Influence of the skin mechanical and microbial properties on hair growth

Size: px
Start display at page:

Download "Influence of the skin mechanical and microbial properties on hair growth"

Transcription

1 Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont Enigma. Impossible? Keywords (5) Hair, Growth, Stem cells, Microbiome, Mechanics Team members Name Name Interests Sophie BARY Ecology, Taxonomy, Phylogeny Frances EDWARDS Cell biology, Developmental biology,cytoskeleton Paul KENNOUCHE Microbiology, Modeling, Tissue engineering Paul Guéridon RIDVO Immunology, Biomaterials, Medicine Mariela SKENDI Medicine, Ultrasound imaging and therapeutic techniques Abstract (200 words max) Human bodies are covered in hair of different lengths. The length of hair is determined by the rate at which it grows and the time it spends growing before it falls out during the anagen phase. The causes of these physiological variations have not yet been determined. Here, we propose to concentrate on the comparison of scalp hair and eyebrows to establish the influence of the hair follicle environment on hair growth. We first aim to compare the physiology of scalp hair and eyebrow follicles. We will then identify the differences between the environments of these follicles, in particular their microbiome and mechanical properties. After these descriptive studies, the influence of specific parameters will be tested on follicle stem cell behaviour by using an in vitro culture system. This original project will provide a novel insight on the influence of the environment on homeostasis, but could also lead to new therapeutic solutions to alopecia.

2 B Description of the project B 1 General Introduction Pluricellular organisms derive from a single cell. Throughout development and despite a similar genetic background, cells have very different fates depending on the environment in which they grow. This stands true for the macro environment as well as for the micro environment. This multi scale regulation was initially studied during embryonic development. Yet, it has now become apparent that such a multi factorial regulation also plays a major role in the development of mature organisms. Adult stem cells are responsible for this constant cell renewal. Because of their well characterized cyclic regeneration pattern, hair bulbs are a good model to analyze the influence of the environment on development. Moreover, hair always originates from the same multi cellular epidermal structure: the hair bulb. Yet, there is a visible diversity in the hair covering the human body. What could explain the difference between the limit length of our eyebrows and our scalp hair? To understand this phenomenon, the hair follicle anatomy and cycle must be described. Its structure evolves through three phases : the anagen phase (or growth phase) during which the follicle penetrates deeper into the dermis, progenitor cells proliferate in the bulge and finally cells in the papilla (the basal structure of the hair bulb) divide to forms new hair fiber; the catagen phase which marks the end of the growth of the hair following apoptosis of the cells in the hair follicle. the telogen phase, the dormance of the follicle. A difference in the duration of the anagen phase of the scalp hair and the eyebrow has previously been reported. The rate of hair growth and the duration of anagen vary with the type of hair and location. On the scalp, the growth rate of terminal hair is approximately 0.3 mm per day and the duration of anagen ranges from two to six years. In contrast, eyebrow hair grows only at a rate of 0.1 mm per day and has an anagen phase of two to three months. Yet, the determinants of the duration of the anagen phase remain unknown. Classical hypothesis include cell to cell signalling, signalling through endocrine factors or blood irrigation. Recent reports reveal the diversity of the skin microbiome. Given the major role that the micriobiome plays in organs such as the gut, we suspect that it might have a determinant role in the development of the hair. This is further supported by pathologies such as bacterial folliculitis. In addition to that, a factor that has long been overlooked and we aim to study is the influence of the mechanical constraints. B 2 Objectives and specific aims The aim of our project is to determine if two specific environmental cues, namely tissue stiffness and the microbiota, influence tissue homeostasis in the particular case of hair renewal. Compared description of the physiology of the hair and brow follicles Comparative histology of follicles of scalp hair and eyebrows Compare the division rate and the time stem cells spend dividing in vitro in the same conditions? Comparison of the environment of these two types of follicles Mechanical properties : high frequency ultrasounds Microbiota Determine the influence of tissue mechanics and microbial populations on hair stem cell physiology. Primary cultures of hair follicle stem cells in environments with differential stiffness Variation of the microbial populations in culture

3 C Detailed description of the project I. Correlation of hair growth with physiological parameters of the stem cells. The first aim of our project is to determine which physiological characteristics of bulge stem cells are correlated with the length of hair. For this, we will compare the scalp hair and eyebrows of a group of blond men aged 25 to 30. We will first compare the histology of eyebrow and hair follicles, concentrating on the number of stems cells and their size. For this, hair and eyebrows will be collected, and dissected, before proceeding to the staining of the stem cells using immunohistochemistry. In order to characterize the behavior of the different follicles, hair stem cells will be collected from the bulbs, cultured, and then sorted using Fluorescent Automated Cell Sorting targetting CD24 and a6 integrin as specific markers of bulge stem cells. We will then study their division rate using microscopy. II. Characterization of the microenvironment of hair follicles. A. Assessment of elastic parameters of human skin using dynamic elastography. We will perform tissue stiffness measurement of the skin in vivo by sonoelastography and transient elastography. This technique uses Young's modulus as a parameter because it defines local tissue stiffness yielding local, quantitative information. We will use a high resolution device capable of measuring local Young's modulus in very thin layers and devoted to the in vivo evaluation of the elastic properties of human skin. It uses an ultrasonic probe (50 MHz) for tracking the displacements induced by a 300 Hz shear wave generated by a ring surrounding the transducer. B. Microbiota The skin is colonized by a diverse milieu of microorganisms, most of which are harmless or even beneficial to their host. Colonization is driven by the ecology of the skin surface, which is highly variable. We estimate that ~1 billion bacteria inhabit a typical square centimeter of skin covering the surface and extending down into the appendages and glands. Intrinsic factors as well as environmental factors influence the composition of skin microorganism communities. The topography of human skin varies at both microscopic and macroscopic levels. Distinct habitats are characterized by differences in skin thickness and folds and densities of hair follicles and glands. To consider the diversity of this microenvironment, and to test whether it has an impact on the anagen phase, it is necessary to take into account the topography of the environment. The ecosystem will be caracterized by using DNA barcoding, a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, the 16S rrna gene which is universal among prokaryotes.

4 We will use online databases, such as the Ribosomal Database Project (RDP), which catalog hundreds of thousands of validated 16S rrna gene sequences. Thus, sequencing of the 16S rrna gene facilitates identification of bacteria present in a given sample. Taking into account the diversity of these ecosystem implies to investigate what bacteria, fungi and virus are present on this two different environments. Since viruses don t contain a generic barcode gene, it was decided to sequence the whole genome of viruses in this work using Next Generation Sequence Technology. This implies extraction, PCR amplification, sequencing and database research in order to identify virus. III. How does the microenvironment of hair follicles influence their physiology? The first two aims of our project will have identified differences in the specific microenvironment of hair and eyebrow follicles, and differences in the physiology of the bulge cells. The next aim will be to determine if bulge cell physiology can be influenced by the identified parameters of the microenvironment. We will approach this question by using in vitro culture of bulge cells from hair and eyebrows, to specifically control their microenvironment. We will obtain hair stem cells from the brows and hair of the same population studied in the first part. We will culture the cells, and proceed to their sorting using Fluorescent Automated Cell Sorting using CD24 and a6 integrin as specific markers of bulge stem cells. If the first part of our project has revealed a difference in tissue stiffness between the epidermis of hair and brows, we will proceed to the culture of the stem cells on PDMS substrates. Varying the crosslinker concentrations will lead to substrates of different stiffness. We will then monitor the influence of stiffness on hair stem cell physiology, by considering the different parameters that we will have identified in the second part of our work, eg. size, rate of division, timing of differentiation process. We will also test the influence of the microbiome on these parameters by culturing the stem cells in presence of the different populations identified as being different from hair to brows in the previous section. D Scientific Interest in the project of all the participants and beyond The project is fully interdisciplinary and requires a wide range of theorical and technical knowledge. It is at the interface between microbiology, biophysics and physiology, and we will need knowledge in mechanical physics, medicine and chemistry to determine the environments for different hair. It will gather abilities in new methods like Next Generations Sequencing, and new ultrasound techniques. There are numerous challenges that will probably interest developmental biologists : this project will improve the understanding of the influence of the environment on tissue homeostasis medical imaging : the use of high frequency ultrasounds to study tissue mechanics will help improve the technique and will be a proof of concept for its use to study the epidermis

5 society : alopecia for example, a health problem. We may provide new information that could help improve this condition, through surgery or the use of probiotics cosmetic industry : to improve their products, shampoo for example E BUDGET (1 million euro max for 3 years including salaries, equipment, consumables, etc.) Consumables : ,12 /student/year = ,80 NGS : 1999,87 /run x 10 = ,70 Equipment fees (elastography, FACS) : ,00 Travel : 19850,25 x 3 years = ,75 Publications, etc = Staff : /student = Total : ,25

Hair Chemistry. Chapter 1. Hair Relaxers Science, Design, and Application www.alluredbooks.com

Hair Chemistry. Chapter 1. Hair Relaxers Science, Design, and Application www.alluredbooks.com Hair Relaxers Science, Design, and Application www.alluredbooks.com Chapter 1 Hair Chemistry We all know that the hair on our head is dead, but underneath the scalp, within the hair follicle, is a surprisingly

More information

Biology Institute: 7 PhD programs Expertise in all areas of biological sciences

Biology Institute: 7 PhD programs Expertise in all areas of biological sciences Biology Institute: 7 PhD programs Expertise in all areas of biological sciences!" #$%&'()*" '+**$,%' Biology Institute: PhD programs Programs Website: http://www.ib.unicamp.br/pos About the Biology Institute

More information

Development of the skin and its derivatives

Development of the skin and its derivatives Development of the skin and its derivatives Resources: http://php.med.unsw.edu.au/embryology/ Larsen s Human Embryology Chapter 7 The Developing Human: Clinically Oriented Embryology Dr Annemiek Beverdam

More information

no!no! Thermicon: A Novel, Home-based Hair Removal Device Dr. Mira Barki Yavne, Israel Introduction Lasers and intense pulsed light sources have become a popular method for long-term removal of unwanted

More information

What is androgenetic alopecia?

What is androgenetic alopecia? What is androgenetic alopecia? Androgenetic alopecia is also called male pattern alopecia. It refers to a symptom that develops after puberty, influenced by the androgen, where thinning and/or loss of

More information

where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results

where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results GOING BALD? HAIR LOSS? THINNING? NO MORE! - HAIR RESTORATION FROM FUECLINICS Hair transplantation involves

More information

Biotechnology. Srivatsan Kidambi, Ph.D.

Biotechnology. Srivatsan Kidambi, Ph.D. Stem Stem Cell Cell Engineering-What, Biology and it Application Why, How?? to Biotechnology Srivatsan Kidambi, Ph.D. Assistant Professor Department of Chemical & Biomolecular Engineering University of

More information

All About Human Hair and Hair Loss. 1. Story

All About Human Hair and Hair Loss. 1. Story All About Human Hair and Hair Loss 1. Story Hair has always been an important sign of beauty. This is especially true for women. Next to the face, hair is one of the main qualities people look for when

More information

Preventing hair loss by balancing the hair cycle, strengthening the hair follicle, and improving scalp health

Preventing hair loss by balancing the hair cycle, strengthening the hair follicle, and improving scalp health Preventing hair loss by balancing the hair cycle, strengthening the hair follicle, and improving scalp health By Dr. M. Pflaumbaum*, M. Farwick, M. Mentel, T. Köhler Sphinganine-based ceramides represent

More information

PROPERTIES OF THE HAIR AND SCALP

PROPERTIES OF THE HAIR AND SCALP PROPERTIES OF THE HAIR AND SCALP 1. The scientific study of hair, its diseases and care is called: a. dermatology c. biology b. trichology d. cosmetology 2. The two parts of a mature hair strand are the

More information

BIOMEDICAL SCIENCE: A COURSE THAT COUNTS

BIOMEDICAL SCIENCE: A COURSE THAT COUNTS BIOMEDICAL SCIENCE: A COURSE THAT COUNTS Department of Pharmacy, Health and Well-being Why study Biomedical at Sunderland? By studying Biomedical at Sunderland, you are choosing to put your future career

More information

MASTER OF SCIENCE IN BIOLOGY

MASTER OF SCIENCE IN BIOLOGY MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

Skin Science: The Use of

Skin Science: The Use of Skin Science: The Use of Genomics Tools in Skin Care Genemarkers LLC Anna Langerveld, PhD anna@genemarkersllc.com www.genemarkersllc.com Cosmeceuticals Summit March 9-11, 2009 Orlando, FL What is Skin

More information

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions

More information

High frequency low intensity current effects: bio-stimulation and cellular regeneration

High frequency low intensity current effects: bio-stimulation and cellular regeneration UNIVERSITA DEGLI STUDI DI PADOVA Dipartimento di Anatomia e Fisiologia Umana Department of Human Anatomy and Physiology High frequency low intensity current effects: bio-stimulation and cellular regeneration

More information

BIOLOGICAL SCIENCES REQUIREMENTS [63 75 UNITS]

BIOLOGICAL SCIENCES REQUIREMENTS [63 75 UNITS] Biological Sciences Major The Biological Sciences address many of the most important and fundamental questions about our world: What is life? How does our brain produce our ideas and emotions? What are

More information

INNOVATION PRIZE 2008. PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells

INNOVATION PRIZE 2008. PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells INNOVATION PRIZE 2008 PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells A Revolutionary Technology to Protect

More information

Diablo Valley College Catalog 2014-2015

Diablo Valley College Catalog 2014-2015 Biological science BIOSC Diablo Valley College is approved by the California Board of Registered Nurses for continuing education credits. Biological Science courses which can be used are BIOSC-119, 120,

More information

Getting to the Root of Hair Loss

Getting to the Root of Hair Loss 26 March 2012 MP3 at voaspecialenglish.com Getting to the Root of Hair Loss Reuters An example of male pattern baldness SHIRLEY GRIFFITH: This is SCIENCE IN THE NEWS in VOA Special English. I'm Shirley

More information

FGF-1 as Cosmetic Supplement

FGF-1 as Cosmetic Supplement FGF-1 as Cosmetic Supplement Ing-Ming Chiu, Ph.D. Professor, Internal Medicine and Molecular and Cellular Biochemistry The Ohio State University Columbus, Ohio, U.S.A. GENTEON USA Fibroblast Growth Factor

More information

CRIME LAB FORENSICS. Course Overview

CRIME LAB FORENSICS. Course Overview CRIME LAB FORENSICS Description Crime Lab Forensics, which is a laboratory-based course, will promote and cultivate the development of student s scientific inquiry and scientific method skills, which are

More information

Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot

Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot Chapter 1 All you need to know about hair almost Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot Typically

More information

Are 50/60 Hz magnetic fields carcinogenic to humans? Michel Plante M.D.

Are 50/60 Hz magnetic fields carcinogenic to humans? Michel Plante M.D. Are 50/60 Hz magnetic fields carcinogenic to humans? Michel Plante M.D. Magnetic fields are present everywhere in our environment. They are commonly measured in Tesla (T), the international unit for magnetic

More information

MICROBIO, IMMUN, PATHOLOGY-MIP (MIP)

MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Microbio, Immun, Pathology-MIP (MIP) 1 MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Courses MIP 101 Introduction to Human Disease (GT-SC2) Credits: 3 (3-0-0) Survey of human systems and diseases. Additional Information:

More information

Please visit your examination provider s website for the most current bulletin prior to testing. IMPORTANT INSTRUCTIONS

Please visit your examination provider s website for the most current bulletin prior to testing. IMPORTANT INSTRUCTIONS NATIONAL BARBER THEORY EXAMINATION CANDIDATE INFORMATION BULLETIN Please visit your examination provider s website for the most current bulletin prior to testing. The National Barber Theory Examination

More information

Three Domains of Life

Three Domains of Life Image from Scientific American blog Three Domains of Life http://www.buzzle.com/articles/three-domains-of-life.html The three-domain system, which classifies life on the planet into three different domains

More information

Nanoindenters. Optics11 Nanoindenter catalog, published in June 2016 by Optics11. Please see our website for more information about our products.

Nanoindenters. Optics11 Nanoindenter catalog, published in June 2016 by Optics11. Please see our website for more information about our products. Optics11 Nanoindenter Instruments Biomechanics Biomaterials Tissue scaffolds Mechanobiology Biofilms Microtissues Composites Single 3D printed structures Polymers Spheroids Cartilage Hydrogels cells Optics11

More information

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge

More information

Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine

Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine January 27, 2009 Dear Professors (representative) of departments, Subject:

More information

Double degrees with University of Sussex, UK

Double degrees with University of Sussex, UK BIOMEDICAL SCIENCE Double degrees with University of Sussex, UK Faculty of Science (International Program), Mahidol University (SIM) has developed Dual Degree Programs in cooperation with University of

More information

Note: Semesters and years in which specific courses are offered are subject to change.

Note: Semesters and years in which specific courses are offered are subject to change. Biology Courses-1 Note: Semesters and years in which specific courses are offered are subject to change. BIO 099/Orientation to Biology 0 course units (8 weeks) (fall, annually) Required for all freshmen

More information

It works. Hair loss prevention and hair regeneration study

It works. Hair loss prevention and hair regeneration study Hair loss prevention and hair regeneration study Report of the findings of the clinical trial to evaluate the effectiveness of VR6 hair treatment Study conducted by: Centro de Tecnología Capilar, SL Report

More information

Biology. Aim of the subject

Biology. Aim of the subject Biology BIO Biology Biology is a scientific subject that has its origins in the need of human beings to know more about themselves and the world around them. It is the theory of life, its origins, evolution,

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Biotechnical Engineering (BE) Course Description

Biotechnical Engineering (BE) Course Description Biotechnical Engineering (BE) Course Description The major focus of the Biotechnical Engineering TM (BE) course is to expose students to the diverse fields of biotechnology including biomedical engineering,

More information

Medical Laboratory Technology Program. Student Learning Outcomes & Course Descriptions with Learning Objectives

Medical Laboratory Technology Program. Student Learning Outcomes & Course Descriptions with Learning Objectives Medical Laboratory Technology Program Student Learning Outcomes & Course Descriptions with Learning Objectives Medical Laboratory Technology Student Learning Outcomes All Colorado Mesa University associate

More information

Micro-Organisms as Feed Additives Probiotics

Micro-Organisms as Feed Additives Probiotics Micro-Organisms as Feed Additives Probiotics Ortwin Simon Institute of Animal Nutrition, Faculty of Veterinary Medicine, Free University Berlin, Bruemmer Str. 34, 14195 Berlin, Germany; Email: osimon@zedat.fu-berlin.de

More information

CAN ÇETİN. Adress +90 536 968 4800. Telephone. cancetincc@gmail.com. E- Mail & Skype

CAN ÇETİN. Adress +90 536 968 4800. Telephone. cancetincc@gmail.com. E- Mail & Skype CAN ÇETİN Adress Yeditepe University, Faculty of Engineering and Architecture Department of Genetics and Bioengineering Tissue Engineering Laboratory 34755 Kayışdağı - Istanbul Turkey Telephone E- Mail

More information

Unit 1 Scientific Inquiry. Learning Goal: Students will use the Scientific inquiry process to identify, and solve problems.

Unit 1 Scientific Inquiry. Learning Goal: Students will use the Scientific inquiry process to identify, and solve problems. Unit 1 Scientific Inquiry Learning Goal: Students will use the Scientific inquiry process to identify, and solve problems. 4 Student can use the scientific inquiry process to evaluate the validity of other

More information

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy

II. Pathways of Discovery in Microbiology. 1.6 The Historical Roots of Microbiology. Robert Hooke and Early Microscopy II. Pathways of Discovery in Microbiology 1.6 The Historical Roots of Microbiology 1.6 The Historical Roots of Microbiology 1.7 Pasteur and the Defeat of Spontaneous Generation 1.8 Koch, Infectious Disease,

More information

STATISTICAL ANALYSIS OF ULTRASOUND ECHO FOR SKIN LESIONS CLASSIFICATION HANNA PIOTRZKOWSKA, JERZY LITNIEWSKI, ELŻBIETA SZYMAŃSKA *, ANDRZEJ NOWICKI

STATISTICAL ANALYSIS OF ULTRASOUND ECHO FOR SKIN LESIONS CLASSIFICATION HANNA PIOTRZKOWSKA, JERZY LITNIEWSKI, ELŻBIETA SZYMAŃSKA *, ANDRZEJ NOWICKI STATISTICAL ANALYSIS OF ULTRASOUND ECHO FOR SKIN LESIONS CLASSIFICATION HANNA PIOTRZKOWSKA, JERZY LITNIEWSKI, ELŻBIETA SZYMAŃSKA *, ANDRZEJ NOWICKI Institute of Fundamental Technological Research, Department

More information

Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015)

Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015) Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015) Preparatory Subject Matter......56-66 Biological Sciences 2A-2B-2C.....15 Chemistry 2A-2B-2C...15 Chemistry 8A-8B or 118A-118B-118C......6-12

More information

La capture de la fonction par des approches haut débit

La capture de la fonction par des approches haut débit Colloque Génomique Environnementale LYON 2011 La capture de la fonction par des approches haut débit Pierre PEYRET J. Denonfoux, N. Parisot, E. Dugat-Bony, C. Biderre-Petit, D. Boucher, G. Fonty, E. Peyretaillade

More information

Metagenomics: : DNA Sequencing of Environmental Samples

Metagenomics: : DNA Sequencing of Environmental Samples Metagenomics: : DNA Sequencing of Environmental Samples Susannah Green Tringe and Edward M. Rubin Department of Energy Joint Genome Institute What is Metagenomics? Metagenomics is the study of genomes

More information

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z. Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Comprehensive Lab Kits & Digital Curriculum for Online Learners

Comprehensive Lab Kits & Digital Curriculum for Online Learners Allied Health Anatomy and Physiology Biology Chemistry Environmental Science Geology Microbiology Pharm Tech Physical Science Physics Comprehensive Lab Kits & Digital Curriculum for Online Learners supports

More information

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer

More information

Notes on Hair Analysis

Notes on Hair Analysis Notes on Hair Analysis I have found local veterinarians very uncooperative when trying to get samples of dog and cat fur. I have found neighbors, friends and relatives a much better source of fur. There

More information

AP Biology Learning Objective Cards

AP Biology Learning Objective Cards 1.1 The student is able to convert a data set from a table of numbers that reflect a change in the genetic makeup of a population over time and to apply mathematical methods and conceptual understandings

More information

Master of Science in Biophysics, Biochemistry and Biotechnology

Master of Science in Biophysics, Biochemistry and Biotechnology Master of Science in Biophysics, Biochemistry and Biotechnology Tracks: Biophysics Biochemistry and Biotechnology Faculty of Science Faculty of Medicine KU Leuven. Inspiring the outstanding. Discover KU

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

Advances in scmos Camera Technology Benefit Bio Research

Advances in scmos Camera Technology Benefit Bio Research Advances in scmos Camera Technology Benefit Bio Research scmos camera technology is gaining in popularity - Why? In recent years, cell biology has emphasized live cell dynamics, mechanisms and electrochemical

More information

Anatomy PHL 212. By Dr Tajdar Husain Khan

Anatomy PHL 212. By Dr Tajdar Husain Khan Anatomy PHL 212 By Dr Tajdar Husain Khan Overview of Anatomy Anatomy(from the Greek word anatome,"dissection") is a branch of natural science dealing with the structural organization of living things The

More information

CapixylTM. The synergistic anti-aging hair complex for stronger and thicker hair

CapixylTM. The synergistic anti-aging hair complex for stronger and thicker hair CapixylTM The synergistic anti-aging hair complex for stronger and thicker hair The importance of hair in our lives cannot be overstated. Whether men or women lose their hair, they lose much more than

More information

CAP Accreditation Checklists 2015 Edition

CAP Accreditation Checklists 2015 Edition CAP Accreditation Checklists 2015 Edition The College of American Pathologists (CAP) accreditation checklists contain the CAP accreditation program requirements, developed on more than 50 years of insight

More information

FACULTY OF MEDICAL SCIENCE

FACULTY OF MEDICAL SCIENCE Doctor of Philosophy in Biochemistry FACULTY OF MEDICAL SCIENCE Naresuan University 73 Doctor of Philosophy in Biochemistry The Biochemistry Department at Naresuan University is a leader in lower northern

More information

2015-2016 Academic Catalog

2015-2016 Academic Catalog 2015-2016 Academic Catalog Master of Science or Arts in Biology Graduate Arts and Sciences Director: Dr. Karen Snetselaar (on sabbatical 2016) Science Center 225, 610-660-1826, ksnetsel@sju.edu Mission

More information

TOPIC 1: ELECTROLYSIS AND OTHER METHODS OF REMOVING UNWANTED HAIR

TOPIC 1: ELECTROLYSIS AND OTHER METHODS OF REMOVING UNWANTED HAIR HAIR REMOVAL 16 Date: Rating: Text pages: 344 379 TOPIC 1: ELECTROLYSIS AND OTHER METHODS OF REMOVING UNWANTED HAIR 1 The removal of superfluous hair is a service offered by most salons a) What is the

More information

FACULTY OF MEDICAL SCIENCE

FACULTY OF MEDICAL SCIENCE Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research

More information

Jeffrey Gordon Center for Genome Sciences Washington University, St. Louis, MO

Jeffrey Gordon Center for Genome Sciences Washington University, St. Louis, MO Jeffrey Gordon Center for Genome Sciences Washington University, St. Louis, MO jgordon@molecool.wustl.edu A transcendent view of ourselves We are composite of species: eukaryotic, bacterial, archaeal Our

More information

A Correlation of Miller & Levine Biology 2014

A Correlation of Miller & Levine Biology 2014 A Correlation of Miller & Levine Biology To Ohio s New Learning Standards for Science, 2011 Biology, High School Science Inquiry and Application Course Content A Correlation of, to Introduction This document

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

There are a wide range of factors that can impact on the health of the hair and hair growth.

There are a wide range of factors that can impact on the health of the hair and hair growth. Welcome to Viviscal Viviscal, one of the best selling hair growth supplement in the US, is now available with TVSN. The Viviscal brand of hair care products is enjoying rapid and substantial growth in

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

3. What impact has microbiology had in regards to the Nobel Prize in medicine and physiology?

3. What impact has microbiology had in regards to the Nobel Prize in medicine and physiology? MEDICAL MICROBIOLOGY Name / Date / Period Read the website article What Is Microbiology? and answer the following questions in complete sentences. (The questions are in order as the answer appears in the

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

Bachelor of Science in Nursing Transfer Admission Information Packet. Preferred Application Deadlines

Bachelor of Science in Nursing Transfer Admission Information Packet. Preferred Application Deadlines Bachelor of Science in Nursing Transfer Admission Information Packet Preferred Application Deadlines Spring Semester: December 1 Fall Semester: February 15 Please read this Information Packet carefully

More information

Quality and Safety Evaluation of Gene Therapy Products in Japan

Quality and Safety Evaluation of Gene Therapy Products in Japan Quality and Safety Evaluation of Gene Therapy Products in Japan Review Mechanism for Gene Therapy in Japan The review mechanism for gene therapy in Japan was partially amended to simplify the necessary

More information

TECHNOLOGY PATENTS IN THE (CONTINUED)... 16

TECHNOLOGY PATENTS IN THE (CONTINUED)... 16 CHAPTER ONE: INTRODUCTION... 1 STUDY GOALS AND OBJECTIVES... 1 REASONS FOR DOING THIS STUDY... 1 SCOPE AND FORMAT... 1 METHODOLOGY AND INFORMATION SOURCES... 2 INTENDED AUDIENCE... 2 ANALYST CREDENTIALS...

More information

VivaCell Services. Hair growth and prevention of hair loss

VivaCell Services. Hair growth and prevention of hair loss 2014 1/10 VivaCell Biotechnology GmbH VivaCell Services growth and prevention of hair loss VivaCell Biotechnology GmbH 2014 2/10 VivaCell Biotechnology GmbH Effects of natural products (extracts/compounds)

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

BIOSCIENCES COURSE TITLE AWARD

BIOSCIENCES COURSE TITLE AWARD COURSE TITLE AWARD BIOSCIENCES As a Biosciences undergraduate student at the University of Westminster, you will benefit from some of the best teaching and facilities available. Our courses combine lecture,

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Stephen Eubanks, M.D.

Stephen Eubanks, M.D. Stephen Eubanks, M.D. The Dermatology & Laser Center at Harvard Park Denver, Colorado Assistant Clinical Professor, Dept. Dermatology University of Colorado Health Sciences Center I would like to thank

More information

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!

More information

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex

More information

Core Curriculum to the Course:

Core Curriculum to the Course: Core Curriculum to the Course: Basic Human Anatomy Basic Biochemistry General Cellular Biology Introduction to Ecology Basic Ecology General Biophysics and Physiology I General Biophysics and Physiology

More information

Cell Biology Questions and Learning Objectives

Cell Biology Questions and Learning Objectives Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate

More information

DNA Microarrays: Application to Personal Health Care and Cosmetic Industries

DNA Microarrays: Application to Personal Health Care and Cosmetic Industries DNA Microarrays: Application to Personal Health Care and Cosmetic Industries Authors: Robert Holtz, William Vitz, BioInnovation Laboratories Inc, Texas, USA Abstract While DNA microarrays have been widely

More information

Major Program. Major Program

Major Program. Major Program Major Program Major Program is set up to serve the major needs of national economy, sustainable development of the society and S&T development. It selects scientific issues with strategic significance,

More information

Textbook Evert RF and SE Eichorn 2012 Raven Biology of Plants. Eighth Edition. WH Freeman. (Table of Contents i ). Lecture Topics

Textbook Evert RF and SE Eichorn 2012 Raven Biology of Plants. Eighth Edition. WH Freeman. (Table of Contents i ). Lecture Topics Science/Biology 2010.04 Plant Biology 3 credits lecture (3 hours/week; 12 weeks); 1 credit laboratory (3 hours/week; 12 weeks) Current advances in plant biology research, highlighting plant structure,

More information

Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: Suzanne_moore@uml.

Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: Suzanne_moore@uml. Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: Suzanne_moore@uml.edu PROFESSIONAL PROFILE Accomplished career demonstrating consistent

More information

Article 53(c) EPC - therapy

Article 53(c) EPC - therapy Article 53(c) EPC - therapy Compound X is not new, but no medical use (a) (b) (c) (d) (e) (f) (g) (h) (i) (j) (k) compound X for use as a medicament compound X for use in treating disease Y composition

More information

RECOMBINANT DNA TECHNOLOGY

RECOMBINANT DNA TECHNOLOGY RECOMBINANT DNA TECHNOLOGY By; Dr. Adeel Chaudhary 2 nd yr Molecular Genetics Medical Technology College of Applied Medical Sciences Recombinant DNA is a form of artificial DNA that is made through the

More information

MBBM801 Methodologies in Molecular Biology and Biomedicine 3 MBBM802 FHS Graduate Core Course 3 MBBM803 Research Ethics 0

MBBM801 Methodologies in Molecular Biology and Biomedicine 3 MBBM802 FHS Graduate Core Course 3 MBBM803 Research Ethics 0 UM Academic Calendar PROGRAMMES OF STUDY Faculty of Health Sciences PhD Programme AREA OF STUDY Biomedical Sciences Courses MBBM801 Methodologies in Molecular Biology and Biomedicine 3 MBBM802 FHS Graduate

More information

School of Biology. Biology Sub-honours 2007/08 August Important Degree Information:

School of Biology. Biology Sub-honours 2007/08 August Important Degree Information: School of Biology Important Degree Information: B.Sc./M.A. Honours The general requirements are 480 credits over a period of normally 4 years (and not more than 5 years) or part-time equivalent; the final

More information

Fields of Education. Last updated August 2011

Fields of Education. Last updated August 2011 Fields of Education Last updated August 2011 Monash University is required to report to the Department of Education, Employment and Workplace Relations (DEEWR) the number of higher degree by research (HDR)

More information

Identification of the androgen receptor aggregates that cause spinal-bulbar muscular atrophy

Identification of the androgen receptor aggregates that cause spinal-bulbar muscular atrophy Identification of the androgen receptor aggregates that cause spinal-bulbar muscular atrophy Dr Xavier Salvatella Giralt CSIC Consell Superior d'investigacions Científiques Institut Recerca Biomèdica de

More information

Pig skin as an alternative to human skin for skin metabolism studies?

Pig skin as an alternative to human skin for skin metabolism studies? Pig skin as an alternative to human skin for skin metabolism studies? H. Osman-Ponchet, A. Lemoine, A. Gaborit, K. Sevin, M. Alriquet, P. Comby, B. Ruty 2 nd Skin Metabolism Meeting October 10-11, 2013

More information

Lecture objectives continued

Lecture objectives continued Skin and appendages Lecture objectives briefly list the functions of the integumentary system. describe the two principal layer of the skin. list the layers of the epidermis. describe what are lines of

More information

Thick and Thin Evaluating layers of the skin

Thick and Thin Evaluating layers of the skin Overview Thick and Thin Evaluating layers of the skin Understanding the layered structure of skin is essential to understanding how it functions. The focus of this lesson is for students to discover and

More information

NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT

NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT 1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun

More information

These are just some of the every day questions that are explained by skin anatomy.

These are just some of the every day questions that are explained by skin anatomy. 1 These are just some of the every day questions that are explained by skin anatomy. 2 The integument (skin, cutaneous membrane) includes two general layers of tissue. The more superficial layer, exposed

More information

CHRONOCYCLIN. Cosmetic application. day and night skin care

CHRONOCYCLIN. Cosmetic application. day and night skin care Cosmetic application day and night skin care Temporary or long-term cutaneous damages overworked, tired, lack of sun exposure, jet lag anti-aging benefits Skin awakening Stimulation of cutaneous natural

More information

Use of surface plasmon resonance for probing cell-matrix interactions

Use of surface plasmon resonance for probing cell-matrix interactions Use of surface plasmon resonance for probing cell-matrix interactions Reichert Technologies Webinar September 20, 2016 Michael Hill Debanjan Sarkar Lab: Laboratory of Biomaterials and Regenerative Therapeutics

More information

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions! AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square

More information

Biology Ch 10 Cell Growth & Division ( )

Biology Ch 10 Cell Growth & Division ( ) Name Class Date Biology Ch 10 Cell Growth & Division (10.1-10.2) For Questions 1 4, write True if the statement is true. If the statement is false, change the underlined word or words to make the statement

More information

Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL

Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL COURSE TITLE: BIOCHEMISTRY COURSE NUMBER: 5104 This course emphasizes biochemical compounds, processes and systems, designed

More information