Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team
|
|
|
- Elinor Cameron
- 9 years ago
- Views:
Transcription
1 Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team
2 Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities
3 Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities
4 NGS Data Raw: Sequencing Reads (FASTQ) Derived Alignments against reference genome (SAM/BAM) Annotations GFF BED Genome Assemblies
5 A Note on FASTQ Contains Sequence data and quality GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Several Variants exist Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res Dec 16.
6 Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities
7 Available NGS Analysis Toolsets Prepare, Quality Check and Manipulate FASTQ reads Mapping SAMTools SNP & INDEL analysis Peak Calling / ChIP-seq RNA-seq analysis
8 Prepare and Quality Check Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics Jul 15;26(14):
9 Combining Sequences and Qualities
10 Grooming --> Sanger
11 Quality Statistics and Box Plot Tool
12 Read Trimming
13 Quality Filtering
14 Manipulate FASTQ Remove reads with N s?
15 Available NGS Analysis Toolsets Prepare, Quality Check and Manipulate FASTQ reads Mapping SAMTools SNP & INDEL analysis Peak Calling / ChIP-seq RNA-seq analysis
16 Mapping NGS Data Collection of interchangeable mappers Accept FASTQ Format Create SAM/BAM Format SAMTools* Algorithms for DNA RNA Local Re-alignment *Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25,
17 Short Reads Bowtie BWA BFAST PerM Longer Reads LASTZ Metagenomics Megablast RNA Tophat Mappers
18 Variable Levels of Settings Default Best- Practices Fully customizable parameters
19 Available NGS Analysis Toolsets Prepare, Quality Check and Manipulate FASTQ reads Mapping SAMTools SNP & INDEL analysis Peak Calling / ChIP-seq RNA-seq analysis
20 SNPs & INDELs SNPs from Pileup Generate Filter INDELS
21 Available NGS Analysis Toolsets Prepare, Quality Check and Manipulate FASTQ reads Mapping SAMTools SNP & INDEL analysis Peak Calling / ChIP-seq RNA-seq analysis
22 Peak Calling / ChIP-seq analysis Punctate Binding Transcription Factors Diffuse Binding Histone Modifications PolII
23 Punctate Binding GeneTrack MACS Zhang et al. Model-based Analysis of ChIP- Seq (MACS). Genome Biol (2008) vol. 9 (9) pp. R137 Albert I, Wachi S, Jiang C, Pugh BF. GeneTrack--a genomic data processing and visualization framework. Bioinformatics May 15;24(10): Epub 2008 Apr 3.
24 MACS Inputs Enriched Tag file Control / Input file (optional) Outputs Called Peaks Negative Peaks (when control provided) Shifted Tag counts (wig, convert to bigwig for visualization)
25 Diffuse Binding CCAT (Control-based ChIP-seq Analysis Tool) Xu H, Handoko L, Wei X, Ye C, Sheng J, Wei CL, Lin F, Sung WK. A signal-noise model for significance analysis of ChIP-seq with negative control. Bioinformatics May 1;26(9):
26 ChIP-seq Exercise
27 I have Peaks, now what? Visualize Share Compare to existing Annotations Interval Operations Annotation Profiler
28 Genomic Interval Operations
29 Secondary Analysis A simple goal: determine number of peaks that overlap a) coding exons, b) 5-UTRs, c) 3-UTRs, d) introns and d) other regions Get Data Import Peak Call data Retrieve Gene location data from external data resource Extract exon and intron data from Gene Data (Gene BED To Exon/Intron/Codon BED expander x4) Create an Identifier column for each exon type (Add column x4) Create a single file containing the 4 types (Concatenate) Complement the exon/intron intervals Force complemented file to match format of Gene BED expander output (convert to BED6) Create an Identifier column for the other type (Add column) Concatenate the exons/introns and other files Determine which Peaks overlap the region types (Join) Calculate counts for each region type (Group)
30 Secondary Analysis
31 Annotation Profiler One click to determine base coverage of the interval (or set of intervals) by a set of features (tables) available from UCSC galgal3, mm8, pantro2, rn4, canfam2, hg18, hg19, mm9, rhemac2
32 Available NGS Analysis Toolsets Prepare, Quality Check and Manipulate FASTQ reads Mapping SAMTools SNP & INDEL analysis Peak Calling / ChIP-seq RNA-seq analysis
33 TopHat Cufflinks Cuffcompare Cuffdiff RNA-seq
34 TopHat Map RNA (FASTQ) to a reference Genome Uses Bowtie BAM file of accepted hits Find Splice Junctions File with two connected BED blocks Trapnell, C., Pachter, L. and Salzberg, S.L. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, (2009).
35 Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L. Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nature Biotechnology doi: /nbt.1621 Cufflinks Input: aligned RNA-Seq reads (SAM/BAM; e.g. from TopHat) assembles transcripts estimates relative abundance tests for differential expression and regulation Outputs GTF: Assembled Transcripts Tabular, with coordinates and expression levels Transcripts Genes
36 Cuffcompare Compare assembled transcripts to a reference annotation (2+ GTF files) Track Cufflinks transcripts across multiple experiments (e.g. across a time course) Outputs: Transcripts Accuracy File "accuracy" of the transcripts in each sample when compared to the reference annotation data Transcripts Combined File union of all transfrags in each sample Transcripts Tracking Files matches transcript structure that is present in one or more input GTF files Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L. Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nature Biotechnology doi: /nbt.1621
37 Cuffdiff Inputs GTF from Cufflinks, Cuffcompare, other source 2 SAM files from 2+ samples Changes in transcript expression splicing promoter use Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L. Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nature Biotechnology doi: /nbt.1621
38 RNA-seq Tutorial
39 Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities
40 Sample Tracking System Built-in system for tracking sequencing requests Customizable interfaces Sequencing Facility Managers/Administrators Customers/Users/Biologists Streamlines delivery of data from sequencing runs to customers
41 Sequencing Facility Managers Setup the Galaxy sample tracking system according to the core facility workflow. [Once per request type] Create and submit a sequencing request on behalf of another user. Reject an incomplete or erroneous sequencing request. Receive samples and assign them tracking barcodes. Setup data transfer from the sequencer Transfer the datasets from the sequencer to Galaxy at the end of the sequence run. }Can be automated
42 Sequencing Facility Users Create and submit a sequencing request. Edit and resubmit a rejected sequencing request. Obtain datasets at the end of a sequencing run. Select Libraries and Histories, and Workflows to populate and run on sequenced samples.
43 Configure Available Request / Sample Options Uses Galaxy forms, do this once
44 Configurations can be custom-built loaded from provided configuration files
45 Configure the Sequencer Available Services are now configured Ready for customers
46 How does it all work?
47 Customer Creates a Request
48 Customer Describes Request
49 Customer Adds a Sample Provide a name for the sample Data Library and Folder History Workflow to run
50 Samples Added, Submit Request
51 Samples enter New state Customer sends samples to sequencing facility
52 Sequencing Facility is informed of Request
53 Sequencing Facility Receives Samples Facility assigns a barcode to sample tubes Scans barcode at each step to change state Customer can watch progress of sequencing request
54 Sequencing Finished Datasets are transferred from sequencer into Galaxy Library User s history Galaxy Workflow is executed on Dataset Customer is automatically ed
55 Extending Sample Tracking with nglims An add-on written by community contributor Brad Chapman nglims and-analysis-system-for-galaxy/
56 Using Galaxy Use public Galaxy server: UseGalaxy.org Download Galaxy source: GetGalaxy.org Galaxy Wiki: GalaxyProject.org Screencasts: GalaxyCast.org Public Mailing Lists
57 Acknowledgments All Members of the Galaxy Team (see them at galaxy-central/wiki/galaxyteam) Thousands of our users GMOD Team UCSC Genome Informatics Team BioMart Team FlyMine/InterMine Teams Funding sources NSF-ABI NIH-NHGRI Beckman Foundation Huck Institutes at Penn State Pennsylvania Department of Public Health Emory University
58 Galaxy Team + Jennifer Jackson
59 Two full days of presentations, workshops, and conversations by and for Galaxy community members
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
How-To: SNP and INDEL detection
How-To: SNP and INDEL detection April 23, 2014 Lumenogix NGS SNP and INDEL detection Mutation Analysis Identifying known, and discovering novel genomic mutations, has been one of the most popular applications
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Running and Enhancing your own Galaxy. Daniel Blankenberg The Galaxy Team http://usegalaxy.org
Running and Enhancing your own Galaxy Daniel Blankenberg The Galaxy Team http://usegalaxy.org Overview Where and How you can use and build Galaxy public website local instance on the cloud tool shed/contributing
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012
RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Basic processing of next-generation sequencing (NGS) data
Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Visualisation tools for next-generation sequencing
Visualisation tools for next-generation sequencing Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Outline Exploring and checking alignment with alignment viewers Using
NGS Data Analysis: An Intro to RNA-Seq
NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA
Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC
Challenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group [email protected] Next-generation sequencing Next-generation sequencing
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
Bioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
Deep Sequencing Data Analysis
Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist
RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance
RNA Express Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance ILLUMINA PROPRIETARY 15052918 Rev. A February 2014 This document and its contents are
Introduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
Practical Solutions for Big Data Analytics
Practical Solutions for Big Data Analytics Ravi Madduri Computation Institute ([email protected]) Paul Dave ([email protected]) Dinanath Sulakhe ([email protected]) Alex Rodriguez ([email protected])
High Throughput Sequencing Data Analysis using Cloud Computing
High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom ([email protected]) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure
GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing
for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
GMQL Functional Comparison with BEDTools and BEDOPS
GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison
Expression Quantification (I)
Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT
Building Bioinformatics Capacity in Africa Nicky Mulder CBIO Group, UCT Outline What is bioinformatics? Why do we need IT infrastructure? What e-infrastructure does it require? How we are developing this
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
Data formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
SMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
Hadoopizer : a cloud environment for bioinformatics data analysis
Hadoopizer : a cloud environment for bioinformatics data analysis Anthony Bretaudeau (1), Olivier Sallou (2), Olivier Collin (3) (1) [email protected], INRIA/Irisa, Campus de Beaulieu, 35042,
New solutions for Big Data Analysis and Visualization
New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina [email protected] http://bioinfo.cipf.es/imedina Head of the Computational Biology
Accessing the 1000 Genomes Data. Paul Flicek European BioinformaMcs InsMtute
Accessing the 1000 Genomes Data Paul Flicek European BioinformaMcs InsMtute Data access General informamon File access 1000 Genomes Browser Tools Where to find help www.1000genomes.org www.1000genomes.org
Integrated Rule-based Data Management System for Genome Sequencing Data
Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer
Cluster software and Java TreeView
Cluster software and Java TreeView To download the software: http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm http://bonsai.hgc.jp/~mdehoon/software/cluster/manual/treeview.html Cluster 3.0
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert May 3, 2016 Abstract FlipFlop implements a fast method for de novo transcript
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING
RNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology
University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology Programme Structure - the MSc outcome will require 180 credits total (full-time only) - 60
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Subread/Rsubread Users Guide
Subread/Rsubread Users Guide Subread v1.5.0-p1/rsubread v1.20.3 1 February 2016 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research The University of Melbourne
Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected] Reference
Globus Genomics Tutorial GlobusWorld 2014
Globus Genomics Tutorial GlobusWorld 2014 Agenda Overview of Globus Genomics Example Collaborations Demonstration Globus Genomics interface Globus Online integration Scenario 1: Using Globus Genomics for
About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster
Cluster Info Sheet About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster Welcome to the PMCBRC cluster! We are happy to provide and manage this compute cluster as a resource
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
SharePoint Wiki Redirect Installation Instruction
SharePoint Wiki Redirect Installation Instruction System Requirements: Microsoft Windows SharePoint Services v3 or Microsoft Office SharePoint Server 2007. License management: To upgrade from a trial license,
Text file One header line meta information lines One line : variant/position
Software Calling: GATK SAMTOOLS mpileup Varscan SOAP VCF format Text file One header line meta information lines One line : variant/position ##fileformat=vcfv4.1! ##filedate=20090805! ##source=myimputationprogramv3.1!
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
The University is comprised of seven colleges and offers 19. including more than 5000 graduate students.
UNC CHARLOTTE A doctoral, research-intensive university, UNC Charlotte is the largest institution of higher education in the Charlotte region. The University is comprised of seven colleges and offers 19
RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application
RESEARCH RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application Mattia D Antonio 1, Paolo D Onorio De Meo 1, Matteo Pallocca 2, Ernesto Picardi 3, Anna Maria D Erchia 3, Raffaele A Calogero
Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
Welcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
RNA- seq de novo ABiMS
RNA- seq de novo ABiMS Cleaning 1. import des données d'entrée depuis Data Libraries : Shared Data Data Libraries RNA- seq de- novo 2. lancement des programmes de nettoyage pas à pas BlueLight.sample.read1.fastq
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Installation Guide for Windows
Installation Guide for Windows Overview: Getting Ready Installing Sequencher Activating and Installing the License Registering Sequencher GETTING READY Trying Sequencher: Sequencher 5.2 and newer requires
Services. Updated 05/31/2016
Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...
Workload Characteristics of DNA Sequence Analysis: from Storage Systems Perspective
Workload Characteristics of DNA Sequence Analysis: from Storage Systems Perspective Kyeongyeol Lim, Geehan Park, Minsuk Choi, Youjip Won Hanyang University 7 Seongdonggu Hangdangdong, Seoul, Korea {lkyeol,
BioHPC Web Computing Resources at CBSU
BioHPC Web Computing Resources at CBSU 3CPG workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/biohpc_web_tutorial.pdf BioHPC infrastructure at CBSU BioHPC Web
Methods, tools, and pipelines for analysis of Ion PGM Sequencer mirna and gene expression data
WHITE PAPER Ion RNA-Seq Methods, tools, and pipelines for analysis of Ion PGM Sequencer mirna and gene expression data Introduction High-resolution measurements of transcriptional activity and organization
CHALLENGES IN NEXT-GENERATION SEQUENCING
CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture
Understanding West Nile Virus Infection
Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Agilent CytoGenomics Software A Complete Solution for Cytogenetic Research Data Analysis
Agilent CytoGenomics Software A Complete Solution for Cytogenetic Research Data Analysis Technical Overview Streamlines the cytogenetic research workflow for finding CNCs, LOH, and UPD Enables manual sample
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
Next Generation Sequencing
Next Generation Sequencing Cavan Reilly December 5, 2012 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform BWT example Introduction
CloudMap: A Cloud-based Pipeline for Analysis of Mutant Genome Sequences
Genetics: Advance Online Publication, published on October 10, 2012 as 10.1534/genetics.112.144204 CloudMap: A Cloud-based Pipeline for Analysis of Mutant Genome Sequences Gregory Minevich 1,, Danny S.
Partek Methylation User Guide
Partek Methylation User Guide Introduction This user guide will explain the different types of workflow that can be used to analyze methylation datasets. Under the Partek Methylation workflow there are
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows
Genes 2012, 3, 545-575; doi:10.3390/genes3030545 Article OPEN ACCESS genes ISSN 2073-4425 www.mdpi.com/journal/genes Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline
