Bioinformatics in next generation sequencing projects

Transcription

1 Once sequenced the problem becomes computational Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet Computational analyses is the bottleneck Rapid improvement in sequencing Still need for customized analysis for most projects March 2012 Preliminary Analyses Overview of computational analyses genome sequence RNA-Seq expression levels assembled contig ChIP-Seq peak calling Real Time Analysis Raw Image (TB) Primary Analyses: Image analysis Base calling Mapping (Assembly) Data type (e.g. peak calling, calculate expression) Custom project Platform-specific analysis using the vendors programs Phred Quality Score, Q Sequenced reads Fasta file: Sequences and Quality scores Text File (GB) Each base call has an estimate of the probability of being wrong (error probability, p) >EAS54_6_R1_2_1_413_324 CCCTTCTTGTCTTCAGCGTTTCTCC Read identifier Fastq file: Q = -10 * - EAS269:1:120:1786:18#0/1 GAACTCTGCCTTTTTCAGTGATGAGGAAAGGAGTTCTCTCTGGTCCCCAG +HWI - EAS269:1:120:1786:18#0/1 aaab ^ _U_aa [ U [ _Z ] a `WU_ ^X `GT^ _ \ TM^ ^ \ \ Z \ YQVVXUBBBB SOLiD Quality scores csfasta file >1_39_146_F3 T >1_39_194_F3 T SOLiD, QV file Phred Quality Score >1_39_146_F >1_39_194_F Probability of incorrect base call 1 in 10 1 in in in in Base call accuracy 90 % 99 % 99.9 % % %

2 FastQ encodings Fastq quality control (FastQC) Sanger FastQ: Phred score from 0-93 using the ASCII characters Solexa (+1.3 pipeline): Phred score from 0-62 using the ASCII characters 0-62 Solexa (older pipelines): Solexa score using ASCII characters -5 to S - Sanger Phred+33, 41 values (0, 40) I - Illumina 1.3 Phred+64, 41 values (0, 40) X - Solexa Solexa+64, 68 values (-5, 62) Video tutorial: Short Read Assembly Overview of computational analyses Velvet and SOAPdenovo de novo genomic assembler specially designed for short read sequencing technologies Primary Analyses: Image analysis Base calling genome sequence RNA-Seq expression levels assembled contig ChIP-Seq peak calling Mapping Assembly Data type (e.g. peak calling, calculate expression) Custom project Nature 2009 Mapping of reads Human Genome Assembly UCSC Genome Browser Task: Map millions of short sequences ( nt) onto a genome (3 000 Mbp ) or transcriptome Computationally feasible Mismatches (sequencing errors and SNPs) Unique / Repetitive matches Indels (Normal variation, CNVs) Large rearrangements (translocations) BLAST, BLAT tools not designed for these tasks

3 MAQ bowtie Commonly used programs Program Approach Comments Bowtie Burrow-Wheeler Transformation (BWT) Illumina, (SOLiD), fast MAQ Spaced Seed Indexing Illumina, (SOLiD), SNPs BWA Novoalign Burrow-Wheeler Transformation (BWT) Needleman-Wunch Alignment Illumina, (SOLiD), indels Illumina, indels, slower, free (single proc mode) ZOOM Designed spaced seeds Illumina, fast, indels, not free Mappers from Illumina (ELAND) and SOLiD (bioscope/mapreads) Storing mapped Alignments Samtools Formats for storing alignments should include: genomic coordinates mismatches, insertion, deletions etc. quality information Sequence Alignment Map (SAM) Generic Alignment format Supports long and short reads Human readable, flexible and compact Emerging standard Li6H.*,6Handsaker6B.*,6Wysoker6A.,6Fennell6T.,6Ruan6J.,6Homer6N.,6Marth6G.,6 Abecasis6G.,6Durbin6R.6and610006Genome6Project6Data6Processing6Subgroup6 (2009)6The6Sequence6alignment/map6(SAM)6format6and6SAMtools.6 BioinformaScs,625,62078W9.6[PMID: ] h"p://samtools.sourceforge.net/ SAM Example CIGAR Format Bit field, where 16 means reverse strand Alignment structure. Here: 22 aligned bases, then 731 bases intron, then 28 aligned bases Start position HWI - EAS269:1:114:1242:1582#0 16 chr Y M731N28M * 0 0 ATTTCGACCATGATCATCGAACCTTCCCCTGGATCCACTTCCACGATCAC #9 ; -7 +2@4 : 2=20-14= : ><?< ; : BB? : 4<BB?ABBBBABCBBBBC=BB NM: i : 0 XS: A:- M, match/ mismatch I, insertion D, deletion S, softclip... Ref: GCATTCAGATGCAGTACGC Read: cctcag--gcagtagtg Pos: 5 CIGAR: 2S4M3D6M3S

4 Samtools for SAM/BAM files Overview of computational analyses Library and software package (C, Java) Creating, sorting, indexing SAM & BAM Visualizing alignments in command SNP calling Short indel detection BAM (Binary representation of SAM) ~25% file size reduction Primary Analyses: Image analysis Base calling Mapping Assembly genome sequence assembled contig Data type (e.g. peak calling, calculate expression) RNA-Seq expression levels ChIP-Seq peak calling Custom project Visualization Visualization Integrated Genome Viewer (Broad Inst.) Custom tracks at UCSC Genome Browser Integrated Genome Viewer UCSC Genome Browser Imports many mentioned formats (SAM, BAM, BED etc) Excellent for visualization of RNA-Sequencing or ChIP-sequencing data Can also download/visualize data from public or private servers Recently introduced new formats for efficient viewing of large data sets: - BedGraph - BigWig Add as custom tracks (slower)

5 Peak characteristics differ with signal Peak characteristics differ with signal H3K4me3: Sharp promoter peaks H3K36me3: Broad transcription elongation signal Important file formats BED format Sequences: FastQ Aligned reads: SAM/BAM Genome annotations: Bed, Gff Coverage: Wig, (Tdf) chrom6w6the6name6of6the6chromosome6(e.g.6chr3,6chry,6chr2_random)6or6scaffold6(e.g.6 scaffold10671). chromstart6w6the6starsng6posison6of6the6feature6in6the6chromosome6or6scaffold.6the6first6 base6in6a6chromosome6is6numbered60. chromend6w6the6ending6posison6of6the6feature6in6the6chromosome6or6scaffold.6the6 chromend6base6is6not6included6in6the6display6of6the6feature.6 For6example,6the6first61006bases6of6a6chromosome6are6defined6as6chromStart=0,6 chromend=100,6and6span6the6bases6numbered60w99. track name=pairedreads description="clone Paired Reads" usescore=1 chr BED continued WIG format track name=pairedreads description="clone Paired Reads" usescore=1 chr cloneb ,399, 0,3601 Wiggle format (WIG) allows the display of continuous-valued data in a track format strand - Defines the strand - either '+' or '-'. thickstart - The starting position at which the feature is drawn thickly (for example, the start codon in gene displays). thickend - The ending position at which the feature is drawn thickly (for example, the stop codon in gene displays). itemrgb - An RGB value of the form R,G,B (e.g. 255,0,0). If the track line itemrgb attribute is set to "On", this RBG value will determine the display color of the data contained in this BED line. NOTE: It is recommended that a simple color scheme (eight colors or less) be used with this attribute to avoid overwhelming the color resources of the Genome Browser and your Internet browser. blockcount - The number of blocks (exons) in the BED line. blocksizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockcount. blockstarts - A comma-separated list of block starts. All of the blockstart positions should be calculated relative to chromstart. The number of items in this list should correspond to blockcount. Variable step Fixed step variablestep chrom=chr2 fixedstep chrom=chr start= step= is equivalent to: variablestep chrom=chr2 span=

6 Data Repositories Short Read Archive (fastq) [discontinued!] European Nucleotide Archive Gene Expression Omnibus (bed, wig, fastq) SEQAnswers, an active forum for discussions on next-generation sequencing methods and bioinformatics