Influence of the skin mechanical and microbial properties on hair growth

Size: px
Start display at page:

Download "Influence of the skin mechanical and microbial properties on hair growth"


1 Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont Enigma. Impossible? Keywords (5) Hair, Growth, Stem cells, Microbiome, Mechanics Team members Name Name Interests Sophie BARY Ecology, Taxonomy, Phylogeny Frances EDWARDS Cell biology, Developmental biology,cytoskeleton Paul KENNOUCHE Microbiology, Modeling, Tissue engineering Paul Guéridon RIDVO Immunology, Biomaterials, Medicine Mariela SKENDI Medicine, Ultrasound imaging and therapeutic techniques Abstract (200 words max) Human bodies are covered in hair of different lengths. The length of hair is determined by the rate at which it grows and the time it spends growing before it falls out during the anagen phase. The causes of these physiological variations have not yet been determined. Here, we propose to concentrate on the comparison of scalp hair and eyebrows to establish the influence of the hair follicle environment on hair growth. We first aim to compare the physiology of scalp hair and eyebrow follicles. We will then identify the differences between the environments of these follicles, in particular their microbiome and mechanical properties. After these descriptive studies, the influence of specific parameters will be tested on follicle stem cell behaviour by using an in vitro culture system. This original project will provide a novel insight on the influence of the environment on homeostasis, but could also lead to new therapeutic solutions to alopecia.

2 B Description of the project B 1 General Introduction Pluricellular organisms derive from a single cell. Throughout development and despite a similar genetic background, cells have very different fates depending on the environment in which they grow. This stands true for the macro environment as well as for the micro environment. This multi scale regulation was initially studied during embryonic development. Yet, it has now become apparent that such a multi factorial regulation also plays a major role in the development of mature organisms. Adult stem cells are responsible for this constant cell renewal. Because of their well characterized cyclic regeneration pattern, hair bulbs are a good model to analyze the influence of the environment on development. Moreover, hair always originates from the same multi cellular epidermal structure: the hair bulb. Yet, there is a visible diversity in the hair covering the human body. What could explain the difference between the limit length of our eyebrows and our scalp hair? To understand this phenomenon, the hair follicle anatomy and cycle must be described. Its structure evolves through three phases : the anagen phase (or growth phase) during which the follicle penetrates deeper into the dermis, progenitor cells proliferate in the bulge and finally cells in the papilla (the basal structure of the hair bulb) divide to forms new hair fiber; the catagen phase which marks the end of the growth of the hair following apoptosis of the cells in the hair follicle. the telogen phase, the dormance of the follicle. A difference in the duration of the anagen phase of the scalp hair and the eyebrow has previously been reported. The rate of hair growth and the duration of anagen vary with the type of hair and location. On the scalp, the growth rate of terminal hair is approximately 0.3 mm per day and the duration of anagen ranges from two to six years. In contrast, eyebrow hair grows only at a rate of 0.1 mm per day and has an anagen phase of two to three months. Yet, the determinants of the duration of the anagen phase remain unknown. Classical hypothesis include cell to cell signalling, signalling through endocrine factors or blood irrigation. Recent reports reveal the diversity of the skin microbiome. Given the major role that the micriobiome plays in organs such as the gut, we suspect that it might have a determinant role in the development of the hair. This is further supported by pathologies such as bacterial folliculitis. In addition to that, a factor that has long been overlooked and we aim to study is the influence of the mechanical constraints. B 2 Objectives and specific aims The aim of our project is to determine if two specific environmental cues, namely tissue stiffness and the microbiota, influence tissue homeostasis in the particular case of hair renewal. Compared description of the physiology of the hair and brow follicles Comparative histology of follicles of scalp hair and eyebrows Compare the division rate and the time stem cells spend dividing in vitro in the same conditions? Comparison of the environment of these two types of follicles Mechanical properties : high frequency ultrasounds Microbiota Determine the influence of tissue mechanics and microbial populations on hair stem cell physiology. Primary cultures of hair follicle stem cells in environments with differential stiffness Variation of the microbial populations in culture

3 C Detailed description of the project I. Correlation of hair growth with physiological parameters of the stem cells. The first aim of our project is to determine which physiological characteristics of bulge stem cells are correlated with the length of hair. For this, we will compare the scalp hair and eyebrows of a group of blond men aged 25 to 30. We will first compare the histology of eyebrow and hair follicles, concentrating on the number of stems cells and their size. For this, hair and eyebrows will be collected, and dissected, before proceeding to the staining of the stem cells using immunohistochemistry. In order to characterize the behavior of the different follicles, hair stem cells will be collected from the bulbs, cultured, and then sorted using Fluorescent Automated Cell Sorting targetting CD24 and a6 integrin as specific markers of bulge stem cells. We will then study their division rate using microscopy. II. Characterization of the microenvironment of hair follicles. A. Assessment of elastic parameters of human skin using dynamic elastography. We will perform tissue stiffness measurement of the skin in vivo by sonoelastography and transient elastography. This technique uses Young's modulus as a parameter because it defines local tissue stiffness yielding local, quantitative information. We will use a high resolution device capable of measuring local Young's modulus in very thin layers and devoted to the in vivo evaluation of the elastic properties of human skin. It uses an ultrasonic probe (50 MHz) for tracking the displacements induced by a 300 Hz shear wave generated by a ring surrounding the transducer. B. Microbiota The skin is colonized by a diverse milieu of microorganisms, most of which are harmless or even beneficial to their host. Colonization is driven by the ecology of the skin surface, which is highly variable. We estimate that ~1 billion bacteria inhabit a typical square centimeter of skin covering the surface and extending down into the appendages and glands. Intrinsic factors as well as environmental factors influence the composition of skin microorganism communities. The topography of human skin varies at both microscopic and macroscopic levels. Distinct habitats are characterized by differences in skin thickness and folds and densities of hair follicles and glands. To consider the diversity of this microenvironment, and to test whether it has an impact on the anagen phase, it is necessary to take into account the topography of the environment. The ecosystem will be caracterized by using DNA barcoding, a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, the 16S rrna gene which is universal among prokaryotes.

4 We will use online databases, such as the Ribosomal Database Project (RDP), which catalog hundreds of thousands of validated 16S rrna gene sequences. Thus, sequencing of the 16S rrna gene facilitates identification of bacteria present in a given sample. Taking into account the diversity of these ecosystem implies to investigate what bacteria, fungi and virus are present on this two different environments. Since viruses don t contain a generic barcode gene, it was decided to sequence the whole genome of viruses in this work using Next Generation Sequence Technology. This implies extraction, PCR amplification, sequencing and database research in order to identify virus. III. How does the microenvironment of hair follicles influence their physiology? The first two aims of our project will have identified differences in the specific microenvironment of hair and eyebrow follicles, and differences in the physiology of the bulge cells. The next aim will be to determine if bulge cell physiology can be influenced by the identified parameters of the microenvironment. We will approach this question by using in vitro culture of bulge cells from hair and eyebrows, to specifically control their microenvironment. We will obtain hair stem cells from the brows and hair of the same population studied in the first part. We will culture the cells, and proceed to their sorting using Fluorescent Automated Cell Sorting using CD24 and a6 integrin as specific markers of bulge stem cells. If the first part of our project has revealed a difference in tissue stiffness between the epidermis of hair and brows, we will proceed to the culture of the stem cells on PDMS substrates. Varying the crosslinker concentrations will lead to substrates of different stiffness. We will then monitor the influence of stiffness on hair stem cell physiology, by considering the different parameters that we will have identified in the second part of our work, eg. size, rate of division, timing of differentiation process. We will also test the influence of the microbiome on these parameters by culturing the stem cells in presence of the different populations identified as being different from hair to brows in the previous section. D Scientific Interest in the project of all the participants and beyond The project is fully interdisciplinary and requires a wide range of theorical and technical knowledge. It is at the interface between microbiology, biophysics and physiology, and we will need knowledge in mechanical physics, medicine and chemistry to determine the environments for different hair. It will gather abilities in new methods like Next Generations Sequencing, and new ultrasound techniques. There are numerous challenges that will probably interest developmental biologists : this project will improve the understanding of the influence of the environment on tissue homeostasis medical imaging : the use of high frequency ultrasounds to study tissue mechanics will help improve the technique and will be a proof of concept for its use to study the epidermis

5 society : alopecia for example, a health problem. We may provide new information that could help improve this condition, through surgery or the use of probiotics cosmetic industry : to improve their products, shampoo for example E BUDGET (1 million euro max for 3 years including salaries, equipment, consumables, etc.) Consumables : ,12 /student/year = ,80 NGS : 1999,87 /run x 10 = ,70 Equipment fees (elastography, FACS) : ,00 Travel : 19850,25 x 3 years = ,75 Publications, etc = Staff : /student = Total : ,25

Hair Chemistry. Chapter 1. Hair Relaxers Science, Design, and Application

Hair Chemistry. Chapter 1. Hair Relaxers Science, Design, and Application Hair Relaxers Science, Design, and Application Chapter 1 Hair Chemistry We all know that the hair on our head is dead, but underneath the scalp, within the hair follicle, is a surprisingly

More information

Biology Institute: 7 PhD programs Expertise in all areas of biological sciences

Biology Institute: 7 PhD programs Expertise in all areas of biological sciences Biology Institute: 7 PhD programs Expertise in all areas of biological sciences!" #$%&'()*" '+**$,%' Biology Institute: PhD programs Programs Website: About the Biology Institute

More information

no!no! Thermicon: A Novel, Home-based Hair Removal Device Dr. Mira Barki Yavne, Israel Introduction Lasers and intense pulsed light sources have become a popular method for long-term removal of unwanted

More information

Biotechnology. Srivatsan Kidambi, Ph.D.

Biotechnology. Srivatsan Kidambi, Ph.D. Stem Stem Cell Cell Engineering-What, Biology and it Application Why, How?? to Biotechnology Srivatsan Kidambi, Ph.D. Assistant Professor Department of Chemical & Biomolecular Engineering University of

More information

What is androgenetic alopecia?

What is androgenetic alopecia? What is androgenetic alopecia? Androgenetic alopecia is also called male pattern alopecia. It refers to a symptom that develops after puberty, influenced by the androgen, where thinning and/or loss of

More information

where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results

where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results where hair grows Hair Restoration NO SCARS NO PAIN NO STRIPS It s your Hair - 100% Natural Results GOING BALD? HAIR LOSS? THINNING? NO MORE! - HAIR RESTORATION FROM FUECLINICS Hair transplantation involves

More information

All About Human Hair and Hair Loss. 1. Story

All About Human Hair and Hair Loss. 1. Story All About Human Hair and Hair Loss 1. Story Hair has always been an important sign of beauty. This is especially true for women. Next to the face, hair is one of the main qualities people look for when

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

High frequency low intensity current effects: bio-stimulation and cellular regeneration

High frequency low intensity current effects: bio-stimulation and cellular regeneration UNIVERSITA DEGLI STUDI DI PADOVA Dipartimento di Anatomia e Fisiologia Umana Department of Human Anatomy and Physiology High frequency low intensity current effects: bio-stimulation and cellular regeneration

More information

Preventing hair loss by balancing the hair cycle, strengthening the hair follicle, and improving scalp health

Preventing hair loss by balancing the hair cycle, strengthening the hair follicle, and improving scalp health Preventing hair loss by balancing the hair cycle, strengthening the hair follicle, and improving scalp health By Dr. M. Pflaumbaum*, M. Farwick, M. Mentel, T. Köhler Sphinganine-based ceramides represent

More information


PROPERTIES OF THE HAIR AND SCALP PROPERTIES OF THE HAIR AND SCALP 1. The scientific study of hair, its diseases and care is called: a. dermatology c. biology b. trichology d. cosmetology 2. The two parts of a mature hair strand are the

More information

Getting to the Root of Hair Loss

Getting to the Root of Hair Loss 26 March 2012 MP3 at Getting to the Root of Hair Loss Reuters An example of male pattern baldness SHIRLEY GRIFFITH: This is SCIENCE IN THE NEWS in VOA Special English. I'm Shirley

More information


MASTER OF SCIENCE IN BIOLOGY MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate

More information

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions

More information


BIOLOGICAL SCIENCES REQUIREMENTS [63 75 UNITS] Biological Sciences Major The Biological Sciences address many of the most important and fundamental questions about our world: What is life? How does our brain produce our ideas and emotions? What are

More information

Diablo Valley College Catalog 2014-2015

Diablo Valley College Catalog 2014-2015 Biological science BIOSC Diablo Valley College is approved by the California Board of Registered Nurses for continuing education credits. Biological Science courses which can be used are BIOSC-119, 120,

More information

Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot

Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot Chapter 1 All you need to know about hair almost Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot Typically

More information

FGF-1 as Cosmetic Supplement

FGF-1 as Cosmetic Supplement FGF-1 as Cosmetic Supplement Ing-Ming Chiu, Ph.D. Professor, Internal Medicine and Molecular and Cellular Biochemistry The Ohio State University Columbus, Ohio, U.S.A. GENTEON USA Fibroblast Growth Factor

More information

INNOVATION PRIZE 2008. PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells

INNOVATION PRIZE 2008. PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells INNOVATION PRIZE 2008 PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells PhytoCellTec Malus Domestica Plant stem cells to protect skin stem cells A Revolutionary Technology to Protect

More information


BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge

More information

It works. Hair loss prevention and hair regeneration study

It works. Hair loss prevention and hair regeneration study Hair loss prevention and hair regeneration study Report of the findings of the clinical trial to evaluate the effectiveness of VR6 hair treatment Study conducted by: Centro de Tecnología Capilar, SL Report

More information

Please visit your examination provider s website for the most current bulletin prior to testing. IMPORTANT INSTRUCTIONS

Please visit your examination provider s website for the most current bulletin prior to testing. IMPORTANT INSTRUCTIONS NATIONAL BARBER THEORY EXAMINATION CANDIDATE INFORMATION BULLETIN Please visit your examination provider s website for the most current bulletin prior to testing. The National Barber Theory Examination

More information

CAN ÇETİN. Adress +90 536 968 4800. Telephone. E- Mail & Skype

CAN ÇETİN. Adress +90 536 968 4800. Telephone. E- Mail & Skype CAN ÇETİN Adress Yeditepe University, Faculty of Engineering and Architecture Department of Genetics and Bioengineering Tissue Engineering Laboratory 34755 Kayışdağı - Istanbul Turkey Telephone E- Mail

More information

Notes on Hair Analysis

Notes on Hair Analysis Notes on Hair Analysis I have found local veterinarians very uncooperative when trying to get samples of dog and cat fur. I have found neighbors, friends and relatives a much better source of fur. There

More information

Metagenomics: : DNA Sequencing of Environmental Samples

Metagenomics: : DNA Sequencing of Environmental Samples Metagenomics: : DNA Sequencing of Environmental Samples Susannah Green Tringe and Edward M. Rubin Department of Energy Joint Genome Institute What is Metagenomics? Metagenomics is the study of genomes

More information

Master of Science in Biophysics, Biochemistry and Biotechnology

Master of Science in Biophysics, Biochemistry and Biotechnology Master of Science in Biophysics, Biochemistry and Biotechnology Tracks: Biophysics Biochemistry and Biotechnology Faculty of Science Faculty of Medicine KU Leuven. Inspiring the outstanding. Discover KU

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

Anatomy PHL 212. By Dr Tajdar Husain Khan

Anatomy PHL 212. By Dr Tajdar Husain Khan Anatomy PHL 212 By Dr Tajdar Husain Khan Overview of Anatomy Anatomy(from the Greek word anatome,"dissection") is a branch of natural science dealing with the structural organization of living things The

More information


TOPIC 1: ELECTROLYSIS AND OTHER METHODS OF REMOVING UNWANTED HAIR HAIR REMOVAL 16 Date: Rating: Text pages: 344 379 TOPIC 1: ELECTROLYSIS AND OTHER METHODS OF REMOVING UNWANTED HAIR 1 The removal of superfluous hair is a service offered by most salons a) What is the

More information

Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine

Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine Support Program for Improving Graduate School Education Advanced Education Program for Integrated Clinical, Basic and Social Medicine January 27, 2009 Dear Professors (representative) of departments, Subject:

More information

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z. Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.

More information

Biotechnical Engineering (BE) Course Description

Biotechnical Engineering (BE) Course Description Biotechnical Engineering (BE) Course Description The major focus of the Biotechnical Engineering TM (BE) course is to expose students to the diverse fields of biotechnology including biomedical engineering,

More information

AP Biology Learning Objective Cards

AP Biology Learning Objective Cards 1.1 The student is able to convert a data set from a table of numbers that reflect a change in the genetic makeup of a population over time and to apply mathematical methods and conceptual understandings

More information

Medical Laboratory Technology Program. Student Learning Outcomes & Course Descriptions with Learning Objectives

Medical Laboratory Technology Program. Student Learning Outcomes & Course Descriptions with Learning Objectives Medical Laboratory Technology Program Student Learning Outcomes & Course Descriptions with Learning Objectives Medical Laboratory Technology Student Learning Outcomes All Colorado Mesa University associate

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information



More information

Stephen Eubanks, M.D.

Stephen Eubanks, M.D. Stephen Eubanks, M.D. The Dermatology & Laser Center at Harvard Park Denver, Colorado Assistant Clinical Professor, Dept. Dermatology University of Colorado Health Sciences Center I would like to thank

More information

La capture de la fonction par des approches haut débit

La capture de la fonction par des approches haut débit Colloque Génomique Environnementale LYON 2011 La capture de la fonction par des approches haut débit Pierre PEYRET J. Denonfoux, N. Parisot, E. Dugat-Bony, C. Biderre-Petit, D. Boucher, G. Fonty, E. Peyretaillade

More information

Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015)

Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015) Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015) Preparatory Subject Matter......56-66 Biological Sciences 2A-2B-2C.....15 Chemistry 2A-2B-2C...15 Chemistry 8A-8B or 118A-118B-118C......6-12

More information

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data PIT Bioinformatics Group, Department of Computer

More information

Comprehensive Lab Kits & Digital Curriculum for Online Learners

Comprehensive Lab Kits & Digital Curriculum for Online Learners Allied Health Anatomy and Physiology Biology Chemistry Environmental Science Geology Microbiology Pharm Tech Physical Science Physics Comprehensive Lab Kits & Digital Curriculum for Online Learners supports

More information

Note: Semesters and years in which specific courses are offered are subject to change.

Note: Semesters and years in which specific courses are offered are subject to change. Biology Courses-1 Note: Semesters and years in which specific courses are offered are subject to change. BIO 099/Orientation to Biology 0 course units (8 weeks) (fall, annually) Required for all freshmen

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Advances in scmos Camera Technology Benefit Bio Research

Advances in scmos Camera Technology Benefit Bio Research Advances in scmos Camera Technology Benefit Bio Research scmos camera technology is gaining in popularity - Why? In recent years, cell biology has emphasized live cell dynamics, mechanisms and electrochemical

More information


FACULTY OF MEDICAL SCIENCE Doctor of Philosophy in Biochemistry FACULTY OF MEDICAL SCIENCE Naresuan University 73 Doctor of Philosophy in Biochemistry The Biochemistry Department at Naresuan University is a leader in lower northern

More information

CAP Accreditation Checklists 2015 Edition

CAP Accreditation Checklists 2015 Edition CAP Accreditation Checklists 2015 Edition The College of American Pathologists (CAP) accreditation checklists contain the CAP accreditation program requirements, developed on more than 50 years of insight

More information

Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL

Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL Graduate Certificate Pre-Med Program Course Descriptions For Year 2015-2016 FALL COURSE TITLE: BIOCHEMISTRY COURSE NUMBER: 5104 This course emphasizes biochemical compounds, processes and systems, designed

More information

Thick and Thin Evaluating layers of the skin

Thick and Thin Evaluating layers of the skin Overview Thick and Thin Evaluating layers of the skin Understanding the layered structure of skin is essential to understanding how it functions. The focus of this lesson is for students to discover and

More information

There are a wide range of factors that can impact on the health of the hair and hair growth.

There are a wide range of factors that can impact on the health of the hair and hair growth. Welcome to Viviscal Viviscal, one of the best selling hair growth supplement in the US, is now available with TVSN. The Viviscal brand of hair care products is enjoying rapid and substantial growth in

More information


BIOSCIENCES COURSE TITLE AWARD COURSE TITLE AWARD BIOSCIENCES As a Biosciences undergraduate student at the University of Westminster, you will benefit from some of the best teaching and facilities available. Our courses combine lecture,

More information


FACULTY OF MEDICAL SCIENCE Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research

More information

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions! AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square

More information

Bachelor of Science in Nursing Transfer Admission Information Packet. Preferred Application Deadlines

Bachelor of Science in Nursing Transfer Admission Information Packet. Preferred Application Deadlines Bachelor of Science in Nursing Transfer Admission Information Packet Preferred Application Deadlines Spring Semester: December 1 Fall Semester: February 15 Please read this Information Packet carefully

More information

VivaCell Services. Hair growth and prevention of hair loss

VivaCell Services. Hair growth and prevention of hair loss 2014 1/10 VivaCell Biotechnology GmbH VivaCell Services growth and prevention of hair loss VivaCell Biotechnology GmbH 2014 2/10 VivaCell Biotechnology GmbH Effects of natural products (extracts/compounds)

More information

2015-2016 Academic Catalog

2015-2016 Academic Catalog 2015-2016 Academic Catalog Master of Science or Arts in Biology Graduate Arts and Sciences Director: Dr. Karen Snetselaar (on sabbatical 2016) Science Center 225, 610-660-1826, Mission

More information

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!

More information

Biotechnology Test Test

Biotechnology Test Test Log In Sign Up Biotechnology Test Test 15 Matching Questions Regenerate Test 1. Plasmid 2. PCR Process 3. humulin 4. pluripotent 5. polymerase chain reaction (PCR) a b Is much smaller than the human genome,

More information

Quality and Safety Evaluation of Gene Therapy Products in Japan

Quality and Safety Evaluation of Gene Therapy Products in Japan Quality and Safety Evaluation of Gene Therapy Products in Japan Review Mechanism for Gene Therapy in Japan The review mechanism for gene therapy in Japan was partially amended to simplify the necessary

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Core Curriculum to the Course:

Core Curriculum to the Course: Core Curriculum to the Course: Basic Human Anatomy Basic Biochemistry General Cellular Biology Introduction to Ecology Basic Ecology General Biophysics and Physiology I General Biophysics and Physiology

More information

Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: Suzanne_moore@uml.

Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: Suzanne_moore@uml. Curriculum Vitae Suzanne E. Moore D.V.M 24 South Shore Road Salem, NH 03079 Cell phone number: 603-571-3550 Email: PROFESSIONAL PROFILE Accomplished career demonstrating consistent

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex

More information

Cell Biology Questions and Learning Objectives

Cell Biology Questions and Learning Objectives Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate

More information

A Correlation of Miller & Levine Biology 2014

A Correlation of Miller & Levine Biology 2014 A Correlation of Miller & Levine Biology To Ohio s New Learning Standards for Science, 2011 Biology, High School Science Inquiry and Application Course Content A Correlation of, to Introduction This document

More information

Fields of Education. Last updated August 2011

Fields of Education. Last updated August 2011 Fields of Education Last updated August 2011 Monash University is required to report to the Department of Education, Employment and Workplace Relations (DEEWR) the number of higher degree by research (HDR)

More information


NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT 1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun

More information

Pig skin as an alternative to human skin for skin metabolism studies?

Pig skin as an alternative to human skin for skin metabolism studies? Pig skin as an alternative to human skin for skin metabolism studies? H. Osman-Ponchet, A. Lemoine, A. Gaborit, K. Sevin, M. Alriquet, P. Comby, B. Ruty 2 nd Skin Metabolism Meeting October 10-11, 2013

More information

Identification of the androgen receptor aggregates that cause spinal-bulbar muscular atrophy

Identification of the androgen receptor aggregates that cause spinal-bulbar muscular atrophy Identification of the androgen receptor aggregates that cause spinal-bulbar muscular atrophy Dr Xavier Salvatella Giralt CSIC Consell Superior d'investigacions Científiques Institut Recerca Biomèdica de

More information

CHRONOCYCLIN. Cosmetic application. day and night skin care

CHRONOCYCLIN. Cosmetic application. day and night skin care Cosmetic application day and night skin care Temporary or long-term cutaneous damages overworked, tired, lack of sun exposure, jet lag anti-aging benefits Skin awakening Stimulation of cutaneous natural

More information


UPBM CURRICULAR BROCHURE UPBM CURRICULAR BROCHURE Undergraduate Program in Biology and Medicine Contents Academic Year 2015-16 About the Undergraduate Program in Biology and 1 Undergraduate 2-3 Getting

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

International Stem Cell Registry

International Stem Cell Registry International Stem Cell Registry Importance of Stem Cells Stem cells are model systems for the study of development and disease. Pluripotent stem cells offer new tools for drug design and discovery. Pluripotent

More information

BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516

BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516 BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516 1. Mission, Aims and Objectives The new BSc (Hons)/ MSc course is a

More information

A: Nursing Knowledge. Alberta Licensed Practical Nurses Competency Profile 1

A: Nursing Knowledge. Alberta Licensed Practical Nurses Competency Profile 1 A: Nursing Knowledge Alberta Licensed Practical Nurses Competency Profile 1 Competency: A-1 Anatomy and Physiology A-1-1 A-1-2 A-1-3 A-1-4 A-1-5 A-1-6 A-1-7 A-1-8 Identify the normal structures and functions

More information

A.C.N.E. H.E.L.P. Advanced Comedolytic & Normalizing Effect by Heat, Electricity & Light for Prevention & Treatment of Acne.

A.C.N.E. H.E.L.P. Advanced Comedolytic & Normalizing Effect by Heat, Electricity & Light for Prevention & Treatment of Acne. A.C.N.E. H.E.L.P. Advanced Comedolytic & Normalizing Effect by Heat, Electricity & Light for Prevention & Treatment of Acne. The acne More than 80% of the world population suffers at least once in a lifetime

More information


BIOSCIENCE. BIOSC 0070 BIOLOGY LABORATORY 1 1 cr. BIOSC 0080 BIOLOGY LABORATORY 2 1 cr. BIOSCIENCE BIOSC 0070 BIOLOGY LABORATORY 1 1 cr. Various morphological aspects and physiological processes in plants and animals are investigated. Corequisite: BIOSC 0170. BIOSC 0080 BIOLOGY LABORATORY

More information

7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)

7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) 7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 38 credit hours: 1- Basic requirements: 10 credit hours. 150701, 150702, 150703,

More information

Support structure for genetic material

Support structure for genetic material Support structure for genetic material 1 Making proteins in the RER Making copies of humans 2 Making copies of cells Making copies of genetic material 3 Making copies of genetic material Making copies

More information

Report and Recommendations of the Pathways Nursing Major Committee

Report and Recommendations of the Pathways Nursing Major Committee Report and Recommendations of the Pathways Nursing Major Committee Members: Candy Dato (chair), New York City College of Technology Alice Akan, Lehman College Mary Ellen McMorrow, College of Staten Island

More information

University of Babylon College of Dentistry Curriculum of first Year

University of Babylon College of Dentistry Curriculum of first Year University of Babylon College of Dentistry Curriculum of first Year The Name of Course Medical Chemistery The Number of Course Me. Ch 100 Number of unite 8 Total Hours 5 Theory Hours 3 5% 5% 10% 20% ---

More information

Biotechnology. Biotechnology s Laboratories. Lab Name Location Person in Charge Programs Served Courses Served. Biotechnology Department

Biotechnology. Biotechnology s Laboratories. Lab Name Location Person in Charge Programs Served Courses Served. Biotechnology Department Biotechnology s oratories Biotechnology Name Location Person in Charge Programs Served Courses Served General Biology W12-039 Zahra Yassin General Microbiology M12-132 Aisha Echtibi General (Basic Course)

More information


LEARN TO LOVE YOUR HAIR AGAIN WHAT YOU NEED TO KNOW ABOUT HAIR LOSS IN WOMEN LEARN TO LOVE YOUR HAIR AGAIN WHAT YOU NEED TO KNOW ABOUT HAIR LOSS IN WOMEN In collaboration with Prepared and Sponsored by What You Need to Know About Hair Loss in Women If you think your hair may be

More information

Medical Laboratory Sciences Department of Biology

Medical Laboratory Sciences Department of Biology Medical Laboratory Sciences Department of Biology mls Why Choose Medical Laboratory Sciences at the University of North Florida? The development of the Medical Laboratory Sciences (MLS) program is a result

More information

ALMOFRONT 2 cruise in Alboran sea : Chlorophyll fluorescence calibration

ALMOFRONT 2 cruise in Alboran sea : Chlorophyll fluorescence calibration Vol. 3 : 6-11, 2010 Journal of Oceanography, Research and Data ALMOFRONT 2 cruise in Alboran sea : Chlorophyll fluorescence calibration CUTTELOD Annabelle 1,2 and CLAUSTRE Hervé 1,2 1 UPMC, Univ. Paris

More information

Leiv Sigve Håvarstein

Leiv Sigve Håvarstein MICROBIAL BIOFILM Leiv Sigve Håvarstein NORWEGI IAN UNIVERS SITY OF LIFE SCIENCES Biofilms: The social life of microorganisms Aggregates of microbial cells at interfaces -solid-liquid -liquid-liquid -liquid-gaseous

More information

Influential passengers:

Influential passengers: Influential passengers: monitoring invasive species through High Throughput DNA Sequencing during EXPO2015 Maurizio Casiraghi ZooPlantLab, The research topics in the scientific area are committed to the

More information

Practical Cell Analysis

Practical Cell Analysis Practical Cell Analysis Dimitri Pappas Dept of Chemistry & Biochemistry, Texas Tech University, USA WILEY A John Wiley and Sons, Ltd, Publication Contents Preface Acknowledgments xiii xix 1 Getting Started

More information


OBJECTIVES PROCEDURE. Lab 2- Bio 160. Name: Lab 2- Bio 160 Name: Prokaryotic and Eukaryotic Cells OBJECTIVES To explore cell structure and morphology in prokaryotes and eukaryotes. To gain more experience using the microscope. To obtain a better

More information

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents Scientific Working Group on DNA Analysis Methods Validation Guidelines for DNA Analysis Methods Table of Contents Introduction.2 1. Definitions. 2 2. General Considerations 3 3. Developmental Validation..5

More information

Veterinary Testing. Classes of Test

Veterinary Testing. Classes of Test Veterinary Testing Classes of Test July 2014 Copyright National Association of Testing Authorities, Australia 2014 This publication is protected by copyright under the Commonwealth of Australia Copyright

More information

Prokaryotic and Eukaryotic Cells

Prokaryotic and Eukaryotic Cells Lab 2- Bio 201 Prokaryotic and Eukaryotic Cells Name: OBJECTIVES To explore cell structure and morphology in prokaryotes and eukaryotes. To gain more experience using the microscope, and in particular,

More information

Education & Training Plan Life Sciences Specialist Certificate Program with Externship

Education & Training Plan Life Sciences Specialist Certificate Program with Externship University of Texas at El Paso Professional and Public Programs 500 W. University Kelly Hall Ste. 212 & 214 El Paso, TX 79968 Contact: Sylvia Monsisvais 915-747-7578

More information

Acoustic GHz-Microscopy: Potential, Challenges and Applications

Acoustic GHz-Microscopy: Potential, Challenges and Applications Acoustic GHz-Microscopy: Potential, Challenges and Applications A Joint Development of PVA TePLa Analytical Systems GmbH and Fraunhofer IWM-Halle Dr. Sebastian Brand (Ph.D.) Fraunhofer CAM Fraunhofer Institute

More information

Biochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!!

Biochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!! Biochemistry Major Talk 2014-15 August 14, 2015 Department of Biochemistry The University of Hong Kong Welcome!!!!!!!!!!!!!! Introduction to Biochemistry A four-minute video:

More information

5-2008. Plant Stem Cell Extract for Longevity of Skin and Hair. D. Schmid, C. Schürch, P. Blum, E. Belser, F. Zülli:

5-2008. Plant Stem Cell Extract for Longevity of Skin and Hair. D. Schmid, C. Schürch, P. Blum, E. Belser, F. Zülli: 5-2008 English Edition International Journal for Applied Science Personal Care Detergents Specialties D. Schmid, C. Schürch, P. Blum, E. Belser, F. Zülli: Plant Stem Cell Extract for Longevity of Skin

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Biology Department Competitive Admission Requirements

Biology Department Competitive Admission Requirements GENERAL BIOLOGY BACHELOR OF SCIENCE IN BIOLOGY The General Biology option emphasizes breadth of training in Biology. As the most flexible among the options leading to a Science degree in Biology, students

More information

On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma

On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma On the origin of giant multinuclear Reed-Sternberg cells and the role of CD4 T cells in Hodgkin lymphoma Uber die Entstehung von multinuklearen Reed-Sternberg Riesenzellen und die Rolle von CD4 T-Zellen

More information