Ultramer. Oligonucleotides. Mutagenesis Application Guide. Experimental Overview, Protocol, Troubleshooting

Transcription

1 Ultramer Oligonucleotides Mutagenesis Application Guide Experimental Overview, Protocol, Troubleshooting

2

3 Ultramer Oligonucleotides Mutagenesis Application Guide Experimental Overview, Protocol, Troubleshooting Senior Managing Editor and Contributor Jaime Sabel Contributors Adam Clore, PhD, Brian Reinertson, and Scott Rose, PhD Integrated DNA Technologies

4 Mutagenesis Application Guide Mutagenesis Application Guide Experimental Overview, Protocol, Troubleshooting 1. Introduction Site-directed Mutagenesis PCR for Substitutions, Additions, and Deletions Primer Extension Inverse PCR Cassette Mutagenesis Random Mutagenesis (in vitro saturation) Error-prone PCR PCR with Degenerate Primers Chemical Mutagenesis Mutagenesis with Ultramer Oligonucleotides Ultramer Primer Design Terminal Changes by PCR Terminal Additions by PCR Oligonucleotide-directed Internal Mutagenesis Controls PCR Controls Ligation Controls DpnI Digestion Controls Transformation Controls Example Protocols Protocol for Terminal Changes or Additions Protocol for Oligonucleotide-directed Internal Mutagenesis Troubleshooting Primer Design Good Primer Design Template Concentration and Quality Too Much or Too Little Template Poor Quality Template

5 3.3 Reaction Setup Experimental Setup Kits Controls Reaction Components Polymerases PCR Reaction Parameters Cycle Number Annealing Temperature Extension Time Denaturation Temperature Initial Denaturation Time Touchdown PCR Ligation Quantification of Product Gel Confirmation of a Ligation Reaction Inhibitors of Ligase DpnI Digestion Controls Methylated DNA Transformation Handling Competent Cells Heat Shock Considerations Electroporation Considerations Antibiotic Selection Contamination E. coli Strains Toxic Sequences References

6

7 Mutagenesis Application Guide 1. Introduction In vitro mutagenesis is used to purposefully change genetic information. Analysis of the subsequent changes in gene expression and gene products helps elucidate the functional effect of the mutation [1]. The technique falls into two general categories: sitedirected mutagenesis and random mutagenesis. Each contains several subcategories with various methodologies used to generate mutations. The particular mutagenesis method you choose to use will depend on the goal of the project and the information you have about the target sequence (Table 1). Site-directed mutagenesis creates a specific change in a known sequence, while random mutagenesis allows researchers to screen for mutations regardless of the genomic location or to quickly create a wide variety of individual mutations. For both methods, a successful experiment depends on many factors including the technique used for constructing the mutant DNA, the quality of the primers used, an appropriate expression vector and system, effective purification, and development of an assay for detection [2]. This guide gives an overview of in vitro mutagenesis, assuming a pre-existing understanding of standard cloning and PCR techniques. It also describes how long oligonucleotides, called Ultramer Oligonucleotides, can simplify mutagenesis experiments. Two protocols for general site-directed mutagenesis techniques are provided. IDT supplies a variety of high quality reagents geared toward these methods (see IDT Reagents for Mutagenesis, pages 20 and 21). Many protocols and kits that simplify the mutagenesis process are also available commercially.

8 Mutagenesis Application Guide Desired Outcome Limited base identity changes at the end of the desired sequence IDT reagent Internal limited base identity changes (non-random) IDT reagent If you are using a cloned template source PCR (Section 1.1.1) Preferred Approach 25 nmole desalted oligos Primer Extension (Section 1.1.2) 25 nmole desalted oligos or Ultramer Oligonucleotides If you are using a genomic or cdna template source PCR (Section 1.1.1) 25 nmole desalted oligos Primer Extension (Section 1.1.2) 25 nmole desalted oligos Random internal base changes Error-prone PCR (Section 1.2.1) Error-prone PCR (Section 1.2.1) 5 or 3 terminal insertions <100 bases IDT reagent Insertions >100 bases Deletions <50 bases Deletions >50 bases IDT reagent IDT reagent IDT reagent PCR (Section 1.1.1) Ultramer Oligonucleotides Primer Extension (Section 1.1.2) or Inverse PCR (Section 1.1.3) Ultramer Oligonucleotides Inverse PCR (Section 1.1.3) or Primer Extension (1.1.2) Ultramer Oligonucleotides Inverse PCR (Section 1.1.3) 25 nmole desalted oligos PCR (Section 1.1.1) Ultramer Oligonucleotides Primer Extension (Section 1.1.2) Ultramer Oligonucleotides Primer Extension (Section 1.1.2) Primer Extension (Section 1.1.2) 25 nmole desalted oligos Table 1. Site-directed Mutagenesis Methods and Outcomes 1.1 Site-directed Mutagenesis Site-directed mutagenesis creates a mutation at a defined site and requires a known template sequence. This method of altering the sequence allows researchers to investigate the impact of sequence changes, such as single nucleotide polymorphisms (SNPs), or to insert or delete a sequence element, such as a ligand binding site or restriction site. Alternatively, site-directed mutagenesis can be used to screen a variety of mutants to determine the optimal sequence for the question at hand. 6

9 Site-directed mutagenesis is typically performed using PCR. The identification and construction of new commercial polymerases and advances in oligonucleotide synthesis have dramatically increased its efficiency. Primers designed with mutations can introduce small sequence changes, and primer extension or inverse PCR can be used to achieve longer mutant regions. In addition, PCR has provided increased precision along with a decrease in cost and time spent on mutagenesis experiments [3]. While the rest of this section will discuss the various PCR methods for site-directed mutagenesis, Section 2 will show how some of these mutation strategies can be more easily accomplished using long oligonucleotides called Ultramer Oligonucleotides PCR for Substitutions, Additions, and Deletions Changes to sequence can be made using PCR by simply including the desired change in one of the PCR primers [4]. The changes can be base substitutions (Figure 1A), additions, or deletions (Figure 1B). The primers are designed to include the desired change. As the primers are extended in the PCR, the resulting amplification product incorporates the mutation, replacing the original sequence. The method is typically very efficient, but can be adversely affected by impure oligonucleotide primers. (See Oligonucleotide Quality Requirements for Mutagenesis Protocols, page 22, for more information on the importance of oligonucleotide purity in mutagenesis). In addition to internal changes, terminal additions can also be accomplished by PCR. This process is also known as mispriming, and was first described by Mullis and Faloona [5]. The process uses a primer with additional 5 sequence not complementary to the target. The extension is added to the new product sequence during PCR. In this way, additions can be added to either or both terminal ends of a sequence (Figure 1C). The terminal additions must be made on the 5 end of the primer; any extensions on the 3 end of the primer would result in PCR failure and, therefore, cannot be done using terminal addition by PCR. While PCR for substitutions, additions, and deletions is a simple way to introduce a mutation, it is limited by the fact that the mutation can only be introduced in the sequence covered by the primers rather than the sequence that lies between the primers [3]. 7

10 Mutagenesis Application Guide Example: Substituting bases in a sequence A primer that contains the complementary bases for the desired sequence is used in a PCR. All other bases in both primers are complementary to the existing sequence. The PCR will amplify the new sequence and the final product will have the desired sequence with the base changes. Existing sequence 5 ggacgcaagctgtaatgctctagacgtta tgtggtcattgtgtcaccgcaggacattga 3 3 cctgcgttcgacattacgagatctgcaat acaccagtaacacagtggcgtcctgtaact 5 Desired sequence 5 ggatccaagctgtaatgctctagacgtta tgtggtcattgtgtcaccgcaggacattga 3 3 cctaggttcgacattacgagatctgcaat acaccagtaacacagtggcgtcctgtaact 5 Primer A 5 ggatccaagctgtaatgctcta 3 cctgcgttcgacattacgagatctgcaat acaccagtaacacagtggcgtcctgtaact 5 5 ggacgcaagctgtaatgctctagacgtta tgtggtcattgtgtcaccgcaggacattga 3 <-cagtggcgtcctgtaact 5 Primer B Figure 1A. PCR for Base Substitutions. Primers containing the base changes of interest as a non-complementary break in the primer sequence (indicated by the blue bubble in primer A) are used in a PCR reaction. As the primers are extended, the resulting amplification product incorporates the mutation, replacing the original sequence (shown as a blue bar in the PCR product). 8

11 Figure 1B. PCR for Deletions. Primer A contains complementary sequence to the regions flanking the area to be deleted. During PCR, primer binding will cause a region of the template to loop out, and amplify only the complementary region. The final product is shorter because it is missing the deleted sequence. Figure 1C. PCR for Terminal Additions. An Ultramer primer containing an addition to the sequence on the 5 end (the 6X His tag, primer B) is used along with the complementary primer A to amplify a new product containing the terminal addition. 9

12 Mutagenesis Application Guide Primer Extension Site-directed mutagenesis by primer extension was first described by Ho et al. and involves incorporating mutagenic primers in independent, nested PCRs to ultimately combine them in the final product [6]. The reaction uses flanking primers (primers A and D) on either end of the target sequence, plus two internal primers (primers B and C) that contain the mismatched or inserted bases and hybridize to the region where the mutation will occur. The first round of PCR creates the AB and CD fragments. The two PCR products are mixed together for a second round of PCR. Because primers B and C have complementary ends, the two fragments will hybridize in the second PCR with primers A and D. The final product AD will contain the mutated sequence (Figure 2A). Figure 2A. Primer Extension for an Insertion. Primers B and C contain the complementary sequence that will be inserted (indicated by the blue line). The first round of PCR uses two reactions with primer pairs A/B (1) and C/D (2). The two resulting PCR products are mixed together with primer pair A/D for a second round of PCR. The overlapping regions of the two, first-round PCR products allow the strands to hybridize and the second round of PCR creates the final, fulllength product with the desired insertion. Site-directed mutagenesis using primer extension for base deletions or changes is a similar process to that just described. To create a deletion, the B and C primers are positioned on either side of the region to be deleted so that it does not become part of the AB and CD fragments. By design, the B and C primers include complementary sequence so that the AB fragment will hybridize to the CD fragment for the final extension. Because the wild type sequence is not amplified, the final AD product will not contain the deleted fragment (Figure 2B) [6]. Primer extension for additions requires that any additional bases must reside within one of the primers. Traditionally, primer length was limited to bases due to synthesis yield constraints. However, with the advent of improved synthesis technology, use of especially long primers, such as the IDT Ultramer Oligonucleotides, now makes longer additions possible. 10

13 Figure 2B. Primer Extension for Deletions. Primers B and C are located on either side of the sequence to be deleted and contain sequence from both sides of the deletion (indicated by black or gray additions that match the black or gray original sequence). This sequence will allow them to overlap with the other fragment after the first round of PCR. The first round of PCR uses primer pairs A/B and C/D. The two resulting PCR products are mixed together with the primer pair A/D for a second round of PCR. The overlapping regions of these two, first-round PCR products allow the strands to hybridize and the second round of PCR creates the final, full-length product with the desired area deleted. Alternatively, Lee t al. recently described a new method, overlap extension PCR, that involves an additional set of PCR primers to bring in a longer insert [7]. Primer sets A/B and E/F are used to amplify the original sequence while primer set C/D is used to amplify the insert cassette. Primers B, C, D, and E have additional overlapping sequence that, when hybridized, align the three sections in the correct order. Thus, during a second round of PCR using the primer set A/F, the three separate pieces are incorporated together (Figure 2C). Figure 2C. Primer Extension for Longer Additions. Primer sets A/B and E/F are used to amplify the original sequence into two fragments while primer set C/D is used to amplify an insert cassette. Primers E and B contain additional complementary sequence to the insert cassette (indicated by the blue line) and Primers C and D contain additional complementary sequence to the original sequence (indicated by the black or gray additions that match the black or gray original sequence). The three resulting PCR products are mixed together with primer pair A/F for a second round of PCR. The overlapping regions of the three, firstround PCR products allow the strands to hybridize and the second round of PCR creates the final, full-length product with the original sequence and the inserted cassette. 11

14 Mutagenesis Application Guide One of the most widely adopted methods for introducing changes by primer extension was developed by Stratagene and is marketed as the QuikChange Site-Directed Mutagenesis Kit. This mutagenesis protocol requires two complementary oligonucleotides, a high-fidelity polymerase, and the restriction enzyme, DpnI. The approach is to hybridize complementary oligonucleotides that contain altered sequence at their center to denatured double-stranded plasmid DNA. A high-fidelity polymerase is used to generate a copy of each strand of the plasmid DNA by priming from the mutagenic primers. This polymerase does not displace the newly synthesized strands and so the extension stops when the primers copy the entire plasmid and return to the 5 end of the primer. The extension mix is treated with the DNA endonuclease restriction enzyme, DpnI, which requires that the N7 position of adenine be methylated as part of its G M ATC recognition sequence. The methylated adenine is only present on the parental plasmid (due to the action of the bacterial DNA methyltransferase, Dam). Thus, DpnI selectively cleaves the parental plasmid DNA, leaving only the mutagenic strands. Once transformed into high efficiency competent bacteria, the annealed mutagenic strand nicks are sealed and the plasmid, now carrying the mutation, is replicated Inverse PCR While traditional PCR amplifies a region of known sequence, inverse PCR uses primers oriented in the reverse direction to amplify a region of unknown sequence [8]. Mutagenic primers can be used to change cloned sequences using a technique adapted from the inverse PCR method [9]. In this method, the entire circular plasmid is amplified and a sequence is deleted (Figure 3A), changed (Figure 3B), or inserted (Figure 3C). The primers are positioned back-to-back, facing outward, on the two opposite DNA strands. One or both of the primers contain the mismatches to create the desired mutations, and both may also carry phosphorylated 5 ends or a restriction site for subsequent recircularization. The DNA polymerase used in the PCR must be high fidelity and leave blunt ends for subsequent ligation. After PCR, the plasmid DNA is purified, the phosphorylated ends are ligated, and the recircularized plasmid is transformed. [9]. An updated version of this method with a protocol for its use was recently published by Erster and Liscovitch [10]. The authors suggest this method could be used for many types of insertions into target proteins including: ligand-binding domains, functional domains, cleavage sites, tags, and regulatory elements. 12

15 13 Figure 3A. Inverse PCR for a Deletion. This method uses primers that hybridize to regions on either side of the area to be deleted. In this case, the primers contain 5 phosphorylated ends to allow the two ends to be ligated together following amplification. PCR with a high fidelity DNA polymerase that leaves blunt ends creates a linearized fragment that is missing the deleted region. This fragment is then recircularized by intramolecular ligation and the resulting plasmid is transformed.

16 Mutagenesis Application Guide Figure 3B. Inverse PCR for a Substitution. One of the two primers contains the mutation of interest (indicated by the blue bubble). In this case, both primers contain 5 phosphorylated ends to allow the two ends to be ligated together following amplification. PCR is used to amplify the entire circular plasmid to create a linear template that contains the substituted sequence. This fragment is then recircularized by intramolecular ligation and the resulting plasmid is transformed. 14

17 15 Figure 3C. Inverse PCR for an Insertion. The primers are lined up back-to-back on either side of the area where the new sequence will be inserted (indicated by the black, dotted line). One of the primers contains the additional sequence that will be inserted (indicated by the blue line). Both primers contain 5 phosphorylated ends to facilitate ligation following amplification. PCR creates a linearized fragment containing the new sequence. The plasmid is then recircularized by intramolecular ligation and transformed.

18 Mutagenesis Application Guide Cassette Mutagenesis Cassette mutagenesis replaces a section of DNA sequence with a DNA fragment containing the mutated sequence [2]. The insert and target fragments can be generated either by restriction digestion, PCR amplification, or commercial synthesis of products like IDT Ultramer Oligonucleotides or IDT Genes. The restriction digestion method is dependent on the presence of restriction sites on each side of the area that will be replaced. These restriction sites may be present in the original plasmid or may be inserted into its sequence [11]. In this method, the original plasmid is cleaved on either side of the region of interest with two restriction enzymes (Figure 4). The new cassette is then ligated into the linearized plasmid. The PCR amplification method does not require specific restriction sites but does require synthetic oligonucleotides. Cassette mutagenesis has many advantages. It is a very efficient technique and provides an easy way to screen mutants by simply sequencing the resulting plasmids. It provides flexibility to perform many different mutagenesis events on the same vector once set up with flanking restriction sites. Multiple cassettes can also be inserted throughout the vector [12]. Disadvantages to this approach include the need to identify or insert appropriate restriction sites for exchanging cassettes. Unless the mutated cassette is obtained commercially, the mutations must be generated using oligonucleotides, cloned, and sequenced before insertion back into the plasmid. Finally, cassette mutagenesis can lead to occasional double mutants or deletion mutants resulting from oligonucleotide impurities, underscoring the importance of using high quality primers. (See Oligonucleotide Quality Requirements for Mutagenesis Protocols, page 22, for more information on the importance of oligonucleotide purity in mutagenesis). 1.2 Random Mutagenesis (in vitro saturation) Random mutagenesis creates mutations at undefined sites and does not require knowledge of sequence or function. This approach is a powerful means to identify protein variants with desired properties as well as to understand the interaction of genes in biological pathways. Using a screening assay designed to detect a specific phenotype, protein sequence libraries can be put through multiple rounds of mutation and selection in a process known as directed protein evolution. Through this process, investigators can reveal the function of proteins by mapping enzymatic active sites, studying their role in cellular events, or examining structure-function relationships [13]. If multiple desired mutations are identified in the same gene, investigators can use site-directed mutagenesis to combine these mutations to test their interactions with other genes in biological pathways [14]. 16

19 17 Figure 4. Cassette Mutagenesis. The original plasmid is cleaved with restriction enzymes A and E on either side of the cassette to be removed (indicated in orange). The restriction digest creates a linearized plasmid fragment and a cassette. The new cassette (indicated in blue) containing the desired changes is then ligated into the linearized plasmid.

20 Mutagenesis Application Guide Random mutations can be introduced in a number of ways including by chemical mutagenesis, error-prone PCR (enzymatic mutagenesis), PCR with degenerate primers, UV irradiation, mutator strains, nucleotide analogs, or DNA recombination [15]. Three of these error-prone PCR, PCR with degenerate primers, and chemical mutagenesis are discussed here in more detail Error-prone PCR Error-prone PCR is the standard method that researchers use to create libraries of mutations within single genes. The procedure is simple and is used in the most common type of mutagenesis experiments: those that examine a small number of mutations to identify a desired phenotype. DNA polymerases are not 100% efficient and have varying degrees of fidelity. Of those tested, Taq DNA polymerase has the lowest fidelity, with an error rate of % per nucleotide per pass of the polymerase [16, 17]. For most reaction conditions, this error rate is not sufficient to cause mutagenesis. However, altering the reaction conditions, the polymerase, or the divalent cation used by the polymerase can increase the error rate and generate mutations [18]. Cadwell and Joyce reported increasing the mutation rate to 0.66% ± 0.13% per position per PCR [18]. The advantages to this method include the ability to repeat mutagenesis through many rounds of selection as well as to create mutant libraries from randomized cloned genes in order to screen for specific phenotypes. A caveat is that Taq polymerase has a bias toward inducing mutations in A and T bases [19]. Further, excessively altered conditions lead to poor amplification and undesired amplicons; thus, a balance must be achieved between conditions ideal for mutagenesis and those that lead to PCR artifacts [18]. The area that undergoes mutagenesis in error-prone PCR is determined by the position of the primers. The actual reaction is performed under conditions that reduce the fidelity, or increase the error rate, of the polymerase. Thus, the number of reaction cycles determines the degree of mutagenesis [20]. A new technique, called MutaGen, improves on this method by adding a selective PCR amplification of the replicated mutated sequences following the initial round of mutagenic replication [21]. The combination of the two steps allows a wider range of variants to be obtained and combines all types of mutations, including codon deletions. MutaGen has been reported as an efficient method for generating libraries with human fragment antibodies, or those displaying different mutation rates and complementary mutational spectra. The diversity of mutations can be increased further by creating libraries using different DNA polymerases and then pooling them into a single library. 18

21 1.2.2 PCR with Degenerate Primers PCR with degenerate primers can also be used for semi-random mutagenesis. In this approach, primers are synthesized with a mixture of wild type and non-wild type nucleotides which results in predictable rates of misincorporation per nucleotide [22]. The primers can also contain both regions of wild type sequence and degenerate sequence. Degenerate regions are synthesized with a mixture of the nucleotides consisting primarily of the wild type base with a small percentage of the other three bases. Oligonucleotides with mixed base composition can be ordered from commercial vendors like IDT. The degenerate PCR method is the most cost-effective method for performing saturation mutagenesis generation of all possible mutations within a gene region due to the shorter oligonucleotides used [22]. In addition, degenerate PCR also biases against mutants with multiple mutations when there is a single degenerate base position. This makes it a good tool for identifying single base changes that alter function. Because the percentage of base substitutions at each position in the primer can be controlled, this method allows for more precise control over the location and rate of mutagenesis than other random mutation methods. The disadvantages to this method are that it can bias mutations toward sequences with a higher binding affinity for the degenerate primers and changes are limited to the primer binding locations. In addition, it is often hard or impossible to select for changes that will result in a subset of amino acids Chemical Mutagenesis Chemical mutagenesis can induce changes in living cells across the entire genome. These changes avoid the bias that PCR-based mutagenesis methods have toward AT to GC transversions as a result of DNA polymerase bias. In addition, this method has the advantage of selecting for non-lethal mutations because the cells must replicate for the changes to be observed. Lai et al. first described use of ethyl methane sulfonate (EMS) for in vitro mutagenesis in the coding region of a gene [23]. EMS is an alkylating agent that results in G-T mismatches through introduction of AT to GC and GC to AT transition mutations. The degree of mutagenesis achieved can be altered by changing the reactions conditions, such as concentration of EMS, incubation time and temperature, reaction ph, or the length or amount of the targeted gene. 19

22 Mutagenesis Application Guide IDT Product Focus: Reagents for Mutagenesis Primers IDT offers custom DNA synthesis on scales from 25 nmole to 10 μmole. Every oligonucleotide primer is deprotected and desalted to remove small molecule impurities. Oligonucleotides are quantified twice by UV spectrophotometry to provide an accurate measure of yield and are quality control checked by mass spectrometry. Ultramer Oligonucleotides Ultramer Oligonucleotides are bases long and are synthesized using IDT proprietary, high-fidelity synthesis systems and chemistries. They are the longest, highest-quality oligonucleotides commercially available and are ideal for demanding applications like cloning, ddrnai, and gene construction. Researchers can save a great deal of time and trouble in these applications through direct synthesis of the entire target fragment. Ultramer Oligonucleotides are available on several scales, and can come with attached modifications such as 5 phosphate, biotin, and amino modifiers C6 and C12. Internal degenerate bases, as well as deoxyuracil and deoxyinosine modifications are also available. Phosphate Modifications Phosphate modifications may be added to any primer or Ultramer Oligonucleotide. 5 phosphorylation is necessary if the product will be used as a substrate for DNA ligase, as when two pieces will be ligated together to create a combined, longer product. 3 phosphorylation will inhibit degradation by some 3 -exonucleases and can be used to block extension by many DNA polymerases. Genes IDT provides a confidential custom gene synthesis service. By ordering genes from IDT, researchers not only save money spent on reagents necessary for construction, cloning, and sequencing, but can also save time by outsourcing the manufacturing of hard-to-clone gene sequences which often result in repeated failures. At IDT, all genes are constructed using Ultramer Oligonucleotides and the highest fidelity next generation synthesis technology available. Genes arrive in a plasmid cloning vector and are ready for use in a variety of applications. For more information and to order these products, please visit IDT s website at 20

23 IDT Product Focus: Degenerate Primers Machine Mixed Bases Machine mixed bases contain an equal ratio of each base and are used to create random primers. To order, enter the IUB symbols (e.g., R for a mix of A and G) into the sequence on the IDT DNA ordering page ( For a complete list of the IUB symbols, see the Mixed Bases tab on the DNA ordering page. Custom Mixed Bases Custom mixes of bases allow customers to specify the ratio of each base. Both hand mix and machine mix options are available. To order click on the Mixed Bases tab on the IDT DNA ordering page ( Trimers Inserting serial N bases gives rise to all 64 possible codons. This does not produce an equal representation of the 20 amino acids (AAs), but rather biases toward those AAs that have more codons encoding them. Additionally, serial N bases will also insert unwanted stop codons. To avoid this, a set of trimer phosphoramidites have been developed which comprise a single codon for each of the 20 AAs. These are available as a 20 Trimer Mix for creating better N-domains in oligonucleotides intended to encode proteins. It is also possible to obtain custom mixes with more limited amino acid content. To add Trimers to your oligonucleotide order, click on the modification tab on the IDT DNA ordering page ( Universal bases To add these modifications to your oligonucleotide order, click on the modification tab on the IDT DNA ordering page ( DeoxyInosine is a naturally occurring base that, while not truly universal, is less destabilizing than mismatches involving the 4 standard bases. Some base pairing bias does exist with di:dc > di:da > di:dg > di:dt. When present in a DNA template, deoxyinosine preferentially directs incorporation of dc by DNA polymerase into the growing nascent strand. 5-Nitroindole is currently the best universal base available. It does not favor any particular base pairing and is not as destabilizing to the duplex as mismatches between the standard bases. 5-Nitroindole directs random incorporation of any specific base when used as a template for DNA polymerase, and partially blocks enzyme processivity. 21

24 Mutagenesis Application Guide Oligonucleotide Quality Requirements for Mutagenesis Protocols For mutagenesis applications, the quality of the oligonucleotide primers is a critical consideration. Impure oligonucleotides can adversely affect the reaction efficiency and can introduce additional undesired mutations. IDT monitors every custom synthesis reaction on every synthesis platform and maintains a base-coupling efficiency that is higher than the industry standard. IDT has also pioneered the use of high-throughput quality control (QC) methods and is the only oligonucleotide manufacturer that offers 100% QC and purity guarantees. QC documents are even made available to customers. In addition, IDT evaluates product quality compared to competitor products; IDT oligonucleotides consistently rank as the most pure. This exceptional oligonucleotide quality reduces downstream processing costs, such as assembly and sequencing, and lowers the overall cost of generating sequences carrying mutations. In addition to purity, IDT tests its oligonucleotides against those from competitors in functional studies. A recent performance test examined primers used for sitedirected mutagenesis (SDM). Four pairs of SDM primers were ordered from four different companies (including IDT). These sets were: Set 1 = Single base change C to G (40mers) Set 2 = Random 20 bp mutagenesis (60mers) Set 3 = Addition of a 20 bp section of the repetitive element GGT (60mers) Set 4 = Deletion of a 20 bp section (60mers) These oligonucleotides were used in parallel SDM experiments, and resulting clones were screened by IDT scientists. The data from the cumulative cloning experiments show that, in every case, use of IDT oligonucleotides led to better mutagenesis results. Correct Colonies out of 8 Tested IDT Competitor A Competitor B Competitor C SDM Set SDM Set SDM Set SDM Set % Correct 100% 87.5% 84% 59% 22

25 2. Mutagenesis with Ultramer Oligonucleotides Ultramer primers are oligonucleotides that range in length from bases and simplify the addition of large changes into a target sequence. These high-fidelity oligonucleotides are the longest oligonucleotides commercially available. Coupling efficiencies for their synthesis routinely reach 99.7%, which eliminates the need for purification. Ultramer primers are especially useful in PCR and site-directed mutagenesis reactions. Incorporating Ultramer Oligonucleotides as the mutagenic primers allows for greater flexibility in the type and size of sequence changes that can be made. The 3 end of the Ultramer Oligonucleotide primes the PCR with the additional sequence placed upstream (5 ). Researchers can add long stretches of new sequences to an existing clone by adding up to 180 bases to a 20 base PCR primer, make changes to a large area within a clone in a single reaction, or change or correct multiple sequence locations simultaneously (Figure 5). Ultramer primers also provide a new tool for regions that have traditionally been difficult to target by extending primers into regions with more optimal sequence composition than was previously attainable. Changing sequence identity at the 5 and 3 ends of a known sequence, or adding additional flanking sequences, are the most straightforward ways to modify DNA. Typically, this procedure is used for adding terminal restriction sites to aid in cloning, adding protein purification tags such as 6X His, or adding bacterial phage promoters such as T7/T3/ SP6 for synthesis of in vitro RNA transcripts. However, site-directed mutagenesis makes it possible to introduce sequence changes anywhere within a cloned sequence. Here we provide design recommendations for using Ultramer primers with these types of mutagenesis procedures as well as example protocols. The first techniques, Terminal Changes by PCR and Terminal Additions by PCR, create changes at the ends of a PCR amplicon. The second approach, Oligonucleotide-directed Internal Mutagenesis, creates changes anywhere within a cloned sequence. Example: Using Ultramer Oligonucleotides for Site-Directed Mutagenesis Ultramer Oligonucleotides allow mutations to be made over a large region in a single PCR extension reaction. In the experiment in Figure 5, a 33-base region was targeted for site-directed mutagenesis with Ultramer Oligonucleotides that had degenerate bases added at specific points. The oligonucleotides were desalted, but not purified further. The degenerate bases allowed a set of these long oligonucleotides to create a library of clones containing a variety of mutations in the targeted region. Each of the lines of sequence represent single clones that were created. Although a few clones do have 23

26 Mutagenesis Application Guide mutations outside the 33-base region, almost all only contain mutations in the targeted area. This experiment exhibits both how Ultramer Oligonucleotides can be used for creating multiple mutations in a broad region and how additional purification of these products is not mandatory. Figure 5A. 93mer Ultramer Primers Used for Mutagenesis (Above left) Aspartic acid residue 7 and glutamic acid residue 8, contribute to the active site of the Pyrococcus abysii RNase H2 enzyme. Targeted saturation sitedirected mutagenesis was carried out on residues 2 12 using a 93mer Ultramer Oligonucleotide. 2 desalted complementary Ultramer Oligonucleotides were synthesized with 30 base non-degenerate 5 and 3 ends. The internal sequences of the Ultramer Oligonucleotides were synthesized with mixed phosphoramidites at a ratio of 91:3:3:3 so that mutations would be introduced but not at every site. 2 desalted 93mer degenerate Ultramer Oligonucleotides were run on a 10% acrylamide, 7 M Urea denaturing gel and visualized with GelStar Nucleic Acid Gel Stain (Cambrex Bio Science Rockland). The size markers were PAGE purified Ultramer Oligonucleotides of 80, 100, 125, 150, 175, 200, and 225 nt in length. Figure 5B. Sequence of RNase H2 Enzyme Active Site Mutations (Above right) The mutagenesis reaction was completed by extension with KOD DNA polymerase, followed by DpnI digestion of the parent plasmid, and transformation into competent BL21DE3 cells. 59 of the resultant clones were sequenced. Even though the Ultramer Oligonucleotides were not purified further than standard desalting, 88% of the clones contained only mutations within the central 11 amino acid targeted region. The majority of these clones had between 3 5 mutations within this region. 24

27 2.1 Ultramer Primer Design Primer design and cycling conditions will vary based on the type of sequence change you intend to make. While some of the basic PCR primer design rules hold true, others may have to be amended as the template sequence places some constraints on the primer sequence. Accurately calculating the melting temperature (T m ) of the oligonucleotide primers, minimizing primer-primer interactions, starting with the correct amount of template, and carefully screening against potential off-target hybridization are all key factors to a successful PCR amplification. You can easily calculate an accurate T m and screen the sequence for potential interactions (e.g., dimer formation) with the free IDT online SciTools software, OligoAnalyzer 3.1 ( To calculate the T m of the oligonucleotide, you need to know the final monovalent salt (K +, Na +, NH 4+ ), divalent salt (Mg 2+ ), dntp, and oligonucleotide concentration of the planned PCR. These values must be entered into the input parameters in OligoAnalyzer 3.1 to get an accurate calculation of the T m. Unfortunately, many vendors do not disclose their PCR buffer composition. If that information is not available, use default conditions of 50 mm [K + ]. When the magnesium salt is included in the buffer, its concentration is typically at mm, except for buffers used for qpcr where the [Mg 2+ ] starts at 3 mm. The primer sequence should have little to no secondary structure. You can measure the stability of any secondary structure within the oligonucleotide sequence with UNAfold, another free tool within the online suite of IDT SciTools ( In the output, confirm that the T m of the folded sequence is at least 5 10 C less than the annealing temperature and the secondary structure has a ΔG value between 0 and -9 kcal/ mol. For additional discussion, see Troubleshooting Section Good Primer Design. IDT Product Focus: Ultramer Oligonucleotides Ultramer Oligonucleotides are bases long and are synthesized using IDT proprietary, high-fidelity synthesis systems and chemistries. They are the longest, highest quality oligonucleotides commercially available and are ideal for demanding applications like cloning, ddrnai, and gene construction. Researchers can save a great deal of time and trouble in these applications through direct synthesis of the entire target fragment. Ultramer Oligonucleotides are available on several scales, and can come with attached modifications such as 5 phosphate, biotin, and amino modifiers C6 and C12. Internal degenerate bases, as well as deoxyuracil and deoxyinosine modifications are also available. 25

28 Mutagenesis Application Guide Terminal Changes by PCR See Section for an example protocol for this method. Designing the oligonucleotide primers for this type of mutagenesis is straightforward. If the goal is to simply change one to a few bases (e.g., to add or remove a restriction site), then alter the primer sequence to reflect the desired sequence, calculate the T m of the mismatch using OligoAnalyzer 3.1, and use an annealing temperature 1 2 C lower than the calculated T m for the mutagenic primer. Sequential base changes will have a greater destabilizing effect and will significantly lower the melting temperature. Example: Changing a base near the 5 end of a sequence to generate a Bam HI (GGATCC) restriction site. The T m was calculated using OligoAnalyzer 3.1 with the following conditions: 0.25 μm oligo, 50 mm KCl, 2 mm MgCl 2, 0.8 mm dntp. Cycling conditions used with the hot start KOD DNA Polymerase (0.5 U) (Novagen) were 2 min 95 C; 30 x (20 sec 95 C, 15 sec 56 C, 45 sec 70 C). Desired mutation underlined red GCATCCAAGCTGTAATGCTCTAgacgttatcctgtggatgattactctgtggtcattgtgtccccgcaggacatt- gac Mutagenic forward primer GgATCCAAGCTGTAATGCTCTA Tm 57.8 Wild type sequence GCATCCAAGCTGTAATGCTCTA Tm 61.7 If the PCR product will be digested with a restriction enzyme and subcloned directly, add 3 5 T bases at the 5 end of the primer to allow for efficient binding and cleavage of the PCR product by the restriction enzyme. Do not include those additional bases in the T m calculation. 26

29 2.1.2 Terminal Additions by PCR See Section for an example protocol for this method. To design the primers, select the sequence by extending the length base-by-base from the 5 end of each DNA strand until the calculated T m of the proposed primer sequence matches the desired annealing temperature for the PCR reaction, typically in the range of C. The oligonucleotide concentration, monovalent salt concentration, dntp concentration, and Mg 2+ ion concentration are necessary for accurate T m calculations. Exclude primer designs that form stable heterodimers, homodimers, or hairpins, if possible. While it may not be possible to completely eliminate such undesired interactions, increasing or decreasing primer length should minimize these interactions. Potential interactions with heterodimers, homodimers, and hairpins can be evaluated using OligoAnalyzer 3.1 ( Once the forward and reverse primers have been designed, add the new sequence in front of the appropriate primer. The PCR thermocycling profile is based on the initial annealing temperature of the primer without the additional sequence added. Example: Adding HSV-Tag, 6X His tag to the 3 end of the coding sequence for the Pyrococcus abysii RNase H2 gene. Target sequence: atgaaagttgcaggtgcagatgaagctggtcgtggtccagttattggtccgctggttattgttgctgctgttgtggaggaagacaaaatccgctctctgactaagctgggtgttaaagactccaaacagctgaccccggcgcaacgtgaaaaactgttcgatgaaatcgtaaaagtactggatgattactctgtggtcattgtgtccccgcaggacattgacggtcgtaagggcagcatgaacgaactggaggtagaaaacttcgttaaagccctgaatagcctgaaagttaagccggaagttatttacattgattccgctgatgttaaagctgaacgtttcgctgaaaacattcgcagccgtctggcgtacgaagcgaaagttgtagccgaacataaagcggatgcgaagtatgagatcgtatccgcagcctctatcctggcaaaagttatccgtgaccgcgagatcgaaaagctgaaagccgaatacggtgattttggttccggttacccgtctgatccgcgtactaagaaatggctggaagaatggtatagcaaacacggcaatttcccgccgatcgtgcgtcgtacttgggatactgcaaagaaaatcgaagaaaaattcaaacgtgcgcagctgaccctggacaacttcctgaagcgttttcgcaac The following primers were selected. T m was calculated using OligoAnalyzer 3.1 with the following conditions: 0.25 μm oligo, 50 mm KCl, 2 mm MgCl 2, 0.8 mm dntp. Forward primer 5 -atgaaagttgcaggtgcaga-3 Tm 61.6 Reverse primer 5 -gttgcgaaaacgcttcagga-3 Tm 62.6 Extended reverse primer with HSV-Tag (in green) and 6X His tag (in red) 5 -TCAGTGGTGGTGGTGGTGGTGCTCGACATCCTCGGGGTCTTCCGGGGCGAGTTCTGGCTGGCTgttgcgaaaa cgcttcagga-3 27

30 Mutagenesis Application Guide Oligonucleotide-directed Internal Mutagenesis See Section for an example protocol for this method. As discussed in Section 1.1.2, one of the most widely adopted methods for introducing changes anywhere within a plasmid was developed by Stratagene and marketed as the QuikChange Site-Directed Mutagenesis Kit. Incorporating Ultramer primers into this method is both simple and highly effective. The Ultramer primer sequence is designed by selecting 25 bases upstream and downstream (shown underlined, below) of the site to be mutagenized (shown in red, below). The goal is to get the T m of this flanking sequence to be 60 C or greater. Add in the desired sequence (shown in blue, below) to finalize the Ultramer primer sequence, and create the reverse complement sequence. The Stratagene protocol recommends purified primers but this step is not necessary when high-fidelity Ultramer Oligonucleotides are used desalted oligonucleotides of this length do not require additional purification as long as more than one clone will be sequenced. Example: Mutagenic oligo design Aspartic acid residue 7 and glutamic acid residue 8, contribute to the active site of the Pyrococcus abysii RNase H2 enzyme. Amino acids Asp7 and Glu8 (highlighted in red) were targeted for mutagenesis to Arg and Lys. 25 bases upstream and downstream of the site to be mutagenized (shown underlined) were selected. The desired sequence (highlighted in blue) was added and the reverse complement sequence was created. 5 GGATCCGATGAAAGTTGCAGGTGCAAGGAAGGCTGGTCGTGGTCCAGTTATTGGTC 3 5 GACCAATAACTGGACCACGACCAGCCTTCCTTGCACCTGCAACTTTCATCGGATCC 3 Starting Template Sequence CTGCCCAGCCGGCGATGGCCATGGATATCGGAATTAATTCGGATCCGATGAAAGTTGCAGGTGCAGATGAAGCTGGTCGTG- GTCCAGTTATTGGTCCGCTGGTTATTGTTGCTGCTGTTGTGGAGGAAGACAAAATCCGCTCTCTGACTAAGCTGGGTGT- TAAAGACTCCAAACAGCTGACCCCGGCGCAACGTGAAAAACTGTTCGATGAAATCGTAAAAGTACTGGATGATTACTCT- GTGGTCATTGTGTCCCCGCAGGACATTGACGGTCGTAAGGGCAGCATGAACGAACTGGAGGTAGAAAACTTCGTTA- AAGCCCTGAATAGCCTGAAAGTTAAGCCGGAAGTTATTTACATTGATTCCGCTGATGTTAAAGCTGAACGTTTCGCT- GAAAACATTCGCAGCCGTCTGGCGTACGAAGCGAAAGTTGTAGCCGAACATAAAGCGGATGCGAAGTATGAGATCGTATCC- GCAGCCTCTATCCTGGCAAAAGTTATCCGTGACCGCGAGATCGAAAAGCTGAAAGCCGAATACGGTGATTTTGGTTCCGGT- TACCCGTCTGATCCGCGTACTAAGAAATGGCTGGAAGAATGGTATAGCAAACACGGCAATTTCCCGCCGATCGTGCGTCG- TACTTGGGATACTGCAAAGAAAATCGAAGAAAAATTCAAACGTGCGCAGCTGACCCTGGACAACTTCCTGAAGCGTTTTCG- CAACaagctt----plasmid vector sequence 28

31 2.2 Controls Effective controls are an integral component of any mutagenesis experiment. The controls listed below will confirm each step in the process toward making a site-specific mutation. You may choose to eliminate some of these controls but it is important to weigh removing a control against the time and costs associated with repeating the experiment if you observe incomplete or poor results. At a minimum, each step of the process should include a positive and a negative control. The positive control should be a plasmid of similar size to the experimental plasmid that can be mutated to give an easily identifiable phenotype. This will allow you to follow each of the steps of the mutagenesis reaction with template and primers that are known to work. An example of this type of control would be a plasmid containing a gene expressing the alpha subunit of the β-galactosidase gene. This gene can easily be mutated into an inactive form by changing the start codon to a stop codon, or by adding one or more stop codons to the 5 end of the gene. Detection of this change is easily observed when transformed into cells compatible with blue-white screening (such as DH5α) and plated on agar plates containing X-Gal PCR Controls Negative control a PCR with all of the PCR components except template. No amplification product should be detectable. If a product is amplified, one of the reagents is contaminated and must be replaced. Positive control a PCR containing a control plasmid and primers that will yield a mutant product. This reaction should be run with the same conditions and reaction components as the experimental reaction. The control plasmid should be similar in size to the test sequence so that it will amplify under the same cycling conditions. When you run these controls on an agarose gel, you should see a strong, single band in the positive PCR control lane and no band in the negative control lane. 29