Genetic resources of Olea europaea L. in the Bologna province (Italy): SSR analysis and identification of local germplasm

Transcription

1 Adv. Hort. Sci., (2): Genetic resources of Olea europaea L. in the Bologna province (Italy): SSR analysis and identification of local germplasm T. Ganino* D. Beghè*, A. Rotondi**, A. Fabbri* * Dipartimento di Biologia Evolutiva e Funzionale, Sezione Biologia Vegetale, Università degli Studi di Parma, Via Usberti, 11/a, Parma, Italy. ** Istituto di Biometeorologia, Consiglio Nazionale delle Ricerche (IBIMET-CNR), Via Gobetti, 101, Bologna, Italy. Key words: ancient olive tree, genetic variability, microsatellite marker, molecular markers. Abstract: In Italy the number of olive cultivars is extremely high, and together with the best known and widespread ones, in the collections numerous minor local cultivars and ecotypes exist which have not been sufficiently characterized. In Emilia Romagna this aspect is less evident, but nevertheless a great numberof old olive trees and bushed is present on the northern slopes of the Apennins, to witness an olive cultivation which has always been present since the times of the Roman Empire. Many of these genotypes have been collected and characterized as not belonging to cultivars presently known, but which might have been cultivated in distant times. This kind of olive genetic diversity was studied using SSR technique, on plants growing in the Bologna area (IT). For genotype identification comparisons were made with a number of important cultivars of Central Italy. Screening was obtained by analysing patterns produced by 1 SSR primers. A dendrogram obtained from the analysis reveals the presence of an interesting amount of genetic diversity among the studied individuals. 1. Introduction The olive tree (Olea europaea L.), has been cultivated for 000 years in the Mediterranean basin, where 9% of world olive cultivation and production are concentrated; it is therefore particularly adapted to warm temperate zones, characterized by long and dry summers. Its resistance under limiting climatic conditions as to drought, temperature, soil salinity and lime content, unlike most other fruit crops, made it a hardy and long-living tree. Although olive origins and ancient history are still debated among scholars, it is commonly believed that its ancestors originated in Asia Minor, where wild forms are still widespread. From Asia Minor the domesticated form of olive would eventually spread to the whole Mediterranean area, as a companion of all civilizations, with no exceptions, which developed on its shores: from the Egyptians to the Minoans, to the Greeks and the Phoenicians; the latter brought the tree Received for publication February Accepted for publication 22 May to France, while the Greeks introduced it in Sicily; from Magna Grecia it finally reached Rome 00 years before Christ (Simmonds, 19; Rallo et al., 200). The diffusion of olive cultivation reached its climax with the conquests and trade of the Roman times, and the species was soon present in all territories bordering the Mediterranean Sea; this created the most economically important area of the crop, an area which soon reached Northern Italy and Emilia-Romagna. Olive cultivation in Emilia Romagna was subjected to ups and downs, depending on political-economical and environmental vicissitudes, with periods of expansion, and new introductions, followed by periods of sharp decline of productions, and disappearance of the crop from wide areas. All this determined the presence of a varied olive germplasm, the provenance of which was often forgotten. At any rate, our epoch has received a rich legacy of germplasm which might represent an important genetic wealth, both for olive breeding for extreme environments, and for scientific purposes, with reference to adaptation mechanisms to several biotic and abiotic factors of the olive environment. At the same time a renewed interest for the crop is growing and new plantations on a small scale are beco- 149

2 ming numerous in the western part of the region. This requires the acquisition of deeper information on the adaptation of foreign germplasm and on the features of the locally available genotypes. The correct identification of available genotypes is a key tool in any fruit industry; and this is particularly true when a fruit crop is being developed in a new area. Variety identification has for centuries been made according to phenotype, and utilising more or less sophisticated descriptor lists. This has proven insufficient for a definitive discrimination in many cases, and research has in the last years developed more reliable biomolecular tools. DNA fingerprinting techniques have already permitted a taxonomical revision within the genus Olea and the identification of markers associated to agronomically relevant characters (Rugini and Baldoni, 2003). Genetic variability of Olea europaea L. can be evaluated with several methods (Ganino et al., 200): morphological (Barranco et al., 2000), enzymatical (Ouazzani et al., 1993; Trujillo et al., 199), RAPD markers (Fabbri et al., 199; Belaj et al., 2001), AFLP markers (Angiolillo et al., 1999), SSR markers (Rallo et al., 2000; Cipriani et al., 2002; Ganino et al., 200) and analysis of chloroplast DNA(Besnard et al., 2002). The SSR technique appeared able to provide highly reliable markers to solve variety identification problems, as their high transferability, high polymorphism and co-dominance have been demonstrated (Sefc et al., 2000; Bandelj et al., 2002; Carriero et al., 2002; Cipriani et al., 2002; Marrazzo et al., 2002; Belaj et al., 2003, 2004; Ganino et al., 200). Olive culture in Emilia Romagna is mostly widespread in the south-eastern zones of the sub-costal area of the Region, ascribable to Romagna. In the recent years, new olive orchards were also established in the western hill zones, the Emilia section of the Region. Bologna represents one of the Emilia provinces where many ancient olive trees are still present. These ancient plants are often found near ancient villas, fortresses, or by the cloister of the several churches which characterise Bologna province. IBIMET-CNR of Bologna (IT) has begun in the year 2000 an activity of retrieval and description of ancient olive plants which, having adapted to the Bologna climate, can be defined as local ecotypes. The study and selection of the most interesting genotypes is the initial stage of the process of genetic and sanitary certification of ancient cultivars to be reintroduced in environments they had populated in the past (Baldini, 2003). Following morphological and molecular characterization a process of clonal selection was undertaken, and presently 8 autochthonous genotypes of Bologna province are being studied and evaluated in experimental plots (Rotondi et al., 200). The present research represents a second stage of molecular characterization of Bologna olive germplasm, which is particularly referred to the eastern part of the province, by adopting microsatellite molecular characterization. 2. Materials and Methods Material sampling and DNA extraction The studied plants are located east of Bologna, in the territories of Pianoro, Montecalvo and Imola. DNA extraction was made from leaves of 18 olive accessions (Table 1); the extraction of genome DNA was performed according to the CTAB methodology (Belaj et al., 2001). Table 1 - List of studied olive accessions Id. Accession Montecalvo1 Montecalvo2 Montecalvo3 Pasquini1 Pasquini2 Pasquini3 Pasquini4 Dall'Oglio1 Dall'Oglio2 Dall'Oglio3 Cocchi1 Cocchi2 Cocchi3 Cocchi4 Cocchi Toranello1 Toranello2 Toranello3 Two national genotypes ( Carolea and Frantoio ), to be inserted in each analysis as internal standards to verify the correct amplification, were added to the studied material; this latter DNA came from the collection field of Mirto - Crosia (Cosenza, Italy) of the Istituto Sperimentale per l Olivicoltura of Rende (Cosenza, Italy). SSR amplification For DNA amplification 1 couples of SSR primers (Table 2) of the series DCA, EMO, GAPU and UDO were used. The amplification reaction was made in a volume of 2 ml containing: 1x Reaction Buffer (Biotools, B & M Labs, S.A., Madrid, SP), 1. mm MgCl 2 (Biotools, B & M Labs, S.A., Madrid, SP), 0.2 mm dntps (Amersham Biosciences, Piscataway, USA), 0.2 mm primer (MWG Biotech, Ebersberg), 20 ng genomic DNA and 0. U di Taq polymerase (Biotools, B & M Labs, S.A., Madrid, SP). One primer of each pair (Forward) was end-labelled with a fluorescent tag (Cy or IRD 00) (MWG Biotech, Ebersberg). The amplification reaction was optimised in a thermal cycler MJ PCT 100 Research (Watertown, Mass.) programming a first passage at 9 C for minutes followed by 30 cycles of 4 s at 94 C, 4 s at the specific annealing temperature for each couple of primers (Table 2), 4 s at 2 C for denaturation, annealing and 1

3 Table 2 - Primer sequences, sequence lengths and annealing temperatures of the 1 microsatellites used Primer DCA 3 DCA 4 DCA DCA DCA 9 DCA13 DCA14 DCA1 DCA1 DCA1 DCA18 EMO 90 GAPU 9 GAPU 101 GAPU 103 UDO 24 UDO 043 For ' 3' Rev ' 3' CCCAAGCGGAGGTGTATATTGTTAC CTTAACTTTGTGCTTCTCCATATCC AACAAATCCCATACGAACTGCC GGACATAAAACATAGAGTGCTGGGG AATCAAAGTCTTCCTTCTCATTTCG GATCAGATTAATGAAGATTTGGG AATTTTTTAATGCACTATAATTTAC GATCTTGTCTGTATATCCACAC TTAGGTGGGATTCTGTAGATGGTTG GATCAAATTCTACCAAAAATATA AAGAAAGAAAAAGGCAGAATTAAGC CATCCGGATTTCTTGCTTTT CCCTGCTTTGGTCTTGCTAA CATGAAAGGAGGGGGACATA TGAATTTAACTTTAAACCCACACA GGATTTATTAAAAGCAAAACATACAAA TCGGCTTTACAACCCATTTC TGCTTTTGTCGTGTTTGAGATGTTG AGTGACAAAAGCAAAAGACTAAAGC CGTGTTGCTGTGAAGAAAATCG AGGGTAGTCCAACTGCTAATAGACG GATCCTTCCAAAAGTATAACCTCTC AACTGAACCTGTGTATCTTGCATCC TTGAGGTCTCTATATCTCCCAGGGG TATACCTTTTCCATCTTGACGC TTTTAGGTGAGTTCATAGAATTAGC TAATTTTTGGCACGTAGTATTGG GTTTTCGTCTCTCTACATAAGTGAC AGCGAATGTAGCTTTGCATGT CAAAGGTGCACTTTCTCTCG GGCACTTGTTGTGCAGATTG GCATCGCTCGATTTTTATCC CAATAACAAATGAGCATGATAAGACA TGCCAATTATGGGGCTAACT Size T ( C) (annealing) 0 2 primer extension, respectively; the last step included 8 min. of incubation at 2 C. The amplification products were separated with a CEQ 2000 Genetic Analysis System (Beckman Coulter, Inc.) sequencer on acrilamide CEQ Separation Gel LPA - 1 (Beckman Coulter, Inc.). The marker CEQ DNA S i z e Standard kit 400 (Beckman Coulter, Inc., Fullerton, CA, USA) was used to estimate the approximate molecular weight of the amplified products. SSR data analysis Allele sizing. The fragments were sized using a conservative binning approach (Kirby, 1990) using statistical R software base (R Development Core Team, 200), which takes into account the type of repeat and compensates for the limits of fragment resolution. Data pro c e s s i n g.the biodiversity of the studied population was evaluated according to number of alleles per locus within the population, allele frequency, heterozygosity percentage (H), both observed (H 0 ) an expected (H E ). Such values were obtained by utilising the software Identity 1.0 (Wagner and Sefc, 1999). Data were statistically processed by Statistica statistic analysis software (StatSoft Italia srl, Vigonza, Padova, Italy) for the construction of a dendrogram by the U P G M Amethod and Euclidean distance. Cultivar identification The data obtained by the analysis of local genotypes were compared with the genetic profiles of a number of olive cultivars present in the SSR Database of Parma University (Italy) (Beghè, 2008); the compared allele profiles were of 10 primers (DCA3, DCA4, DCA9, DCA1, DCA18, GAPU9, GAPU101, GAPU103, UDO24 and UDO43). For the comparison 43 cultivars were utilised from the collection of the Istituto Sperimentale per l Olivicoltura di Rende (Cosenza, Italy), of the del CNR IBI- M E T di Bologna (Italy) collection, and the collection made by Parma University in the Azienda Gavinell of Salsomaggiore Terme (Parma, Italy) (Table 3). Table 3 - List of cultivars utilised for the identification of the Bologna olive accessions Cultivar (z) Frantoio CS Canino CS Carolea CS Carbuncion CS Emilia CS Oliva Grossa CS Craputea CS Cassanese CS Leccino CS Santa Caterina CS Moraiolo CS Coratina CS Olivo delle Alpi CS Cucca CS Gremignolo di Bolgheri CS Taggiasca CS Razzola CS Spagnola di Missano CS Moraiolo PR Manzanilla CS Gordal Sevillana CS Arbequina CS Piqual CS Kalamata CS Koroneiki CS Picholine CS Colombina ER Correggiolo di Villa Verruchio ER Correggiolo di Montegridolfo ER Frantoio di Villa Verruchio ER Nostrana di Brisighella ER Ghiacciolo ER Rossina ER Selvatico ER Grappuda ER Capolga ER Orfana ER Moraiolo ER Carbuncion di Carpineta ER Leccino ER Ascolana Tenera PR Maurino PR Leccio del Corno PR (z) The cultivar name is tagged with the abbreviation of field collection provinces. CS= Mirto, Crosia, Cosenza, Italy; ER= CNR-IBIMET, Bologna, Italy; PR= Salsomaggiore Terme, Parma, Italy. 11

4 3. Results The 1 oligonucleotides belonging to the series DCA, EMO, GAPU and UDO have produced polymorphic and reproducible amplification fragments. Allele polymorphism has allowed the discrimination of the 18 analysed genotypes, producing 10 alleles with an average number, for the studied loci, of.1 (Tables 4 a and b). The value of expected heterozygosity (H E ) was always above 0. (with the exception of primer DCA1); this figure means the existence of a good genetic variability within the population, which in turn indicates the presence of genetically different individuals, interesting from the point of view of an eventual breeding activity. The relations among cultivars have been studied by cluster analysis (UPGMA) and by and Euclidean distance; after statistical analysis a dendrogram was generated from which differences emerged within the studied population (Fig. 1). The SSR markers identified within the 18 examined accessions 9 different genotypes from Romagna and one case of synonymy with cv. Frantoio (used as internal standard) (Fig. 1 and Table ); cv. Carolea, as expected, is genetically distant from the studied population. Montecalvo1 Dall Oglio2 Dall Oglio3 Dall Oglio1 Cocchi3 Toranello1 Toranello2 Toranello3 Pasquini4 Cocchi4 Montecalvo2 Montecalvo3 Cocchi1 Frantoio Cocchi Cocchi2 Pasquini1 Pasquini3 Pasquini2 Carolea Euclidean distance Fig. 1 - Dendrogram of Olea europaea L. genotypes, generated with Euclidean distance and UPGMA cluster analysis. The numbers indicate the genotype groups with complete identity or genotypes which differ by 1 to 4 alleles. Table 4 a - Allele size (bp), number of alleles per locus (n), allele frequency within the population (f), expected heterozygosity (H e ), observed heterozygosity (H o ). Each allele is indicated with a letter in italics (first column) Allele DCA3 f In the dendrogram (Fig. 1) four groups of accessions can be singled out which either show total genetic identity or can be considered clones of a same cultivar as they differ for 1 to 4 alleles (Table ). The four groups are indicated with the numbers 1, 2, 3 and 4, and include the accessions Montecalvo1, Dall Oglio2, Dall Oa b c d e f g h i l n H E H O Allele a b c d e f g h i l n H E H O DCA f DCA4 f DCA18 f DCA f EMO90 f DCA f DCA9 f D C A 1 3f D C A 1 4f GAPU9 f GAPU101 f GAPU103 f D C A 1 f U D O 2 4 f D C A 1 f Table 4 b - Allele size (bp), number of alleles per locus (n), allele frequency within the population (f), expected heterozygosity (H e ), observed heterozygosity (H o ). Each allele is indicated with a letter in italics (first column) U D O 4 3 f

5 glio3 and Dall Oglio1 (group 1), Toranello1, Toranello2 and Toranello3 (group 2), Cocchi1, Frantoio, Montecalvo3, Montecalvo2 and Cocchi (group 3), Pasquini1 and Pasquini3 (group 4). The differences within the 4 groups are illustrated by Table. The other accessions, with reference to this type of analysis, are ascribable to different genotypes. The studied population was then compared with the genetic profiles of some olive cultivars present in the SSR Database of Parma University (Italy) (Beghè, 2008), which produced some interesting results. From the dendrogram in figure 2 it can be noticed that some of the analysed accessions have been identified as belonging to cvs. Ascolana Tenera, Nostrana di Brisighella, Moraiolo and Santa Caterina, apart from the already mentioned synonymy of a few accessions with cultivar Frantoio (Figs. 1 and 2). In particular, Pasquini1 and 3 can be considered clones of Ascolana Tenera, with a difference of only 3 alleles; Cocchi4 can be considered a clone of Nostrana di Brisighella, as the difference is of 4 alleles; Cocchi3 can be considered a clone of Moraiolo, as the difference is of only 2 alleles; Pasquini2 can be considered a clone of Santa Caterina (although it requires further analysis), as the difference is of 4 alleles. Montecalvo1 Dall Oglio1 Dall Oglio2 Dall Oglio3 Piqual CS Pasquini1 Ascolana Tenera PR Oliva Grossa CS Pasquini3 Ghiacciolo ER Carolea CS Arbequina CS Pasquini4 Coratina CS Kalamata CS Cocchi 4 Nostrana di Brisighella ER Emilia CS Cocchi3 Moraiolo ER Moraiolo ER Moraiolo CS Toranello1 Toranello2 Toranello3 Carbuncion CS Rossina ER Selvatico ER Montecalvo2 Montecalvo3 Cocchi1 Correggiolo di Montegridolfo ER Correggiolo di Villa Verrucchio ER Frantoio di Villa Verrucchio ER Frantoio CS Razzola CS Cocchi Taggiasca CS Leccio del Corno PR Capolga ER Carbuncion di Carpineta ER Spagnola di Missano CS Karoneiki CS Maurino PR Gremignolo di Bolgheri CS Craputea CS Grappuda ER Cocchi2 Leccino ER Leccino CS Columbina ER Cucca CS Canino CS Cassanese CS Olivo delle Alpi CS Pasquini 2 Orfana ER Santa Caterina CS Gordan Sevillana Picholine CS Manzanilla CS Euclidean distance Fig. 2 - Dendrogram generated after the comparison of the Bologna genotypes with some olive varieties present in the Parma University SSR database (Italy) (Beghè 2008). Synonymies with known cultivar (complete identity or clones) are boxed. 13

6 4. Discussion and Conclusions From the genetic analysis several cases of synonymy emerged with cultivars common in Central Italy (Figs. 1 and 2). For these cultivars it is worthwhile to stress some of the varietal characters they display in the environment of origin. Ascolana Tenera. It is a table cultivar, diffused in the Marche region and widespread in all of Central Italy, some of its features are frost tolerance and selfcompatibility (Barranco et al., 2000); pollinators are cvs. Santa Caterina, Itrana, Rosciola, Morchiaio and Giarraffa. Frantoio. An oil cultivar widespread in all Central Italy, some of its features are poor frost tolerance and the production of high quality oil. It is considered self fertile but productivity improves when pollinated by suitable pollinators, such as Leccino, Maurino, Mignolo and Pendolino ; Frantoio is itself a good pollinator for a number of other cultivars (Barranco et al., 2000; Cimato et al., 2001). Santa Caterina. A table cultivar, diffused in Tuscany (Florence and Lucca olive districts); tolerates low winter temperatures. Its blooming time coincides with that of Frantoio, and is partially self fertile (Barranco et al., 2000; Cimato et al., 2001). Nostrana di Brisighella. An oil cultivar grown in the valleys of Senio and Lamone (province of Ravenna); frost tolerant, is partially self fertile (Rotondi et al., 2003, 2004). Moraiolo. This cultivar very hardy and prefers hilly environments, widespread in all Central Italy, it is self fertile and displays interincompatibility. There are several ecotypes (Barranco et al., 2000; Cimato et al., 2001). It therefore appears that the germplasm retrieved in the province of Bologna, which represented synonymy with known cultivars, possesses as common features the area of origin (or area of major present occurrence), self fertility and frost tolerance. All the originary cultivars are mostly diffused in Central Italy: Frantoio, Moraiolo and Santa Caterina have originated on Northern Tuscany; Ascolana Tenera is mostly present in Central Italy; Nostrana di Brisighella is instead only present in Romagna. As concerns frost tolerance, all so far identified cultivars have as a common character tolerance to low temperatures, with the exception of Frantoio, which is the main pollinator for all examined genotypes and is widely adopted due to the top quality of its oil. Finally, all these cultivars are totally or partially self fertile, a character not very common in olive germplasm: its presence explains the presence of isolated trees, which have consequently been able to guarantee a minimum of production over the centuries. The results obtained by the present molecular investigation allow us to draw some conclusions: - Thanks to SSRs it was possible to compare the data of Bologna germplasm with the SSR Database of Parma University (Italy) (Beghè, 2008). - The SSR markers proved to be a very reliable method of analysis. By utilising 1 primers 9 genotypes (out of a total number of 18 accessions) were isolated, and among them resulted to be synonyms of as many national cultivars, while the remainder 4 are 2 groups of accessions and two individual plants (Figs. 1 and 2). - The six national cultivars showing synonymy with the studied germplasm are characterised by having as zone of origin, or main diffusion, Central Italy; they are also considered relatively resistant to low temperatures (with the exception of Frantoio ), and are all more or less self fertile. The introduction of the olive therefore appears to have occurred from Central Italy, and in particular from Northern Tuscany for most genotypes. More work is left to be done to ascertain the provenance of the still unknown genotypes, provided they are still cultivated anywhere. Acknowledgements The Authors wish to thank Matteo Mari and Enrico Licausi for technical assistance. References ANGIOLILLO A., MENCUCCINI M., BALDONI L., Olive genetic diversity assessed using amplified length poly - morphisms. - Theor. Appl. Genet., 98: BALDINI E., Notizie sull olivicoltura Bolognese. - Ed. Accademia Nazionale di Agricoltura, Bologna. BANDELJ D., JAKŠE J., JAVORNIK B., DNA fingerprin - ting of olive varieties by microsatellite markers. - Food. Technol. Biotechnol., 40(3): BARRANCO D., CIMATO A., FIORINO P., RALLO L., TOU- ZANI A., CASTANEDAC., SERAFIN F., TRUJILLO I., World catalogue of olive varieties. - Consejo Oleìcolo Internacional, Madrid, Spain. BEGHÈ D., Studio sulla variabilità genetica e sulla prove - nienza del germoplasma di Olea europaea L. in Emilia. - Ph.D. Thesis, Dipartimento di Biologia Evolutiva e Funzionale, Università di Parma, Italy, pp BELAJ A., CIPRIANI G., TESTOLIN R., RALLO L., TRUJILLO I., Characterization and identification of the main Spa - nish and Italian olive cultivars by simple-sequence-repeat markers. - HortScience, 39(): BELAJ A., SATOVIC Z., CIPRIANI G., BALDONI L., TESTO- LIN R., RALLO L., TRUJILLO I., Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic rela - tionships in olive. - Theor. Appl. Genet., 10: BELAJ A., TRUJILLO I., DE LA ROSA R., RALLO L., Polymorphism and discrimination capacity of randomly ampli - fied polymorphic markers in an olive germplasm bank. - J. Amer. Soc. Hort. Sci., 12(1): 4-1. BESNARD G., KHADARI B., BARADAT P., BERVILLÉ A., Olea europaea (Oleaceae) phylogeography based on chloroplast DNA polymorphism. - Theor. Appl. Genet., 104: CARRIERO F., FONTANAZZA G., CELLINI F., GIORIO G., Identification of simple sequence repeats (SSRs) in olive (Olea europaea L.). - Theor. Appl. Genet., 104:

7 CIMATO A., CANTINI C., SANI G., L olivo in Toscana: il germoplasma autoctono. - Ed. ARSIA Toscana, IPSL, CNR, Regione Toscana, Firenze, Italy. CIPRIANI G., MARRAZZO M.T., MARCONI R., CIMATO A., TESTOLIN R., Microsatellite markers isolated in olive are suitable for individual fingerprinting and reveal poly - morphism within ancient cultivars (Olea europaea L.). - Theor. Appl. Genet., 104: FABBRI A., HORMAZA J.I., POLITO V.S., Random Amplified Polymorphic DNA analysis of olive (Olea europaea L.) cultivars. - J. Amer. Soc. Sci., 120(3): GANINO T., BARTOLINI G., FABBRI A., The classifica - tion of olive germplasm - A review. - J. Hortic. Sci. Biotech., 81(3): GANINO T., BEGHÈ D., VALENTI S., NISI R., FABBRI A., RAPD and SSR markers for characterization and iden - tification of ancient cultivars of Olea europaea L. in the Emilia region, Northern Italy. - Genet. Resour. Crop. Evol., 4(): KIRBY L.T., DNA fingerprinting: an introduction. - Stockton Press, New York, USA, pp. 3. MARRAZZO T., CIPRIANI G., MARCONI R., CIMATO A., TESTOLIN R., Isolation and characterisation of micro - satellite DNAin Olive (Olea europaea L.). - Acta Horticulturae, 8: 1-4. OUAZZANI N., LUMARET R., VILLEMUR P., GIUSTO F.D., Leaf allozyme variation in cultivated and wild olive trees (Olea europea L.). - J. Hered., 84: R DEVELOPMENT CORE TEAM, R: A language and environment for statistical computing. - R Foundation for Statistical Computing, Vienna, Austria. URL h t t p : / / w w w. R - project.org. RALLO L., BARRANCO D., CABALLERO J.M., DEL RIO C., MARTIN A., TOUS J., TRUJILLO I., Variedades de olivo en España. - Ediciones Mundi-Prensa, Madrid, Barcelona, México. RALLO P., DORADO G., MARTIN A., Development of simple sequence repeats (SSRs) in olive tree (Olea europaea L.). - Theor. Appl. Genet., 101: ROTONDI A., BALDONI L., CULTRERA N.G.M., MARIOTTI R., Alla scoperta delle varietà autoctone. - Il Divulgatore Olivo. Un rilancio all insegna della tipicità, XX(9/10): ROTONDI A., MAGLI M., RICCIOLINI C., BALDONI L., Morphological and molecuar analyses for the characteriza - tion of a group of Italian olive cultivars. - Euphytica, 132: ROTONDI A., MARI M., BABINI A.R., GOVONI M., CRISTO- FERI G., L attitudine alla propagazione e la certifica - zione genetica e sanitaria dell olivo in Emilia-Romagna. - Ed. La Mandragola, Imola, Italy. RUGINI E., BALDONI L., Le biotecnologie, pp In: FIORINO P. (ed.) Olea. Trattato di olivicoltura. Il Sole 24 Ore Edagricole, Bologna, Italy, pp. 42. SEFC K.M., LOPES M.S., MENDONÇA D., RODRIGUES DOS SANTOS M., LAIMER DA C Â M A R A M A C H A D O M., DA C Â M A R A MACHADO A., Identification of m i c rosatellite loci in olive (Olea europaea) and their charac - terization in Italian and Iberian olive tre e s. - Mol. Ecol., 9: SIMMONDS N.W., 19 - Evolution of crop plants. - Longman, London and New York. TRUJILLO I., RALLO L., ARUS P., Identifying olive cul - tivars by isozyme analysis. - J. Amer. Soc. Hort. Sci., 120: WAGNER H.W., SEFC K.M., Identity 1.0: freeware pro - gram for the analysis of microsatellite data