Basic processing of next-generation sequencing (NGS) data

Save this PDF as:

Size: px
Start display at page:

Download "Basic processing of next-generation sequencing (NGS) data"


1 Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1

2 Reminder: we are measuring expression of protein coding genes by transcript abundance Biology: Chromosome Gene Transcript Protein mrna abundance (transcript sequence copies) 2

3 A typical experimental setup Condition 1 Condition 2 Tissue sample 1 Tissue sample 2. Tissue sample n Tissue sample 1 Tissue sample 2. Tissue sample n mrna sequencing (RNA-seq) Data processing Expression analysis (comparisons) 3

4 Data processing overview Raw sequence generation Sequence filtration Mapping Mapping filtration Computing gene expression values Gene expression analysis 4

5 Sequence file formats Output files from sequencing equipment Can be MANY and HUGE data files! A common file format is Fastq (36 bp reads AAAGCTTGTTTTTTCCCTACANCTGTATCCTTTCTT +OBAN:8:1:2:902#0/1 TAAATATAACATTCTTTCCACNACACTTTCTAGGAC +OBAN:8:1:2:1718#0/1 GGAAGGCAGCGAACATCTGTTCAATCTCCTCCTTGG +OBAN:8:1:1114:370#0/1 a^aba\]_[_]wa[[z] M^YNX``]]^a`_XTXB DNA sequence Quality sequence Sequence number 1 Sequence number 2 Sequence number n 5

6 Sequence format conversions If specific sequence file format is required for downstream analysis/processing, conversion can be done with programs like maq or Program: maq (Mapping and Assembly with Qualities) Version: Contact: Heng Li Usage: maq <command> [options] Format converting: sol2sanger convert Solexa FASTQ to standard/sanger FASTQ mapass2maq convert mapass2's map format to maq's map format bfq2fastq convert BFQ to FASTQ format 6

7 Filtering on raw sequences Quality Read count per tissue/sample Uniqueness Trimming 7

8 Mapping sequences Choice of suitable program Depend on your purpose of analysis. There are many alignment software programs, here are some commonly used examples Bowtie: Basic mapping to reference sequence Maq/BWA: Mapping and SNP/indel detection Tophat: splices alignments for studying exon splice-junctions 8

9 Mapping sequences Choice of reference sequence database what to map against? Genome reference: common if you want to do transcript assembly, study alternative splicing and detect SNPs/indels Transcript reference: common if you want to do simple read mapping, count transcript copies and analyze expression levels 9

10 Mapping sequences Common issues Reference database not available. If you do not have a reference you need to consider building you own 10

11 Mapping sequences Common issues Lack of unique mapping will typically lead to random mapping Gene A Gene B ATCATCGGGCCATCGATTAGCTGATCGGACGCTA ATCGATTAGCTG TTTTCCTCTTTATCGATTAGCTGGGGGT ATCGATTAGCTG Sequence read with multiple mapping options 11

12 Mapping sequences Paired end reads 12

13 Example: map reads to reference database with Bowtie Build reference database index: bowtie-build NC_ fna e_coli_o157_h7 Test build: bowtie -c e_coli_o157_h7 GCGTGAGCTATGAGAAAGCGCCACGCTTCC Map/align reads to references: bowtie S e_coli reads/e_coli_1000.fq 13

14 Sequence Alignment MAP format (SAM: Bowtie output example) Standard alignment file format: OBAN:8:1:3:1366#0/1 16 ENSSSCG ENSSSCT ACTC M * 0 0 GTCTACTTTACGTTCAGGATGACAGGTTAATGCTTC VXG^Z^`_ZVUYZ]T`ZQ\_U\W[X_^aaa`[R\\R XA:i:0 MD:Z:36 NM:i:0 OBAN:8:1:3:285#0/1 4 * 0 0 * * 0 0 AGGTATTGGGTTTGGGGGCCTTACACACCAGGTGGA `VOW^b`RVRS`aUQMT[Z^_a_`_Y_]Y]\RNTVW XM:i:0 OBAN:8:1:3:672#0/1 4 * 0 0 * * 0 0 TGGGTATACAGTTCATCCAGTACCCGCTCCGGCTTC a`^\y_^``]``aq]a^^_vp`[[\^[sy[yqjwub XM:i:0 14

15 Filtering sequence mapping Low percent reads mapped Low number of genes covered 15

16 Computing absolute expression Counting transcript copies Mapping output Sample 1 Count Sample 1 GeneA ATCGATTAGAC GeneA 2 GeneA ATGGGCTGCAG GeneB 1 GeneB ATTTCGGCTGC GeneC 3 GeneC GeneC GeneC ATCCCTCCCTA GGGCTGGCTGC GCCGGCGGCAA Count copies f.ex. with Perl script 16

17 Creating a gene expression matrix Concat and Pivot Column IDs defined by tissue samples Rows IDs defined by gene/transcript IDs Gene Sample1 Sample2. SampleN GeneA 2 4 GeneB 1 0 GeneC

18 Filtering genes by absolute expression Number of reads per gene per sample (alternatively per total samples) Overall tissue sample assessment table 18

19 Transformation of expression values Adjust for technical differences like total read count per sample Depending in the downstream analysis tool Some tools read absolute count and does transformation/normalization Relative abundance (RA) Log transformation of RA Reads per Kilobase per Million Reads (RPKM; Mortazavi et al, 2008) 19

20 Carry on with gene expression analysis! Differential expression Clustering Etc 20

21 Some general considerations Linux is the best environment for handling and analyzing huge data files Learning some of the Linux commands can be helpful (grep, sed, cut, awk) Learning Perl/R programming can also help data text file processing Use batch files to build data processing pipelines (documentation and re-use) Get use to shift between various tools for processing, analyzing and visualization Check input/output files, you are responsible, not the software/script authors! 21

22 Resources for NGS data Forum for discussing NGS data analysis: Galaxy online tools: NCBI Short Read Archive (SRA): Bioconductor packages for NGS: ShortRead, Biostrings, edger, Rsamtools, biomart

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group Next-generation sequencing Next-generation sequencing

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Expression Quantification (I)

Expression Quantification (I) Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax)

More information

PROGRAMMING FOR BIOLOGISTS. BIOL 6297 Monday, Wednesday 10 am -12 pm

PROGRAMMING FOR BIOLOGISTS. BIOL 6297 Monday, Wednesday 10 am -12 pm PROGRAMMING FOR BIOLOGISTS BIOL 6297 Monday, Wednesday 10 am -12 pm Tomorrow is Ada Lovelace Day Ada Lovelace was the first person to write a computer program Today s Lecture Overview of the course Philosophy

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

GeneProf and the new GeneProf Web Services

GeneProf and the new GeneProf Web Services GeneProf and the new GeneProf Web Services Florian Halbritter Stem Cell Bioinformatics Group (Simon R. Tomlinson) December 10, 2012 Florian Halbritter

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: Joint project between BaRC and IT Main site: 1 Font Conventions Bold and blue refers

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance

RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance RNA Express Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance ILLUMINA PROPRIETARY 15052918 Rev. A February 2014 This document and its contents are

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

From Reads to Differentially Expressed Genes. The statistics of differential gene expression analysis using RNA-seq data

From Reads to Differentially Expressed Genes. The statistics of differential gene expression analysis using RNA-seq data From Reads to Differentially Expressed Genes The statistics of differential gene expression analysis using RNA-seq data experimental design data collection modeling statistical testing biological heterogeneity

More information

Normalization of RNA-Seq

Normalization of RNA-Seq Normalization of RNA-Seq Davide Risso Modified: April 27, 2012. Compiled: April 27, 2012 1 Retrieving the data Usually, an RNA-Seq data analysis from scratch starts with a set of FASTQ files (see e.g.

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

Hadoopizer : a cloud environment for bioinformatics data analysis

Hadoopizer : a cloud environment for bioinformatics data analysis Hadoopizer : a cloud environment for bioinformatics data analysis Anthony Bretaudeau (1), Olivier Sallou (2), Olivier Collin (3) (1), INRIA/Irisa, Campus de Beaulieu, 35042,

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Cavan Reilly December 5, 2012 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform BWT example Introduction

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Practical Solutions for Big Data Analytics

Practical Solutions for Big Data Analytics Practical Solutions for Big Data Analytics Ravi Madduri Computation Institute ( Paul Dave ( Dinanath Sulakhe ( Alex Rodriguez (

More information

Visualisation tools for next-generation sequencing

Visualisation tools for next-generation sequencing Visualisation tools for next-generation sequencing Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Outline Exploring and checking alignment with alignment viewers Using

More information

Gene Expression Analysis

Gene Expression Analysis Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information



More information

A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here

A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here A Complete Example of Next- Gen DNA Sequencing Read Alignment Presentation Title Goes Here 1 FASTQ Format: The de- facto file format for sharing sequence read data Sequence and a per- base quality score

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012 RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided

More information

Genome-scale technologies 2/ Algorithmic and statistical aspects of DNA sequencing What to sequence next? Exciting achievements of the -seq.

Genome-scale technologies 2/ Algorithmic and statistical aspects of DNA sequencing What to sequence next? Exciting achievements of the -seq. Genome-scale technologies 2/ Algorithmic and statistical aspects of DNA sequencing What to sequence next? Exciting achievements of the -seq. Ewa Szczurek University of Warsaw, MIMUW

More information

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg ( WEB-SERVER MANUAL Contact: Michael Hackenberg ( 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University The Human Genome Project took

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina Head of the Computational Biology

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

-> Integration of MAPHiTS in Galaxy

-> Integration of MAPHiTS in Galaxy Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University Sequence Characters IUPAC nucleotide

More information

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013 NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include

More information

High Throughput Sequencing Data Analysis using Cloud Computing

High Throughput Sequencing Data Analysis using Cloud Computing High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom ( LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure

More information

Data formats and file conversions

Data formats and file conversions Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases

More information

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview

More information

Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT

Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT Building Bioinformatics Capacity in Africa Nicky Mulder CBIO Group, UCT Outline What is bioinformatics? Why do we need IT infrastructure? What e-infrastructure does it require? How we are developing this

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR How to use BioMart to quickly obtain lists of gene information from Ensembl

More information December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

NGS Data Analysis: An Intro to RNA-Seq

NGS Data Analysis: An Intro to RNA-Seq NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental

More information

Managing and Conducting Biomedical Research on the Cloud Prasad Patil

Managing and Conducting Biomedical Research on the Cloud Prasad Patil Managing and Conducting Biomedical Research on the Cloud Prasad Patil Laboratory for Personalized Medicine Center for Biomedical Informatics Harvard Medical School SaaS & PaaS gmail google docs app engine

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website:

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Bioinformatics Unit Department of Biological Services. Get to know us

Bioinformatics Unit Department of Biological Services. Get to know us Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information


G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Understanding West Nile Virus Infection

Understanding West Nile Virus Infection Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,

More information

Hadoop. Bioinformatics Big Data

Hadoop. Bioinformatics Big Data Hadoop Bioinformatics Big Data Paolo D Onorio De Meo Mattia D Antonio Big Data Too much information! Big Data Explosive data growth proliferation of data capture

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Deep Sequencing Data Analysis

Deep Sequencing Data Analysis Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist

More information


CHALLENGES IN NEXT-GENERATION SEQUENCING CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: 60428 Host: Heather Merk Technical Production: John McQueen

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

This exam contains 13 pages (including this cover page) and 18 questions. Check to see if any pages are missing.

This exam contains 13 pages (including this cover page) and 18 questions. Check to see if any pages are missing. Big Data Processing 2013-2014 Q2 April 7, 2014 (Resit) Lecturer: Claudia Hauff Time Limit: 180 Minutes Name: Answer the questions in the spaces provided on this exam. If you run out of room for an answer,

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Cluster software and Java TreeView

Cluster software and Java TreeView Cluster software and Java TreeView To download the software: Cluster 3.0

More information

BIG DATA BIG DATA 8/1/12. Cool Informa+cs Tools and Services for Biomedical Research. David Ruau, PhD. August 1 st, 2012

BIG DATA BIG DATA 8/1/12. Cool Informa+cs Tools and Services for Biomedical Research. David Ruau, PhD. August 1 st, 2012 Cool Informa+cs Tools and Services for Biomedical Research David Ruau, PhD. August 1 st, 2012 @druau Sponsored by the Office of Postdoctoral Affairs and the Lane Medical Library BIG DATA BIG DATA 1 Big

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway

More information

Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics

Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics Single Nucleotide Polymorphism (SNP) Calling from Next-Gen Sequencing (NGS) data for Bacterial Phylogenetics Taj Azarian, MPH Doctoral Student Department of Epidemiology College of Medicine and College

More information

Basics of microarrays. Petter Mostad 2003

Basics of microarrays. Petter Mostad 2003 Basics of microarrays Petter Mostad 2003 Why microarrays? Microarrays work by hybridizing strands of DNA in a sample against complementary DNA in spots on a chip. Expression analysis measure relative amounts

More information

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Alan R. Gingle Andrew H. Paterson Joshua A. Udall Jonathan F. Wendel 1 CEGC project goals set the context

More information

mrna NGS Data Analysis Report

mrna NGS Data Analysis Report mrna NGS Data Analysis Report Project: Test Project (Ref code: 00001) Customer: Test customer Company/Institute: Exiqon Date: Monday, June 29, 2015 Performed by: XploreRNA Exiqon A/S Company Reg. No. (CVR)

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Text file One header line meta information lines One line : variant/position

Text file One header line meta information lines One line : variant/position Software Calling: GATK SAMTOOLS mpileup Varscan SOAP VCF format Text file One header line meta information lines One line : variant/position ##fileformat=vcfv4.1! ##filedate=20090805! ##source=myimputationprogramv3.1!

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG)

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) 1 RNA Transcription to RNA and subsequent

More information

edger: differential expression analysis of digital gene expression data User s Guide Yunshun Chen, Davis McCarthy, Mark Robinson, Gordon K.

edger: differential expression analysis of digital gene expression data User s Guide Yunshun Chen, Davis McCarthy, Mark Robinson, Gordon K. edger: differential expression analysis of digital gene expression data User s Guide Yunshun Chen, Davis McCarthy, Mark Robinson, Gordon K. Smyth First edition 17 September 2008 Last revised 8 October

More information

Databases and mapping BWA. Samtools

Databases and mapping BWA. Samtools Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:

More information

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015

Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Early DNA Sequencing Technologies Early efforts at DNA sequencing were: o tedious o time consuming o labor intensive Frederick Sanger (Sanger

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory NGS at the Academic Medical Center Sequence facility Laboratory

More information

Installation Guide for Windows

Installation Guide for Windows Installation Guide for Windows Overview: Getting Ready Installing Sequencher Activating and Installing the License Registering Sequencher GETTING READY Trying Sequencher: Sequencher 5.2 and newer requires

More information

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish-

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- Introduc.on Genome browsing The Ensembl gene set Guided examples

More information

Importance of Statistics in creating high dimensional data

Importance of Statistics in creating high dimensional data Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data

More information

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) Paris November 2013 The Sanger DNA sequencing method Sequencing

More information

Copy Number Variation: available tools

Copy Number Variation: available tools Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

GMQL Functional Comparison with BEDTools and BEDOPS

GMQL Functional Comparison with BEDTools and BEDOPS GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison

More information

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly DANIEL BLANKENBERG, JAMES TAYLOR, IAN SCHENCK, JIANBIN HE, YI ZHANG, MATTHEW

More information

MultiAlign Software. Windows GUI. Console Application. MultiAlign Software Website. Test Data

MultiAlign Software. Windows GUI. Console Application. MultiAlign Software Website. Test Data MultiAlign Software This documentation describes MultiAlign and its features. This serves as a quick guide for starting to use MultiAlign. MultiAlign comes in two forms: as a graphical user interface (GUI)

More information

How-To: SNP and INDEL detection

How-To: SNP and INDEL detection How-To: SNP and INDEL detection April 23, 2014 Lumenogix NGS SNP and INDEL detection Mutation Analysis Identifying known, and discovering novel genomic mutations, has been one of the most popular applications

More information

Efficient tool deployment to the Galaxy Cloud: An RNA-seq workflow case study

Efficient tool deployment to the Galaxy Cloud: An RNA-seq workflow case study Efficient tool deployment to the Galaxy Cloud: An RNA-seq workflow case study Sebastian J. Schultheiss Machine Learning in Biology, Rätsch Lab, FML of the Max Planck Society Tübingen,

More information

Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator

Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator Why is the NGS data processing a big challenge? Computation cannot keep up with the Biology. Source: illumina

More information

Exiqon Array Software Manual. Quick guide to data extraction from mircury LNA microrna Arrays

Exiqon Array Software Manual. Quick guide to data extraction from mircury LNA microrna Arrays Exiqon Array Software Manual Quick guide to data extraction from mircury LNA microrna Arrays March 2010 Table of contents Introduction Overview...................................................... 3 ImaGene

More information