0 License. http://creativecommons.org/licenses/by/3.0/.

More information

Computational Mathematics with Python

Computational Mathematics with Python Computational Mathematics with Python Basics Claus Führer, Jan Erik Solem, Olivier Verdier Spring 2010 Claus Führer, Jan Erik Solem, Olivier Verdier Computational Mathematics with Python Spring 2010 1

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Python Lists and Loops

Python Lists and Loops WEEK THREE Python Lists and Loops You ve made it to Week 3, well done! Most programs need to keep track of a list (or collection) of things (e.g. names) at one time or another, and this week we ll show

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

Introduction to Python

Introduction to Python Caltech/LEAD Summer 2012 Computer Science Lecture 2: July 10, 2012 Introduction to Python The Python shell Outline Python as a calculator Arithmetic expressions Operator precedence Variables and assignment

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

Variables, Expressions, and Statements

Variables, Expressions, and Statements Variables, Expressions, and Statements Chapter 2 Python for Informatics: Exploring Information www.pythonlearn.com Constants Fixed values such as numbers, letters, and strings are called constants because

More information

Metabolic Engineering of Escherichia coli for Enhanced Production of Succinic Acid, Based on Genome Comparison and In Silico Gene Knockout Simulation

Metabolic Engineering of Escherichia coli for Enhanced Production of Succinic Acid, Based on Genome Comparison and In Silico Gene Knockout Simulation APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2005, p. 7880 7887 Vol. 71, No. 12 0099-2240/05/$08.00 0 doi:10.1128/aem.71.12.7880 7887.2005 Copyright 2005, American Society for Microbiology. All Rights

More information

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa

Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in South Africa Available online at www.sciencedirect.com Veterinary Parasitology 157 (2008) 123 127 Short communication Molecular detection of Babesia rossi and Hepatozoon sp. in African wild dogs (Lycaon pictus) in

More information

Computers. An Introduction to Programming with Python. Programming Languages. Programs and Programming. CCHSG Visit June 2014. Dr.-Ing.

Computers. An Introduction to Programming with Python. Programming Languages. Programs and Programming. CCHSG Visit June 2014. Dr.-Ing. Computers An Introduction to Programming with Python CCHSG Visit June 2014 Dr.-Ing. Norbert Völker Many computing devices are embedded Can you think of computers/ computing devices you may have in your

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

For 5 minute cloning and expression of PCR products fused to GFP in mammalian cells

For 5 minute cloning and expression of PCR products fused to GFP in mammalian cells GFP Fusion TOPO TA Expression Kits Version J 22 April 2004 25-0218 GFP Fusion TOPO TA Expression Kits For 5 minute cloning and expression of PCR products fused to GFP in mammalian cells CT-GFP Fusion TOPO

More information

Computational Mathematics with Python

Computational Mathematics with Python Numerical Analysis, Lund University, 2011 1 Computational Mathematics with Python Chapter 1: Basics Numerical Analysis, Lund University Claus Führer, Jan Erik Solem, Olivier Verdier, Tony Stillfjord Spring

More information

Archimer http://archimer.ifremer.fr

Archimer http://archimer.ifremer.fr Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site Fish

More information

6.170 Tutorial 3 - Ruby Basics

6.170 Tutorial 3 - Ruby Basics 6.170 Tutorial 3 - Ruby Basics Prerequisites 1. Have Ruby installed on your computer a. If you use Mac/Linux, Ruby should already be preinstalled on your machine. b. If you have a Windows Machine, you

More information

Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation

Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation Helena Friesen/ Rayna Lunz/* Steven Doyle,^ and Jacqueline

More information

der Strukturbiologie

der Strukturbiologie Einführung Aspekte der in Thermodynamik die Bioinformatik in der Strukturbiologie Wintersemester 2012/13 16:00-16:45 Hörsaal N100 B3 Peter Güntert Literatur Jean-Michel Claverie, Cedric Notredame: Bioinformatics

More information

CSCE 110 Programming I Basics of Python: Variables, Expressions, and Input/Output

CSCE 110 Programming I Basics of Python: Variables, Expressions, and Input/Output CSCE 110 Programming Basics of Python: Variables, Expressions, and nput/output Dr. Tiffani L. Williams Department of Computer Science and Engineering Texas A&M University Fall 2011 Python Python was developed

More information

The nucleotide sequence of the gene for human protein C

The nucleotide sequence of the gene for human protein C Proc. Natl. Acad. Sci. USA Vol. 82, pp. 4673-4677, July 1985 Biochemistry The nucleotide sequence of the gene for human protein C (DNA sequence analysis/vitamin K-dependent proteins/blood coagulation)

More information

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques MAGDY SAEB 1, EMAN EL-ABD 2, MOHAMED E. EL-ZANATY 1 1. School of Engineering, Computer Department,

More information

VHDL Test Bench Tutorial

VHDL Test Bench Tutorial University of Pennsylvania Department of Electrical and Systems Engineering ESE171 - Digital Design Laboratory VHDL Test Bench Tutorial Purpose The goal of this tutorial is to demonstrate how to automate

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information