Python course in Bioinformatics

Transcription

1 March 31, 2009

2

3 Why Python? Scripting language, raplid applications Minimalistic syntax Powerful Flexiablel data structure Widely used in Bioinformatics, and many other domains

4 Where to get Python and learn more? Main source of information: Tutorial: Biopython: Page

5 Invoking Python To start: type python in command line It will look like Python (r252:60911, Mar , 00:12:33) [GCC (Gentoo p1.0.2)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> You can now type commands in the line denoted by >>> To leave: type end-of-file character ctrl-d on Unix, ctrl-z on Windows This is called interactive mode

6 Appetizer Example Task: Print all numbers in a given file File: numbers.txt Code: print.py # Note: the code lines begin in the first column of the file. In # Python code indentation *is* syntactically relevant. Thus, the # hash # (which is a comment symbol, everything past a hash is # ignored on current line) marks the first column of the code data = open("numbers.txt", "r") for d in data: print d data.close()

7 Appetizer Example cont d Task: Print the sum of all the data in the file Code: sum.py data = open("numbers.txt", "r") s = 0 for d in data: s = s + float(d) print s data.close()

8 Interative Mode prompt >>> allows to enter command command is ended by newline variables need not be initialized or declared a colon : opens a block... prompt denotes that block is expected no prompt means python output a block is indented by ending indentation, block is ended

9 Differences to Java or C can be used interatively. This makes it much easier to test programs and to debug no declaration of variables no brackets denote block, just indentation (Emacs supports the style) a comment begins with a #. Everything after that is ignored.

10 Numbers >>> >>> # This is a comment >>> 2+2 # and a comment on the same line as code 4 >>> (50-5*6)/4 5 >>> # Integer division returns the floor:... 7/3 2 >>> 7/-3-3

11 Numbers cont d >>> width = 20 >>> height = 5*9 >>> width * height 900 >>> # Variables must be defined (assigned a value) before they can be >>> # used, or an error will occur: >>> # try to access an undefined variable... n Traceback (most recent call last): File "<stdin>", line 1, in <module> NameError: name n is not defined

12 Strings Strings can be enclosed in single quotes or double quotes >>> spam eggs spam eggs >>> doesn\ t "doesn t" >>> "doesn t" "doesn t" >>> "Yes," he said. "Yes," he said. >>> "\"Yes,\" he said." "Yes," he said. >>> "Isn\ t," she said. "Isn\ t," she said.

13 Strings cont d Strings can be surrounded in a pair of matching triple-quotes: """ or. End of lines do not need to be escaped when using triple-quotes, but they will be included in the string. print """ Usage: thingy [OPTIONS] -h Display this usage message -H hostname Hostname to connect to """

14 Strings cont d Strings can be concatenated (glued together) with the + operator, and repeated with *: >>> word = Help + A >>> word HelpA >>> < + word*5 + > <HelpAHelpAHelpAHelpAHelpA> >>> str ing # <- This is ok string >>> str.strip() + ing # <- This is ok string

15 Strings cont d Strings can be subscripted (indexed); like in C, the first character of a string has subscript (index) 0. There is no separate character type; a character is simply a string of size one. Substrings can be specified with the slice notation: two indices separated by a colon. >>> word = Help + A >>> word[4] A >>> word[0:2] He >>> word[:2] # The first two characters He >>> word[2:] # Everything except the first two characters lpa

16 Strings cont d Unlike a C string, Python strings cannot be changed. Assigning to an indexed position in the string results in an error: >>> word[0] = x Traceback (most recent call last): File "<stdin>", line 1, in? TypeError: object doesn t support item assignment >>> x + word[1:] xelpa >>> Splat + word[4] SplatA

17 Strings cont d >>> from string import * >>> dna = gcatgacgttattacgactctg >>> len(dna) 22 >>> n in dna False >>> count(dna, a ) 5 >>> replace(dna, a, A ) gcatgacgttattacgactctg Exercise: Calculate GC percent of dna

18 Strings cont d Solution: Calculate GC percent >>> gc = (count(dna, c ) + count(dna, g )) / float(len(dna)) * 100 >>> "%.2f" % gc 64.08

19 Strings cont d Exercise: Calculate the complement of DNA A - T C - G

20 Lists A list of comma-separated values (items) between square brackets. List items need not all have the same type (compund data types) >>> a = [ spam, eggs, 100, 1234] >> a[0] spam >>> a[3] 1234 >>> a[-2] 100 >>> a[1:-1] [ eggs, 100] >>> a[:2] + [ bacon, 2*2] [ spam, eggs, bacon, 4] >>> 3*a[:3] + [ Boo! ] [ spam, eggs, 100, spam, eggs, 100, spam, eggs, 100, Boo! ]

21 Lists cont d Unlike strings, which are immutable, it is possible to change individual elements of a list Assignment to slices is also possible, and this can even change the size of the list or clear it entirely >>> a [ spam, eggs, 100, 1234] >>> a[2] = a[2] + 23 >>> a[0:2] = [1, 12] # Replace some items: >>> a[0:2] = [] # Remove some: >>> a [123, 1234] >>> a[1:1] = [ bletch, xyzzy ] # Insert some: >>> a [123, bletch, xyzzy, 1234]

22 Lists cont d Functions returning a list >>> range(3) [0, 1, 2] >>> range(10,20,2) [10, 12, 14, 16, 18] >>> range(5,2,-1) [5, 4, 3] >>> aas = "ALA TYR TRP SER GLY".split() >>> aas [ ALA, TYR, TRP, SER, GLY ] >>> " ".join(aas) ALA TYR TRP SER GLY >>> l = list( atgatgcgcccacgtacga ) [ a, t, g, a, t, g, c, g, c, c, c, a, c, g, t, a, c, g, a ]

23 Dictionaries A dictionary is an unordered set of key: value pairs, with the requirement that the keys are unique A pair of braces creates an empty dictionary:. Placing a comma-separated list of key:value pairs within the braces adds initial key:value pairs to the dictionary The main operations on a dictionary are storing a value with some key and extracting the value given the key >>> tel = { jack : 4098, sape : 4139} >>> tel[ guido ] = 4127 >>> tel { sape : 4139, guido : 4127, jack : 4098} >>> tel[ jack ] 4098

24 Dictionaries cont d >>> tel = { jack : 4098, sape : 4139, guido = 4127} >>> del tel[ sape ] >>> tel[ irv ] = 4127 >>> tel { guido : 4127, irv : 4127, jack : 4098} >>> tel.keys() [ guido, irv, jack ] >>> guido in tel True

25 a, b = 3, 4 if a > b: print a + b else: print a - b

26 cont d >>> # Fibonacci series:... # the sum of two elements defines the next... a, b = 0, 1 >>> while b < 10:... print b... a, b = b, a+b

27 features multiple assignment: rhs evaluated before anything on the left, and (in rhs) from left to right while loop executes as long as condition is True (non-zero, not the empty string, not None) block indentation must be the same for each line of block need empty line in interactive mode to indicate end of block (not required in edited code) use of print

28 Printing >>> i = 256*256 >>> print The value of i is, i The value of i is 65536

29 Flow control x = 35 if x < 0: x = 0 print Negative changed to zero elif x == 0: print Zero elif x == 1: print Single else: print More

30 Iteration Python for iterates over sequence (string, list, generated sequence) a = [ cat, window, defenestrate ] for x in a: print x, len(x)

31 Iteration Python for iterates over sequence (string, list, generated sequence) a = [ cat, window, defenestrate ] for x in a: print x, len(x)

32 Definiting functions def fib(n): # write Fibonacci series up to n """Print a Fibonacci series up to n.""" a, b = 0, 1 while b < n: print b, a, b = b, a+b # Now call the function we just defined: fib(2000) # will return: #

33 Reverse Complement of DNA Excercise: Find the reverse complement of a DNA sequence 5 - ACCGGTTAATT 3 : forward strand 3 - TGGCCAATTAA 5 : reverse strand So the reverse complement of ACCGGTTAATT is AATTAACCGGA

34 Reverse Complement of DNA Solution: Find the reverse complement of a DNA sequence from string import * def revcomp(dna): """ reverse complement of a DNA sequence """ comp = dna.translate(maketrans("agctagct", "TCGAtcga")) lcomp = list(comp) lcomp.reverse() return join(lcomp, "")

35 Translate a DNA sequence Excercise: Translate a DNA sequence to an amino acid sequence Genetic code standard = { ttt : F, tct : S, tat : Y, tgt : C, ttc : F, tcc : S, tac : Y, tgc : C, tta : L, tca : S, taa : *, tca : *, ttg : L, tcg : S, tag : *, tcg : W, ctt : L, cct : P, cat : H, cgt : R, ctc : L, ccc : P, cac : H, cgc : R, cta : L, cca : P, caa : Q, cga : R, ctg : L, ccg : P, cag : Q, cgg : R, att : I, act : T, aat : N, agt : S, atc : I, acc : T, aac : N, agc : S, ata : I, aca : T, aaa : K, aga : R, atg : M, acg : T, aag : K, agg : R, gtt : V, gct : A, gat : D, ggt : G, gtc : V, gcc : A, gac : D, ggc : G, gta : V, gca : A, gaa : E, gga : G, gtg : V, gcg : A, gag : E, ggg : G }