Supplementary Table 1. Forward and reverse primers used in PCR amplification and cycle
|
|
|
- Ashley O’Connor’
- 7 years ago
- Views:
Transcription
1 Supplementary Table 1. Forward and reverse primers used in PCR amplification and cycle sequencing for individual loci used in this study. Locus Forward primer (5-3 ) Reverse primer (5-3 ) 16S TTATTCACCTGTTTATCAAAACAT TATAGATAGAAACCAATCT CO1 ATAATTTTTTTTATAGTTATAC GGAAAAAAAGTTATATTAACWC ArgK GACAGCAARTCTCTGCTGAAGAA GGTYTTGGCATCGTTGTGGTAGATAC EF1-α (short) GYATCGACAARCGTACSATYG ACRGCVACKGTYTGHCKCATGTC EF1-α (long) GGGYAAAGGWTCCTTCAARTATGC AATCAGCACCTTTAGGTGG Pol-II AAYAARCCVGTYATGGGTATTGTRCA AGRTANGARTTCTCRACGAATCCTCT Supplementary Table 2. Best-fit models of sequence evolution used for each locus in Bayesian phylogenetic analyses. Likelihood Ratio Tests (LRT) between nested models of sequence evolution were implemented to determine the best-fit model in the software package Modeltest v3.7 Locus Model test (hlrt) Number of parsimonyinformative sites (bp) 16S TVM+I+G 1 CO1 GTR+I+G 423 ArgK TrN+G 79 EF1-α (coding) EF1-α (intron) TrN+G HKY+G 412 Pol-II TrN+I+G 182
2 Supplementary Table 3. Collection data, taxonomic information, and voucher GenBank accession numbers for specimens and sequences used in the present study. ID# Voucher Taxon Country Collector Date 16S CO1 Ef1-alpha ArgK RNApol-2 EU53a TA321 Aglae caerulea Colombia Ramírez Apr EU EU EU EU EU Apis MP145 outg37 andreniformis China Roubik EU EU EU EU EU MP110 outg10 Apis cerana Thailand Roubik EU EU EU EU EU MP112 outg12 Apis cerana Thailand Roubik EU EU EU EU EU MP140 Apis cerana Thailand EU EU EU EU MP111 outg11 Apis dorsata Thailand Roubik EU EU EU EU EU MP143 outg35 Apis florea China Roubik EU EU EU EU EU MP113 outg13 Apis koschevnikovi Thailand Roubik EU EU EU EU EU MP114 outg14 Apis koschevnikovi Thailand Roubik EU EU EU EU EU MP147 Apis mellifera USA AF AY AF NM DQ Bombus MP146 SR2066 transversalis Peru Ramirez EU EU EU EU EU MP138 Outg34 Bombus vagans USA Ramirez EU EU EU EU EU MP124 outg24 Centris sp. Colombia Ramirez EU EU EU EU MP106 outg7 Cephalotrigona zexmeniae Panama Nieh Aug-26- EU EU EU EU EU MP89 SR2119 Cephalotrigona sp. Ecuador Ramirez Apr-8-05 EU1625 EU EU EU EU MP125 outg25 Epicharis sp. Colombia Ramirez EU EU EU EU Eu SR6 Eufriesea caerulescens Mexico Ramírez Jul EU EU EU EU EU15b CS84 Euglossa asarophora Costa Rica Skov Aug EU EU EU EU Euglossa EU22c SR346 decorata (dark) Colombia Ramírez Jan EU EU EU EU EU8 CS155 Euglossa mixta Costa Rica Skov Aug EU EU EU EU70 Yurr 912 Euglossa villosa Guatemala Ramirez Sep EU EU EU EU Eulaema EU54 SK02 peruviana Peru Skov Apr-1-03 EU1631 EU EU EU71 male#1 Exaerete azteca Mexico Skov Jul EU EU EU EU EU
3 MP107 MP108 MP118 MP115 outg8 outg9 outg18 outg15 MP MP94 SR1960 Friesella schrottkyi Brazil Nieh Aug EU EU EU EU EU Frieseomelitta silvestrii Brazil Nieh Aug EU EU EU EU EU Geotrigona kraussi Panama Roubik 94 EU EU EU EU Lestrimelitta danuncia Panama Roubik 92 EU EU EU EU EU aff. costaricaensis Panama Roubik Jan-Feb 00 EU EU EU EU EU amazonica Perú Ramirez Mar-4-05 EU EU EU EU MP asilvae Brazil Nieh Aug EU1621 EU EU EU EU MP beecheii Mexico Roubik Feb- EU EU EU EU EU MP bicolor bicolor Brazil Nieh Aug EU1622 EU EU EU EU MP captiosa 00 EU EU EU EU EU1628 MP compressipes compressipes Brazil Camargo et al Jun-2-00 EU EU EU EU EU MP compressipes interrupta Apr-94 EU EU EU EU EU MP compressipes interrupta 00 EU EU EU EU EU1628 MP14 84 costaricaensis Costa Rica Roubik Sep-12- EU EU EU EU EU MP costaricaensis Panama Roubik Mar-97 EU EU EU EU EU MP aff. crinita Panama Roubik Jan-Feb 00 EU EU EU EU EU MP92 SR1622 aff. crinita Perú Ramirez Mar-3-05 EU1629 EU EU EU EU MP13 81 fallax Costa Rica Roubik Sep-12- EU EU EU EU EU1628 MP favosa May-94 EU EU EU EU EU MP fuliginosa 00 EU EU EU EU EU MP15 95 fulva May-94 EU EU EU EU EU
4 MP fuscopilosa Brazil Camargo et al Jun-2-00 EU EU EU EU EU MP128 R16 grandis Peru Ramirez EU EU EU EU EU MP grandis Ecuador Roubik Nov- EU EU EU EU EU MP97 SR12 grandis Perú Ramirez Mar EU EU EU EU EU MP95 SR2118 illota Ecuador Ramirez Apr-3-05 EU EU EU EU EU MP46 illustris Brazil Jul- EU EU EU EU EU MP lateralis 00 EU EU EU EU EU MP mandacaia Brazil Nieh Aug-7-00 EU1620 EU EU EU EU MP marginata Brazil Nieh Aug-8-00 EU1627 EU EU EU EU MP12 77 melanopleura Costa Rica Roubik Sep-12- EU EU EU EU EU MP melanoventer Brazil Roubik Feb EU EU EU EU EU MP micheneri Panama Nieh Jul-00 EU EU EU EU EU MP SMR0036 n. sp. Colombia Madriñan May EU EU EU EU EU MP nebulosa Ecuador Roubik Nov EU1620 EU EU EU MP ogliviei 00 EU1629 EU EU EU EU MP1 1 panamica Panama Nieh Aug-7- EU EU EU EU EU MP quadrifasciata anthidioides Brazil Roubik Oct- EU EU EU EU EU MP quadrifasciata anthidioides Brazil Nieh 8-Aug-00 EU1624 EU EU EU EU MP quinquefasciata Brazil Nieh Aug EU1629 EU EU EU1630 EU MP rufiventris Ecuador Roubik Nov- EU EU EU EU EU MP rufiventris flavolineata Brazil Venturieri Jan-00 EU1621 EU EU EU EU MP rufiventris flavolineata Bolivia Boni 2-Oct-02 EU1623 EU EU EU EU
5 MP MP MP rufiventris rufiventris Brazil Nieh 8-Aug-00 EU1625 EU EU EU EU scutellaris Brazil Nieh 8-Aug-00 EU1626 EU EU EU EU seminigra Camargo atrofulva Brazil et al Jun-2-00 EU EU EU EU EU MP solani Mexico Nieh Mar-1-02 EU1624 EU EU EU EU MP127 T3W2 sp. Costa Rica Archibald EU EU EU EU EU MP93 SR1780 sp. Perú Ramirez Mar EU1629 EU EU EU EU MP sp. Peru Rarioet 1-Nov-01 EU1622 EU EU EU EU MP sp. Colombia Arias Mar EU1623 EU EU EU EU MP90 SR1977 sp. Ecuador Ramirez Mar EU1626 EU EU EU EU MP96 SR2120 sp. (male) Ecuador Ramirez Apr EU EU EU EU EU MP91 SR1976 sp. (queen) Ecuador Ramirez Mar EU1627 EU EU EU EU MP triplaridis Panama Nieh Aug-28- EU1628 EU EU EU EU MP129 outg29 Meliponula bocandei Kenya Martins May EU EU EU EU EU MP123 outg23 Meliwillea bivea Panama Roubik Mar EU EU1631 EU EU MP104 outg5 Nannotrigona perilampoides Panama Nieh Aug-28- EU EU163 EU EU EU MP120 outg20 Nogueirapis mirandula Panama Roubik 94 EU EU1631 EU EU MP101 outg2 Plebeia franklii Panama Nieh Aug-28- EU EU1630 EU EU EU MP105 outg6 Scaptotrigona polysticta Brazil Nieh Aug EU EU EU EU EU MP102 outg3 Scaptotrigona barrocoloradensis Panama Nieh Aug-28- EU EU1630 EU EU EU MP103 outg4 Scaptotrigona barrocoloradensis Panama Nieh Aug-28- EU EU EU EU MP outg1 Tetragona angustula Panama Nieh Aug-28- EU EU EU EU EU MP109 SR2086 Trigona sp. Ecuador Ramirez Mar EU EU EU EU EU
6 Supplementary Figure 1. Bayesian phylogenetic trees estimated with (a) a single model of nucleotide substitution (GTR+Γ+I) and (b) partitioned models of sequence evolution for each locus. Phylogenies were estimated in the software package MrBayes v Posterior probabilities correspond to node frequencies obtained using a 50% majority-rule consensus. Supplementary Figure 2. Bayesian phylogenetic trees estimated with partitioned models of sequence evolution by codons, where first, second and third position were estimated separately. The phylogeny was estimated in the software package MrBayes v Posterior probabilities correspond to tree frequencies obtained using a 50% majority-rule consensus. Supplementary Figure 3. Cross-validation test to identify inconsistent fossil calibrations (Near et al., 2005). (a) Histogram of mean age deviation (Dx) of calibrated nodes showing difference between molecular and fossil ages. (b) Sum of the squared differences (Dx) between fossil ages and molecular ages. (c) Effect of removing individual fossil calibration on the average squared deviation of all five fossil calibrations; none of the changes in square deviation were statistically significant based on a onetailed F-test.
7 Supplementary Figure 1 A melanopleura MP12 M. costaricensis MP14 M. panamica MP1 M. sp. (male) MP127 M. solani MP86 M. sp. (male) MP96 M. aff. costaricensis MP33 M. sp. (queen) MP91 M. rufiventris MP24 M. sp. (eburnea group) MP93 M. scutellaris MP78 M. seminigra atrofulva MP38 M. sp (eburnea group) MP85 M. sp (M de Dios) MP70 M. eburnea fuscopilosa MP35 M. panamica costaricaensis MP21 M. fulva MP15 M. lateralis MP45 M. flavolineata MP49 M. sp. (crinita group) MP90 M. nebulosa MP48 M. crinita MP32 M. illota MP95 M. ogliviei MP41 M. rufiventris rufiventris MP77 M. flavolineata MP72 M. crinita MP92 M. melanoventer MP34 M. captiosa MP43 M. fuliginosa MP13 M. fuliginosa MP42 M. bicolor bicolor MP83 M. marginata MP79 M. amazonica MP94 M. sp. MP19 M. interrupta MP20 M. interrupta MP44 M. compressipes MP37 M. grandis MP22 M. compressipes aff. MP97 M. grandis MP128 M. aff. compressipes MP8.1 M. quinquefasciata MP80 M. beecheii MP18 M. illustris MP46a M. michineri MP39 M. quadrifasciata anth. MP23 M. quadrifasciata anth. MP76 M. favosa MP M. mandaçaia MP81 M. asilvae MP82 Cephalotrigona zexmeniae Cephalotrigona sp. Geotrigona kraussi Trigona sp. Scaptotrigona barrocoloradensis Scaptotrigona barrocoloradensis Scaptotrigona polysticta Plebeia franki Friesella schrotkyii Frieseomelitta silvestrii Lestrimelitta sp. Tetragonisca angustula Nannotrigona perilampoides Nogueirapis mirandula Meliwillea bivea Meliponula bocandei Bombus vagans B. transversalis Apis cerana A. cerana A. cerana Apis S. str. A. koschevnikovi A. koschevnikovi A. mellifera A. dorsata Megapis A. andreniformis A. florea Micrapis Euglossa decorata E. villosa E. asarophora E. mixta Eufriesea caerulescens Eulaema peruviana Aglae caerulea Exaerete azteca Centris sp. Epicharis sp. Michmelia Melikerria s. str. Insertae sedis Neotropical Meliponini Meliponini Bombini Apini Euglossini outgroups B 61
8 Supplementary figure melanopleura MP12 M. costaricensis MP14 M. sp. (male) MP127 M. panamica MP1 M. solani MP86 M. sp. (male) MP96 M. aff. costaricensis MP33 M. sp. (queen) MP91 M. rufiventris MP24 M. sp. (eburnea group) MP93 M. lateralis MP45 M. scutellaris MP78 M. seminigra atrofulva MP38 M. sp (M de Dios) MP70 M. sp (eburnea group) MP85 M. fuscopilosa MP35 M. aff. costaricaensis MP21 M. fulva MP15 M. crinita MP32 M. illota MP95 M. ogliviei MP41 M. flavolineata MP49 M. sp. (crinita group) MP90 M. nebulosa MP48 M. crinita MP92 M. melanoventer MP34 M. rufiventris rufiventris MP77 M. flavolineata MP72 M. captiosa MP43 M. fallax MP13 M. fuliginosa MP42 M. bicolor MP83 M. marginata MP79 M. amazonica MP94 M. favosa favosa MP19 M. interrupta MP20 M. interrupta MP44 M. compressipes MP37 M. grandis MP22 M. grandis MP97 M. grandis MP128 M. triplaridis MP8.1 M. quinquefasciata MP80 M. beecheii MP18 M. illustris MP46a M. micheneri MP39 M. quadrifasciata anth. MP23 M. quadrifasciata anth. MP76 M. n. sp. MP M. mandaçaia MP81 M. asilvae MP82 Cephalotrigona zexmeniae Cephalotrigona sp. Trigona sp. Geotrigona kraussi Scaptotrigona barrocoloradensis Scaptotrigona barrocoloradensis Scaptotrigona polysticta Plebeia franki Friesella schrotkyii Frieseomelitta silvestrii Lestrimelitta sp. Tetragonisca angustula Nannotrigona perilampoides Nogueirapis mirandula Meliwillea bivea Meliponula bocandei Bombus vagans Bombus transversalis Apis cerana A. cerana A. cerana A. koschevnikovi A. koschevnikovi A. mellifera A. dorsata A. andreniformis A. florea Euglossa asarophora Euglossa mixta Euglossa villosa Euglossa decorata Aglae caerulea Eufriesea caerulescens Eulaema peruviana Exaerete azteca Centris sp. Epicharis sp. Meliponini Bombini Apini Euglossini outgroups
9 Supplementary Figure 3 40 A Dx A Maximum constraint Cretotrigona prisca B Proplebeia E D Apis lithohermaea C Euglossa moronei B SSx A Maximum constraint B E D Cretotrigona Proplebeia Apis prisca spp. lithohermaea C Euglossa moronei C S All A B D
AT&T Global Network Client for Windows Product Support Matrix January 29, 2015
AT&T Global Network Client for Windows Product Support Matrix January 29, 2015 Product Support Matrix Following is the Product Support Matrix for the AT&T Global Network Client. See the AT&T Global Network
COMPARISON OF FIXED & VARIABLE RATES (25 YEARS) CHARTERED BANK ADMINISTERED INTEREST RATES - PRIME BUSINESS*
COMPARISON OF FIXED & VARIABLE RATES (25 YEARS) 2 Fixed Rates Variable Rates FIXED RATES OF THE PAST 25 YEARS AVERAGE RESIDENTIAL MORTGAGE LENDING RATE - 5 YEAR* (Per cent) Year Jan Feb Mar Apr May Jun
COMPARISON OF FIXED & VARIABLE RATES (25 YEARS) CHARTERED BANK ADMINISTERED INTEREST RATES - PRIME BUSINESS*
COMPARISON OF FIXED & VARIABLE RATES (25 YEARS) 2 Fixed Rates Variable Rates FIXED RATES OF THE PAST 25 YEARS AVERAGE RESIDENTIAL MORTGAGE LENDING RATE - 5 YEAR* (Per cent) Year Jan Feb Mar Apr May Jun
Case 2:08-cv-02463-ABC-E Document 1-4 Filed 04/15/2008 Page 1 of 138. Exhibit 8
Case 2:08-cv-02463-ABC-E Document 1-4 Filed 04/15/2008 Page 1 of 138 Exhibit 8 Case 2:08-cv-02463-ABC-E Document 1-4 Filed 04/15/2008 Page 2 of 138 Domain Name: CELLULARVERISON.COM Updated Date: 12-dec-2007
Analysis One Code Desc. Transaction Amount. Fiscal Period
Analysis One Code Desc Transaction Amount Fiscal Period 57.63 Oct-12 12.13 Oct-12-38.90 Oct-12-773.00 Oct-12-800.00 Oct-12-187.00 Oct-12-82.00 Oct-12-82.00 Oct-12-110.00 Oct-12-1115.25 Oct-12-71.00 Oct-12-41.00
Enhanced Vessel Traffic Management System Booking Slots Available and Vessels Booked per Day From 12-JAN-2016 To 30-JUN-2017
From -JAN- To -JUN- -JAN- VIRP Page Period Period Period -JAN- 8 -JAN- 8 9 -JAN- 8 8 -JAN- -JAN- -JAN- 8-JAN- 9-JAN- -JAN- -JAN- -JAN- -JAN- -JAN- -JAN- -JAN- -JAN- 8-JAN- 9-JAN- -JAN- -JAN- -FEB- : days
Ashley Institute of Training Schedule of VET Tuition Fees 2015
Ashley Institute of Training Schedule of VET Fees Year of Study Group ID:DECE15G1 Total Course Fees $ 12,000 29-Aug- 17-Oct- 50 14-Sep- 0.167 blended various $2,000 CHC02 Best practice 24-Oct- 12-Dec-
P r i c e s. E U B a l a n c e. Pref. Imports World Balance. S t o c k. T r a d e. D G A G R I D A S H B O A R D : S U G A R Last update: 29.01.
P r i c e s E U B a l a n c e S t o c k T r a d e D G A G R I D A S H B O A R D : S U G A R Last update: 29.1.216 Jan-8 Jul-8 1 4 7 1 13 16 19 22 25 28 31 34 37 4 43 46 49 52 Jan-9 Jul-9 Jan-1 Jul-1 Jan-11
Meliponas in Yucatan, Mexico. Luis Medina Medina Department of Apiculture Faculty of Veterinary Medicine University Autonomous of Yucatan
Meliponas in Yucatan, Mexico Luis Medina Medina Department of Apiculture Faculty of Veterinary Medicine University Autonomous of Yucatan Before A. mellifera introduction = ethnic groups in the Americas
CENTERPOINT ENERGY TEXARKANA SERVICE AREA GAS SUPPLY RATE (GSR) JULY 2015. Small Commercial Service (SCS-1) GSR
JULY 2015 Area (RS-1) GSR GSR (LCS-1) Texarkana Incorporated July-15 $0.50690/Ccf $0.45450/Ccf $0.00000/Ccf $2.85090/MMBtu $17.52070/MMBtu Texarkana Unincorporated July-15 $0.56370/Ccf $0.26110/Ccf $1.66900/Ccf
2015-16 BCOE Payroll Calendar. Monday Tuesday Wednesday Thursday Friday Jun 29 30 Jul 1 2 3. Full Force Calc
July 2015 CM Period 1501075 July 2015 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 August 2015 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
UNHCR, United Nations High Commissioner for Refugees
Belgium 22 Jul 1953 r 08 Apr 1969 a Belize 27 Jun 1990 a 27 Jun 1990 a Benin 04 Apr 1962 s 06 Jul 1970 a Bolivia 09 Feb 1982 a 09 Feb 1982 a Bosnia and Herzegovina 01 Sep 1993 s 01 Sep 1993 s Botswana
CAFIS REPORT 2015.10
CAFIS REPORT 2015.10 INDEX Message CAFIS Inbound 03-06 07-08 CAFIS Arch 09-10 CAFIS Brain 11-12 CAFIS Global 13-14 What We Do 15-16 About CAFIS 17-18 Services for Member Stores 19-34 Services for Card
Consumer ID Theft Total Costs
Billions Consumer and Business Identity Theft Statistics Business identity (ID) theft is a growing crime and is a growing concern for state filing offices. Similar to consumer ID theft, after initially
Evaluation of Inquiries about the UIS Environmental Studies Online Master s Degree Program
Evaluation of Inquiries about the UIS Environmental Studies Online Master s Degree Program Lenore Killam Hung-Lung Wei Dennis R. Ruez, Jr. University of Illinois at Springfield Introduction The Department
P/T 2B: 2 nd Half of Term (8 weeks) Start: 25-AUG-2014 End: 19-OCT-2014 Start: 20-OCT-2014 End: 14-DEC-2014
2014-2015 SPECIAL TERM ACADEMIC CALENDAR FOR SCRANTON EDUCATION ONLINE (SEOL), MBA ONLINE, HUMAN RESOURCES ONLINE, NURSE ANESTHESIA and ERP PROGRAMS SPECIAL FALL 2014 TERM Key: P/T = Part of Term P/T Description
P/T 2B: 2 nd Half of Term (8 weeks) Start: 26-AUG-2013 End: 20-OCT-2013 Start: 21-OCT-2013 End: 15-DEC-2013
2013-2014 SPECIAL TERM ACADEMIC CALENDAR FOR SCRANTON EDUCATION ONLINE (SEOL), MBA ONLINE, HUMAN RESOURCES ONLINE, NURSE ANESTHESIA and ERP PROGRAMS SPECIAL FALL 2013 TERM Key: P/T = Part of Term P/T Description
P/T 2B: 2 nd Half of Term (8 weeks) Start: 24-AUG-2015 End: 18-OCT-2015 Start: 19-OCT-2015 End: 13-DEC-2015
2015-2016 SPECIAL TERM ACADEMIC CALENDAR For Scranton Education Online (SEOL), Masters of Business Administration Online, Masters of Accountancy Online, Health Administration Online, Health Informatics
Qi Liu Rutgers Business School ISACA New York 2013
Qi Liu Rutgers Business School ISACA New York 2013 1 What is Audit Analytics The use of data analysis technology in Auditing. Audit analytics is the process of identifying, gathering, validating, analyzing,
Computing & Telecommunications Services Monthly Report March 2015
March 215 Monthly Report Computing & Telecommunications Services Monthly Report March 215 CaTS Help Desk (937) 775-4827 1-888-775-4827 25 Library Annex helpdesk@wright.edu www.wright.edu/cats/ Last Modified
States Parties to the 1951 Convention relating to the Status of Refugees and the 1967 Protocol
States Parties to the 1951 Convention relating to the Status of Refugees and the 1967 Protocol Date of entry into force: 22 April 1954 (Convention) 4 October 1967 (Protocol) As of 1 October 2008 Total
a. mean b. interquartile range c. range d. median
3. Since 4. The HOMEWORK 3 Due: Feb.3 1. A set of data are put in numerical order, and a statistic is calculated that divides the data set into two equal parts with one part below it and the other part
Bayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
Institutions Type Activity
Sıra Recipient Party Description Contributing Party Institutions Type Activity Amount (millions) Currency Report Implementation Period 1 Turkey The training for optimal power generation for peak demand
Comparing share-price performance of a stock
Comparing share-price performance of a stock A How-to write-up by Pamela Peterson Drake Analysis of relative stock performance is challenging because stocks trade at different prices, indices are calculated
Interest Rates. Countrywide Building Society. Savings Growth Data Sheet. Gross (% per annum)
Interest Rates (% per annum) Countrywide Building Society This is the rate of simple interest earned in a year (before deducting tax). Dividing by 12 gives the monthly rate of interest. Annual Equivalent
Detailed guidance for employers
April 2015 3 Detailed guidance for employers Appendix A: Pay reference periods This document accompanies: Detailed guidance no. 3 Assessing the workforce Pay reference period calendars where the definition
2013-2014. oct 03 / 2013 nov 12 / 2013. oct 05 / 2013. oct 07 / 2013. oct 21 / 2013. oct 24 / 2013. nov 07 / 2013 nov 14 / 2013.
2013- ACADEMIC CALENDARS SOUTH UNIVERSITY 2013- ACADEMIC CALENDAR Fall 2013 Winter Spring Summer New Student Orientation Session II (Mid ) oct 03 / 2013 nov 12 / 2013 jan 09 / feb 18 / apr 03 / may 13
Accident & Emergency Department Clinical Quality Indicators
Overview This dashboard presents our performance in the new A&E clinical quality indicators. These 8 indicators will allow you to see the quality of care being delivered by our A&E department, and reflect
Data Partitions and Complex Models in Bayesian Analysis: The Phylogeny of Gymnophthalmid Lizards
Syst. Biol. 53(3):448 469, 2004 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150490445797 Data Partitions and Complex Models in Bayesian Analysis:
ACCESS Nursing Programs Session 1 Center Valley Campus Only 8 Weeks Academic Calendar 8 Weeks
Session 1 Academic Calendar August 24, 2015 to October 17, 2015 Tuesday / Thursday, 5:30 pm to 8:30 pm M/W T/TH T/W TH S Saturday lab as scheduled Classes Begin 24-Aug 25-Aug 25-Aug 27-Aug 29-Aug NU205
ACCESS Nursing Programs Session 1 Center Valley Campus Only 8 Weeks Academic Calendar 8 Weeks
Session 1 Academic Calendar August 24, 2015 to October 17, 2015 Tuesday / Thursday, 5:30 pm to 8:30 pm M/W T/TH T/W TH S Saturday lab as scheduled Classes Begin 24-Aug 25-Aug 25-Aug 27-Aug 29-Aug NU205
Agenda. The generation matrix in SING
Agenda 2 Pontificia Universidad Católica de Chile March 27th, 7 Santiago de Chile Evolution of the electricity offerdemand equilibrium The generation matrix in SING 3 Example of the dispatch order with
A!Team!Cymru!EIS!Report:!Growing!Exploitation!of!Small! OfCice!Routers!Creating!Serious!Risks!
ATeamCymruEISReport:GrowingExploitationofSmall OfCiceRoutersCreatingSeriousRisks PoweredbyTeamCymru sthreatintelligencegroup Page 1of 14www.team-cymru.com www.team-cymru.com Threat'Intelligence'Group EXECUTIVE
2016 Examina on dates
Please note the following informa on: The following exams are available throughout the year: Please click on the exam for which you wish to see the dates. When you have finished, you can select to return
2015 Examination dates
Please note the following information: The following exams are available throughout the year: BULATS Paper-based: Please click on the exam for which you wish to see the dates. When you have finished, you
PROJECTS SCHEDULING AND COST CONTROLS
Professional Development Day September 27th, 2014 PROJECTS SCHEDULING AND COST CONTROLS Why do we need to Control Time and Cost? Plans are nothing; Planning is everything. Dwight D. Eisenhower Back to
Insurance and Banking Subcommittee
Insurance and Banking Subcommittee Citizens Depopulation Update September 16, 2015 Christine Ashburn VP Communications, Legislative and External Affairs 2 3 Depopulation Customer Communications 1. 40 days
State Annual Report Due Dates for Business Entities page 1 of 10
State Annual Report Due Dates for Business Entities page 1 of 10 If you form a formal business entity with the state, you may be required to file periodic reports on the status of your entity to preserve
Implementing Carbon Reduction Without Impacting Working Capital. Presented by Dylan Crompton
Implementing Carbon Reduction Without Impacting Working Capital Presented by Dylan Crompton Evolution of a Carbon Strategy Proactive organisations are on a journey to reduce carbon emissions. Marginal
MONTHLY COFFEE MARKET REPORT
E MONTHLY COFFEE MARKET REPORT March 2013 Coffee prices stabilized in March 2013, with the monthly average of the ICO composite indicator price essentially unchanged on the previous month. Contrasting
FY 2015 Schedule at a Glance
Coaching and Mentoring for Excellence Oct 21 23, 2014 $2,950 Residential Coaching and Mentoring for Excellence Apr 7 9, 2015 $2,400 Non-residential Coaching and Mentoring for Excellence May 27 29, 2015
Time Management II. http://lbgeeks.com/gitc/pmtime.php. June 5, 2008. Copyright 2008, Jason Paul Kazarian. All rights reserved.
Time Management II http://lbgeeks.com/gitc/pmtime.php June 5, 2008 Copyright 2008, Jason Paul Kazarian. All rights reserved. Page 1 Outline Scheduling Methods Finding the Critical Path Scheduling Documentation
Sage ERP MAS 90, 200, 200 SQL, and Sage ERP MAS 500. Supported Versions
Sage ERP MAS 90, 200, 200 SQL, and Sage ERP MAS 500 Supported Versions Current Document: 2012... Page 1 Earlier Documents: 2011... Page 2 2010... Page 3 2009... Page 4 2008... Page 5 Sage ERP MAS 90, 200,
Climatography of the United States No. 20 1971-2000
Climate Division: CA 4 NWS Call Sign: Month (1) Min (2) Month(1) Extremes Lowest (2) Temperature ( F) Lowest Month(1) Degree s (1) Base Temp 65 Heating Cooling 1 Number of s (3) Jan 59.3 41.7 5.5 79 1962
Yield Reduction due to Shading:
1x4 1x16 10 x CBC Energy A/S x Danfoss Solar Inverters CBC-40W Poly 40 W TLX 1,5k 5 ; 1x11 3x4 0 1,5kW 1536 x CBC Energy A/S 1 x Power-One CBC-40W Poly 40 W TRIO-7,6-TL-OUTD 30 ; 4x14 0 7,6kW Location:
Milk Market Situation. Brussels, 27 August 2015
Milk Market Situation Brussels, 27 August EU Productions EU Productions (Jan-Jun compared to Jan-Jun 214) +,8% + 1,2% + 3,2% +,2% +,7% - 2,% - 3,1% -,1% - 11,1%!!! Data from some Member States are confidential
Climatography of the United States No. 20 1971-2000
Climate Division: CA 6 NWS Call Sign: SAN Month (1) Min (2) Month(1) Extremes Lowest (2) Temperature ( F) Lowest Month(1) Degree s (1) Base Temp 65 Heating Cooling 100 Number of s (3) Jan 65.8 49.7 57.8
Coffee year 2014/15 ends with prices at 20-month low
Coffee year 2014/15 ends with prices at 20-month low The coffee market slumped further in September, following a slight rally in August, with the weakness of the real and peso again proving the most influential
EMERGING MARKET CURRENCY PAIRS CURRENCY GUIDE
EMERGING MARKET CURRENCY PAIRS CURRENCY GUIDE /MXN /Mexico 14.597/12.548 168.8 14.5500 14.2500 13.9500 13.7000 13.4000 13.1000 12.7767 JAN 9 FEB 28 APR 21 JUN 11 JUL 30 SEP 18 NOV 7 12.5500 The /MXN is
Independent Accountants Report on Applying Agreed-Upon Procedures
Independent Accountants Report on Applying Agreed-Upon Procedures Board of Trustees We have performed the procedures, as discussed below, with respect to the employer contributions remitted by to the in
Japan Export Air. International Air Freight Fuel Surcharge. All Destinations
Japan Export Air July 28, 2016 International Air Freight Fuel Surcharge Carrier 3K Jet Star Asia Airways 66 1-Jan-15 Taiwan, Philippines 48 1-Jan-15 5C C.A.L. Cargo 130 1-Oct-12 China, Hong Kong, Korea,
Academic Calendar 2015-2018 Arkansas State University - Jonesboro
Shared Governance Proposal Any constituent (individual or group) may submit a proposal into the shared governance process. In order to be considered, each proposal must contain the following and be directed
Supervisor Instructions for Approving Web Time Entry
Supervisor Instructions for Approving Web Time Entry Time Approval Deadlines by Category Local 2110 Members members submit time by NOON on Monday of the pay week. Time should be approved no later than
Proposal to Reduce Opening Hours at the Revenues & Benefits Coventry Call Centre
Proposal to Reduce Opening Hours at the Revenues & Benefits Coventry Call Centre Proposal To change the opening hours of the Revenues & Benefits Call Centre to 9am until 5pm Monday to Friday with effect
Grupo PRISA Overview An integrated media and education company
October, 2013 Disclaimer In addition to figures prepared in accordance with IFRS, PRISA presents non-gaap financial performance measures, e.g., EBITDA, EBITDA margin, adjusted EBITDA, adjusted EBITDA margin,
Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro
Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information.
Choosing a Cell Phone Plan-Verizon
Choosing a Cell Phone Plan-Verizon Investigating Linear Equations I n 2008, Verizon offered the following cell phone plans to consumers. (Source: www.verizon.com) Verizon: Nationwide Basic Monthly Anytime
2015 U.S. ETHANOL EXPORTS AND IMPORTS STATISTICAL SUMMARY
2015 U.S. ETHANOL EXPORTS AND IMPORTS STATISTICAL SUMMARY Copyright 2016 Renewable Fuels Association. All Rights Reserved Million Gallons Million Gallons 2015 U.S. ETHANOL EXPORTS U.S. Ethanol Exports,
Employers Compliance with the Health Insurance Act Annual Report 2015
Employers Compliance with the Health Insurance Act Annual Report 2015 ea Health Council Health Council: Employers Compliance with the Health Insurance Act 1970 Annual Report 2015 Contact us: If you would
Stingless bee nesting biology
Stingless bee nesting biology David W. Roubik To cite this version: David W. Roubik. Stingless bee nesting biology. Apidologie, Springer Verlag, 2006, 37 (2), pp.124-143. HAL Id: hal-00892207
2015 Settlement Calendar for ASX Cash Market Products ¹ Published by ASX Settlement Pty Limited A.B.N 49 008 504 532
2015 Calendar for ASX Cash Market Products ¹ Published by ASX Pty Limited A.B.N 49 008 504 532 Calendar for ASX Cash Market Products¹ ASX Pty Limited (ASX ) operates a trade date plus three Business (T+3)
Global Equity Trading Volumes Surge 36% in 1 st half 2015 driven by Mainland China
Global Equity Trading Volumes Surge 36% in 1 st half 215 driven by Mainland China Global Equity Trading Volumes Ex Mainland China Up 5% Mainland China Share Trading Vols Rise 166% in H1 215 vs H2 214 The
NASDAQ DUBAI TRADING AND SETTLEMENT CALENDAR 2015. 1. On US Federal Reserve Holidays, no settlements will take place for USD.
NASDAQ Dubai Circular No. : 65/14 Date of Issue : December 22 nd 2014 Date of Expiry : Upon issue of replacement Circular NASDAQ DUBAI TRADING AND SETTLEMENT CALENDAR 2015 Issued pursuant to the NASDAQ
Illinois Job Index. Jan 2012 Negative. Talking Points. Illinois Notes. Nation Notes. www.real.illinois.edu
Illinois Job Index Release Data Issue 01/31/2011 Jan 1990 / Dec 2011 2012.01 www.real.illinois.edu For November Illinois Job Index, the state and the Nation had positive job growth, the RMW had negative
Department of Public Welfare (DPW)
Department of Public Welfare (DPW) Office of Income Maintenance Electronic Benefits Transfer Card Risk Management Report Out-of-State Residency Review FISCAL YEAR 2012-2013 June 2013 (March, April and
NATIONAL CREDIT UNION SHARE INSURANCE FUND
NATIONAL CREDIT UNION SHARE INSURANCE FUND PRELIMINARY & UNAUDITED FINANCIAL HIGHLIGHTS RENDELL L. JONES CHIEF FINANCIAL OFFICER MANAGEMENT OVERVIEW Balance Sheet Other - Insurance and Guarantee Program
Roles: Scrum Master & Project Manager
Roles: Scrum Master & Project Manager Scrum Master: Facilitate collaborative meetings Track team performance Remove impediments (Risk, Issue) Validate team alignment to Agile framework and scope Drive
The New Workers Compensation Experience Mod. Billy Smith EVP, Risk Management Pete Bellnier, Sr. Underwriter, Workers Compensation
The New Workers Compensation Experience Mod Billy Smith EVP, Risk Management Pete Bellnier, Sr. Underwriter, Workers Compensation 1 Why is There an E-Mod? Industry Standard Individual Employer s Published
Coffee prices fall to 18-month low as supply concerns fade
Coffee prices fall to 18-month low as supply concerns fade The coffee market registered further decreases in July with prices reacting to the depreciation in the Brazilian exchange rate, which dropped
Banco Santander Chile: Solid results in 2Q14. Sound outlook for 2015
0 Banco Santander : Solid results in 2Q14. Sound outlook for 2015 August 2014 Important information 1 Banco Santander caution that this presentation contains forward looking statements within the meaning
1. Introduction. 2. User Instructions. 2.1 Set-up
1. Introduction The Lead Generation Plan & Budget Template allows the user to quickly generate a Lead Generation Plan and Budget. Up to 10 Lead Generation Categories, typically email, telemarketing, advertising,
How To Understand The Third Platform Ct Market Transformation In Latin America
Latin America 4 Pillars of the Third Platform Continuous Information Series Value Proposition June 2014 International Data Corporation (IDC) is the premier global provider of market intelligence, advisory
5-Minute Primer for Commercial Building Energy Audits
5-Minute Primer for Commercial Building Energy Audits Why Energy Audits? Because an energy audit is the first step to saving energy at your facility. Putting together an energy project can be like finding
The Central Role of Energy Efficiency in the Energy Outlook and EIA s Energy Data Program
The Central Role of Energy Efficiency in the Energy Outlook and EIA s Energy Data Program For MIT Energy Initiative Symposium May 12, 2014 Cambridge, MA By Howard Gruenspecht, Deputy Administrator U.S.
OMBU ENTERPRISES, LLC. Process Metrics. 3 Forest Ave. Swanzey, NH 03446 Phone: 603-209-0600 Fax: 603-358-3083 E-mail: OmbuEnterprises@msn.
OMBU ENTERPRISES, LLC 3 Forest Ave. Swanzey, NH 03446 Phone: 603-209-0600 Fax: 603-358-3083 E-mail: OmbuEnterprises@msn.com Process Metrics Metrics tell the Process Owner how the process is operating.
Request under the Freedom of Information Act 2000 (FOIA)
Our Ref: 006683/12 Freedom of Information Section Nottinghamshire Police HQ Sherwood Lodge, Arnold Nottingham NG5 8PP 11 December 2012 Tel: 101 Ext 800 2507 Fax: 0115 967 2896 Request under the Freedom
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Resource Management Spreadsheet Capabilities. Stuart Dixon Resource Manager
Resource Management Spreadsheet Capabilities Stuart Dixon Resource Manager Purpose Single view of resource data Shows rolling demand vs supply for 14 months, 2 months back, current month, and 11 forward
Request under the Freedom of Information Act 2000 (FOIA)
Our Ref: 005792/13 Freedom of Information Section Nottinghamshire Police HQ Sherwood Lodge, Arnold Nottingham NG5 8PP 8 July 2013 Tel: 101 Ext 800 2507 Fax: 0115 967 2896 Request under the Freedom of Information
ACTIVE MICROSOFT CERTIFICATIONS:
Last Activity Recorded : August 04, 2011 Microsoft Certification ID : 483228 KENT NORDSTROM Asbergsvagen 27 Soderhamn, 82637 SW kent@xpservices.se ACTIVE MICROSOFT CERTIFICATIONS: Microsoft Certified Solutions
PTC Creo 2.0 Hardware Support Dell
PTC Creo 2.0 Hardware Support Dell Last updated: February 2, 2016 The Desktop Virtualization Environment Support Dell table displays at the end of this document, after the standard Creo certification table.
Centers of Academic Excellence in Cyber Security (CAE-C) Knowledge Units Review
Centers of Academic Excellence in Cyber Security (CAE-C) Knowledge Units Review Review Process The Knowledge Unit (KU) Review Calendar divides the entire CAE-C KU list into 12 months for the purposes of
Equipping your Forecasting Toolkit to Account for Ongoing Changes
Equipping your Forecasting Toolkit to Account for Ongoing Changes Presented by: Roger Parlett Supply Chain Manager January 23, 2014 Overview Forecast Set-up Objectives of Creating a Forecast Identify Critical
Open access policies: What can we learn from Latin America? Roxana Barrantes Instituto de Estudios Peruanos
Open access policies: What can we learn from Latin America? Roxana Barrantes Instituto de Estudios Peruanos 8.00 GDP growth 1999 2009 (percetual variation) 6.00 4.00 2.00 0.00-2.00-4.00-6.00 1999 2000
Robeco High Yield Bonds
Important Information 1. Robeco High Yield Bonds (the Fund aims to provide long term capital growth. The Fund invests at least two thirds of its total assets in bonds, asset backed securities and similar
Industry Environment and Concepts for Forecasting 1
Table of Contents Industry Environment and Concepts for Forecasting 1 Forecasting Methods Overview...2 Multilevel Forecasting...3 Demand Forecasting...4 Integrating Information...5 Simplifying the Forecast...6
Working Holiday Maker visa programme report
Working Holiday Maker visa programme report 30 June 2015 This page is left blank intentionally. Table of Contents About this report 1 Enquiries 1 Definition of terms 2 Background to the Working Holiday
10th ANIVERSARY SULAMERICA INVESTIMENTOS
10th ANIVERSARY SULAMERICA INVESTIMENTOS AGENDA 1. Perú Macro Environment 2. The need for a Pension System Reform 3. The Private Pension System 4. AFP Integra 5. Multifondos 6. The Future 1 1. Peru - Macro
Human Resources Management System Pay Entry Calendar
Human Resources Management System Pay Entry Calendar http://www1.umn.edu/ohr/payroll/calendars/index.html Important Information The system is unavailable for entry, due to maintenance, during the following
Schedule of VET FEE-HELP Tuition Fees & Census Dates
Delivery Location Diploma of Beauty Therapy SIB50110 Face to face 87 Bay Street Glebe NSW 2037 Qualification articulates to Bachelor of Applied Health Science (Clinical Aesthetics) delivered by MHM Higher
Financial Operating Procedure: Budget Monitoring
Financial Operating Procedure: Budget Monitoring Original Created: Jan 2010 Last Updated: Jan 2010 1 Index 1 Scope of Procedure...3 2 Aim of Procedure...3 3 Roles & Responsibilities...3 Appendix A Timetable...7
Architectural Services Data Summary March 2011
Firms Typically Small in Size According to the latest U.S. Census Survey of Business Owners, majority of the firms under the description Architectural Services are less than 500 in staff size (99.78%).
EUROPHYT EU Notification System for Plant Health Interceptions An Introduction
EUROPHYT EU Notification System for Plant Health Interceptions An Introduction Andrew OWEN-GRIFFITHS Nandor PETE Unit F4 DG Health and Consumers Overview Background- Plant Health EUROPHYT- what is it,
Managing Projects with Practical Software & Systems Measurement PSM
Managing Projects with Practical Software & Systems Measurement PSM Mauricio Aguiar PSM Qualified Instructor TI Métricas Ltda. Av. Rio Branco 181/1910 Rio de Janeiro, RJ Brazil 20040-007 www.metricas.com.br
LSUF 24 th January 2006
Quality Control ISO 17025:2005 5.9 Assuring the quality of test and calibration results 5.9.1 The laboratory shall have quality control procedures for monitoring the validity of tests and calibrations
BS EN 16001 Energy Management Systems VICTORIA BARRON, PRODUCT MARKETING MANAGER, BSI
BS EN 16001 Energy Management Systems VICTORIA BARRON, PRODUCT MARKETING MANAGER, BSI Agenda Energy Management in context Why Energy Management? Business Needs How BS EN 16001 helps organisations meet
Immigration Forum. by Maureen O Sullivan Kaplan, O Sullivan & Friedman November 14, 2008 Harvard Medical School Campus
Immigration Forum by Maureen O Sullivan Kaplan, O Sullivan & Friedman November 14, 2008 Harvard Medical School Campus Immigration All people who come to the U.S. are divided into: Non-immigrants Immigrants
GEO Study Abroad - Latin America geo.uoregon.edu
GEO Study Abroad - Latin America ARGENTINA Rosario Language & Culture Language, International Studies, Business, History, Literature ECUADOR Bahía de Caráquez Bioregional Community Development GUATEMALA
Coffee Year 2014-15 Futures Trading Analysis
Lower coffee exports lend support to Robusta prices The coffee market rallied slightly in June, led in most part by a recovery in Robusta prices. For the sixth month in a row exports were lower than last