Genetic resources of Olea europaea L. in the Bologna province (Italy): SSR analysis and identification of local germplasm

Size: px
Start display at page:

Download "Genetic resources of Olea europaea L. in the Bologna province (Italy): SSR analysis and identification of local germplasm"

Transcription

1 Adv. Hort. Sci., (2): Genetic resources of Olea europaea L. in the Bologna province (Italy): SSR analysis and identification of local germplasm T. Ganino* D. Beghè*, A. Rotondi**, A. Fabbri* * Dipartimento di Biologia Evolutiva e Funzionale, Sezione Biologia Vegetale, Università degli Studi di Parma, Via Usberti, 11/a, Parma, Italy. ** Istituto di Biometeorologia, Consiglio Nazionale delle Ricerche (IBIMET-CNR), Via Gobetti, 101, Bologna, Italy. Key words: ancient olive tree, genetic variability, microsatellite marker, molecular markers. Abstract: In Italy the number of olive cultivars is extremely high, and together with the best known and widespread ones, in the collections numerous minor local cultivars and ecotypes exist which have not been sufficiently characterized. In Emilia Romagna this aspect is less evident, but nevertheless a great numberof old olive trees and bushed is present on the northern slopes of the Apennins, to witness an olive cultivation which has always been present since the times of the Roman Empire. Many of these genotypes have been collected and characterized as not belonging to cultivars presently known, but which might have been cultivated in distant times. This kind of olive genetic diversity was studied using SSR technique, on plants growing in the Bologna area (IT). For genotype identification comparisons were made with a number of important cultivars of Central Italy. Screening was obtained by analysing patterns produced by 1 SSR primers. A dendrogram obtained from the analysis reveals the presence of an interesting amount of genetic diversity among the studied individuals. 1. Introduction The olive tree (Olea europaea L.), has been cultivated for 000 years in the Mediterranean basin, where 9% of world olive cultivation and production are concentrated; it is therefore particularly adapted to warm temperate zones, characterized by long and dry summers. Its resistance under limiting climatic conditions as to drought, temperature, soil salinity and lime content, unlike most other fruit crops, made it a hardy and long-living tree. Although olive origins and ancient history are still debated among scholars, it is commonly believed that its ancestors originated in Asia Minor, where wild forms are still widespread. From Asia Minor the domesticated form of olive would eventually spread to the whole Mediterranean area, as a companion of all civilizations, with no exceptions, which developed on its shores: from the Egyptians to the Minoans, to the Greeks and the Phoenicians; the latter brought the tree Received for publication February Accepted for publication 22 May to France, while the Greeks introduced it in Sicily; from Magna Grecia it finally reached Rome 00 years before Christ (Simmonds, 19; Rallo et al., 200). The diffusion of olive cultivation reached its climax with the conquests and trade of the Roman times, and the species was soon present in all territories bordering the Mediterranean Sea; this created the most economically important area of the crop, an area which soon reached Northern Italy and Emilia-Romagna. Olive cultivation in Emilia Romagna was subjected to ups and downs, depending on political-economical and environmental vicissitudes, with periods of expansion, and new introductions, followed by periods of sharp decline of productions, and disappearance of the crop from wide areas. All this determined the presence of a varied olive germplasm, the provenance of which was often forgotten. At any rate, our epoch has received a rich legacy of germplasm which might represent an important genetic wealth, both for olive breeding for extreme environments, and for scientific purposes, with reference to adaptation mechanisms to several biotic and abiotic factors of the olive environment. At the same time a renewed interest for the crop is growing and new plantations on a small scale are beco- 149

2 ming numerous in the western part of the region. This requires the acquisition of deeper information on the adaptation of foreign germplasm and on the features of the locally available genotypes. The correct identification of available genotypes is a key tool in any fruit industry; and this is particularly true when a fruit crop is being developed in a new area. Variety identification has for centuries been made according to phenotype, and utilising more or less sophisticated descriptor lists. This has proven insufficient for a definitive discrimination in many cases, and research has in the last years developed more reliable biomolecular tools. DNA fingerprinting techniques have already permitted a taxonomical revision within the genus Olea and the identification of markers associated to agronomically relevant characters (Rugini and Baldoni, 2003). Genetic variability of Olea europaea L. can be evaluated with several methods (Ganino et al., 200): morphological (Barranco et al., 2000), enzymatical (Ouazzani et al., 1993; Trujillo et al., 199), RAPD markers (Fabbri et al., 199; Belaj et al., 2001), AFLP markers (Angiolillo et al., 1999), SSR markers (Rallo et al., 2000; Cipriani et al., 2002; Ganino et al., 200) and analysis of chloroplast DNA(Besnard et al., 2002). The SSR technique appeared able to provide highly reliable markers to solve variety identification problems, as their high transferability, high polymorphism and co-dominance have been demonstrated (Sefc et al., 2000; Bandelj et al., 2002; Carriero et al., 2002; Cipriani et al., 2002; Marrazzo et al., 2002; Belaj et al., 2003, 2004; Ganino et al., 200). Olive culture in Emilia Romagna is mostly widespread in the south-eastern zones of the sub-costal area of the Region, ascribable to Romagna. In the recent years, new olive orchards were also established in the western hill zones, the Emilia section of the Region. Bologna represents one of the Emilia provinces where many ancient olive trees are still present. These ancient plants are often found near ancient villas, fortresses, or by the cloister of the several churches which characterise Bologna province. IBIMET-CNR of Bologna (IT) has begun in the year 2000 an activity of retrieval and description of ancient olive plants which, having adapted to the Bologna climate, can be defined as local ecotypes. The study and selection of the most interesting genotypes is the initial stage of the process of genetic and sanitary certification of ancient cultivars to be reintroduced in environments they had populated in the past (Baldini, 2003). Following morphological and molecular characterization a process of clonal selection was undertaken, and presently 8 autochthonous genotypes of Bologna province are being studied and evaluated in experimental plots (Rotondi et al., 200). The present research represents a second stage of molecular characterization of Bologna olive germplasm, which is particularly referred to the eastern part of the province, by adopting microsatellite molecular characterization. 2. Materials and Methods Material sampling and DNA extraction The studied plants are located east of Bologna, in the territories of Pianoro, Montecalvo and Imola. DNA extraction was made from leaves of 18 olive accessions (Table 1); the extraction of genome DNA was performed according to the CTAB methodology (Belaj et al., 2001). Table 1 - List of studied olive accessions Id. Accession Montecalvo1 Montecalvo2 Montecalvo3 Pasquini1 Pasquini2 Pasquini3 Pasquini4 Dall'Oglio1 Dall'Oglio2 Dall'Oglio3 Cocchi1 Cocchi2 Cocchi3 Cocchi4 Cocchi Toranello1 Toranello2 Toranello3 Two national genotypes ( Carolea and Frantoio ), to be inserted in each analysis as internal standards to verify the correct amplification, were added to the studied material; this latter DNA came from the collection field of Mirto - Crosia (Cosenza, Italy) of the Istituto Sperimentale per l Olivicoltura of Rende (Cosenza, Italy). SSR amplification For DNA amplification 1 couples of SSR primers (Table 2) of the series DCA, EMO, GAPU and UDO were used. The amplification reaction was made in a volume of 2 ml containing: 1x Reaction Buffer (Biotools, B & M Labs, S.A., Madrid, SP), 1. mm MgCl 2 (Biotools, B & M Labs, S.A., Madrid, SP), 0.2 mm dntps (Amersham Biosciences, Piscataway, USA), 0.2 mm primer (MWG Biotech, Ebersberg), 20 ng genomic DNA and 0. U di Taq polymerase (Biotools, B & M Labs, S.A., Madrid, SP). One primer of each pair (Forward) was end-labelled with a fluorescent tag (Cy or IRD 00) (MWG Biotech, Ebersberg). The amplification reaction was optimised in a thermal cycler MJ PCT 100 Research (Watertown, Mass.) programming a first passage at 9 C for minutes followed by 30 cycles of 4 s at 94 C, 4 s at the specific annealing temperature for each couple of primers (Table 2), 4 s at 2 C for denaturation, annealing and 1

3 Table 2 - Primer sequences, sequence lengths and annealing temperatures of the 1 microsatellites used Primer DCA 3 DCA 4 DCA DCA DCA 9 DCA13 DCA14 DCA1 DCA1 DCA1 DCA18 EMO 90 GAPU 9 GAPU 101 GAPU 103 UDO 24 UDO 043 For ' 3' Rev ' 3' CCCAAGCGGAGGTGTATATTGTTAC CTTAACTTTGTGCTTCTCCATATCC AACAAATCCCATACGAACTGCC GGACATAAAACATAGAGTGCTGGGG AATCAAAGTCTTCCTTCTCATTTCG GATCAGATTAATGAAGATTTGGG AATTTTTTAATGCACTATAATTTAC GATCTTGTCTGTATATCCACAC TTAGGTGGGATTCTGTAGATGGTTG GATCAAATTCTACCAAAAATATA AAGAAAGAAAAAGGCAGAATTAAGC CATCCGGATTTCTTGCTTTT CCCTGCTTTGGTCTTGCTAA CATGAAAGGAGGGGGACATA TGAATTTAACTTTAAACCCACACA GGATTTATTAAAAGCAAAACATACAAA TCGGCTTTACAACCCATTTC TGCTTTTGTCGTGTTTGAGATGTTG AGTGACAAAAGCAAAAGACTAAAGC CGTGTTGCTGTGAAGAAAATCG AGGGTAGTCCAACTGCTAATAGACG GATCCTTCCAAAAGTATAACCTCTC AACTGAACCTGTGTATCTTGCATCC TTGAGGTCTCTATATCTCCCAGGGG TATACCTTTTCCATCTTGACGC TTTTAGGTGAGTTCATAGAATTAGC TAATTTTTGGCACGTAGTATTGG GTTTTCGTCTCTCTACATAAGTGAC AGCGAATGTAGCTTTGCATGT CAAAGGTGCACTTTCTCTCG GGCACTTGTTGTGCAGATTG GCATCGCTCGATTTTTATCC CAATAACAAATGAGCATGATAAGACA TGCCAATTATGGGGCTAACT Size T ( C) (annealing) 0 2 primer extension, respectively; the last step included 8 min. of incubation at 2 C. The amplification products were separated with a CEQ 2000 Genetic Analysis System (Beckman Coulter, Inc.) sequencer on acrilamide CEQ Separation Gel LPA - 1 (Beckman Coulter, Inc.). The marker CEQ DNA S i z e Standard kit 400 (Beckman Coulter, Inc., Fullerton, CA, USA) was used to estimate the approximate molecular weight of the amplified products. SSR data analysis Allele sizing. The fragments were sized using a conservative binning approach (Kirby, 1990) using statistical R software base (R Development Core Team, 200), which takes into account the type of repeat and compensates for the limits of fragment resolution. Data pro c e s s i n g.the biodiversity of the studied population was evaluated according to number of alleles per locus within the population, allele frequency, heterozygosity percentage (H), both observed (H 0 ) an expected (H E ). Such values were obtained by utilising the software Identity 1.0 (Wagner and Sefc, 1999). Data were statistically processed by Statistica statistic analysis software (StatSoft Italia srl, Vigonza, Padova, Italy) for the construction of a dendrogram by the U P G M Amethod and Euclidean distance. Cultivar identification The data obtained by the analysis of local genotypes were compared with the genetic profiles of a number of olive cultivars present in the SSR Database of Parma University (Italy) (Beghè, 2008); the compared allele profiles were of 10 primers (DCA3, DCA4, DCA9, DCA1, DCA18, GAPU9, GAPU101, GAPU103, UDO24 and UDO43). For the comparison 43 cultivars were utilised from the collection of the Istituto Sperimentale per l Olivicoltura di Rende (Cosenza, Italy), of the del CNR IBI- M E T di Bologna (Italy) collection, and the collection made by Parma University in the Azienda Gavinell of Salsomaggiore Terme (Parma, Italy) (Table 3). Table 3 - List of cultivars utilised for the identification of the Bologna olive accessions Cultivar (z) Frantoio CS Canino CS Carolea CS Carbuncion CS Emilia CS Oliva Grossa CS Craputea CS Cassanese CS Leccino CS Santa Caterina CS Moraiolo CS Coratina CS Olivo delle Alpi CS Cucca CS Gremignolo di Bolgheri CS Taggiasca CS Razzola CS Spagnola di Missano CS Moraiolo PR Manzanilla CS Gordal Sevillana CS Arbequina CS Piqual CS Kalamata CS Koroneiki CS Picholine CS Colombina ER Correggiolo di Villa Verruchio ER Correggiolo di Montegridolfo ER Frantoio di Villa Verruchio ER Nostrana di Brisighella ER Ghiacciolo ER Rossina ER Selvatico ER Grappuda ER Capolga ER Orfana ER Moraiolo ER Carbuncion di Carpineta ER Leccino ER Ascolana Tenera PR Maurino PR Leccio del Corno PR (z) The cultivar name is tagged with the abbreviation of field collection provinces. CS= Mirto, Crosia, Cosenza, Italy; ER= CNR-IBIMET, Bologna, Italy; PR= Salsomaggiore Terme, Parma, Italy. 11

4 3. Results The 1 oligonucleotides belonging to the series DCA, EMO, GAPU and UDO have produced polymorphic and reproducible amplification fragments. Allele polymorphism has allowed the discrimination of the 18 analysed genotypes, producing 10 alleles with an average number, for the studied loci, of.1 (Tables 4 a and b). The value of expected heterozygosity (H E ) was always above 0. (with the exception of primer DCA1); this figure means the existence of a good genetic variability within the population, which in turn indicates the presence of genetically different individuals, interesting from the point of view of an eventual breeding activity. The relations among cultivars have been studied by cluster analysis (UPGMA) and by and Euclidean distance; after statistical analysis a dendrogram was generated from which differences emerged within the studied population (Fig. 1). The SSR markers identified within the 18 examined accessions 9 different genotypes from Romagna and one case of synonymy with cv. Frantoio (used as internal standard) (Fig. 1 and Table ); cv. Carolea, as expected, is genetically distant from the studied population. Montecalvo1 Dall Oglio2 Dall Oglio3 Dall Oglio1 Cocchi3 Toranello1 Toranello2 Toranello3 Pasquini4 Cocchi4 Montecalvo2 Montecalvo3 Cocchi1 Frantoio Cocchi Cocchi2 Pasquini1 Pasquini3 Pasquini2 Carolea Euclidean distance Fig. 1 - Dendrogram of Olea europaea L. genotypes, generated with Euclidean distance and UPGMA cluster analysis. The numbers indicate the genotype groups with complete identity or genotypes which differ by 1 to 4 alleles. Table 4 a - Allele size (bp), number of alleles per locus (n), allele frequency within the population (f), expected heterozygosity (H e ), observed heterozygosity (H o ). Each allele is indicated with a letter in italics (first column) Allele DCA3 f In the dendrogram (Fig. 1) four groups of accessions can be singled out which either show total genetic identity or can be considered clones of a same cultivar as they differ for 1 to 4 alleles (Table ). The four groups are indicated with the numbers 1, 2, 3 and 4, and include the accessions Montecalvo1, Dall Oglio2, Dall Oa b c d e f g h i l n H E H O Allele a b c d e f g h i l n H E H O DCA f DCA4 f DCA18 f DCA f EMO90 f DCA f DCA9 f D C A 1 3f D C A 1 4f GAPU9 f GAPU101 f GAPU103 f D C A 1 f U D O 2 4 f D C A 1 f Table 4 b - Allele size (bp), number of alleles per locus (n), allele frequency within the population (f), expected heterozygosity (H e ), observed heterozygosity (H o ). Each allele is indicated with a letter in italics (first column) U D O 4 3 f

5 glio3 and Dall Oglio1 (group 1), Toranello1, Toranello2 and Toranello3 (group 2), Cocchi1, Frantoio, Montecalvo3, Montecalvo2 and Cocchi (group 3), Pasquini1 and Pasquini3 (group 4). The differences within the 4 groups are illustrated by Table. The other accessions, with reference to this type of analysis, are ascribable to different genotypes. The studied population was then compared with the genetic profiles of some olive cultivars present in the SSR Database of Parma University (Italy) (Beghè, 2008), which produced some interesting results. From the dendrogram in figure 2 it can be noticed that some of the analysed accessions have been identified as belonging to cvs. Ascolana Tenera, Nostrana di Brisighella, Moraiolo and Santa Caterina, apart from the already mentioned synonymy of a few accessions with cultivar Frantoio (Figs. 1 and 2). In particular, Pasquini1 and 3 can be considered clones of Ascolana Tenera, with a difference of only 3 alleles; Cocchi4 can be considered a clone of Nostrana di Brisighella, as the difference is of 4 alleles; Cocchi3 can be considered a clone of Moraiolo, as the difference is of only 2 alleles; Pasquini2 can be considered a clone of Santa Caterina (although it requires further analysis), as the difference is of 4 alleles. Montecalvo1 Dall Oglio1 Dall Oglio2 Dall Oglio3 Piqual CS Pasquini1 Ascolana Tenera PR Oliva Grossa CS Pasquini3 Ghiacciolo ER Carolea CS Arbequina CS Pasquini4 Coratina CS Kalamata CS Cocchi 4 Nostrana di Brisighella ER Emilia CS Cocchi3 Moraiolo ER Moraiolo ER Moraiolo CS Toranello1 Toranello2 Toranello3 Carbuncion CS Rossina ER Selvatico ER Montecalvo2 Montecalvo3 Cocchi1 Correggiolo di Montegridolfo ER Correggiolo di Villa Verrucchio ER Frantoio di Villa Verrucchio ER Frantoio CS Razzola CS Cocchi Taggiasca CS Leccio del Corno PR Capolga ER Carbuncion di Carpineta ER Spagnola di Missano CS Karoneiki CS Maurino PR Gremignolo di Bolgheri CS Craputea CS Grappuda ER Cocchi2 Leccino ER Leccino CS Columbina ER Cucca CS Canino CS Cassanese CS Olivo delle Alpi CS Pasquini 2 Orfana ER Santa Caterina CS Gordan Sevillana Picholine CS Manzanilla CS Euclidean distance Fig. 2 - Dendrogram generated after the comparison of the Bologna genotypes with some olive varieties present in the Parma University SSR database (Italy) (Beghè 2008). Synonymies with known cultivar (complete identity or clones) are boxed. 13

6 4. Discussion and Conclusions From the genetic analysis several cases of synonymy emerged with cultivars common in Central Italy (Figs. 1 and 2). For these cultivars it is worthwhile to stress some of the varietal characters they display in the environment of origin. Ascolana Tenera. It is a table cultivar, diffused in the Marche region and widespread in all of Central Italy, some of its features are frost tolerance and selfcompatibility (Barranco et al., 2000); pollinators are cvs. Santa Caterina, Itrana, Rosciola, Morchiaio and Giarraffa. Frantoio. An oil cultivar widespread in all Central Italy, some of its features are poor frost tolerance and the production of high quality oil. It is considered self fertile but productivity improves when pollinated by suitable pollinators, such as Leccino, Maurino, Mignolo and Pendolino ; Frantoio is itself a good pollinator for a number of other cultivars (Barranco et al., 2000; Cimato et al., 2001). Santa Caterina. A table cultivar, diffused in Tuscany (Florence and Lucca olive districts); tolerates low winter temperatures. Its blooming time coincides with that of Frantoio, and is partially self fertile (Barranco et al., 2000; Cimato et al., 2001). Nostrana di Brisighella. An oil cultivar grown in the valleys of Senio and Lamone (province of Ravenna); frost tolerant, is partially self fertile (Rotondi et al., 2003, 2004). Moraiolo. This cultivar very hardy and prefers hilly environments, widespread in all Central Italy, it is self fertile and displays interincompatibility. There are several ecotypes (Barranco et al., 2000; Cimato et al., 2001). It therefore appears that the germplasm retrieved in the province of Bologna, which represented synonymy with known cultivars, possesses as common features the area of origin (or area of major present occurrence), self fertility and frost tolerance. All the originary cultivars are mostly diffused in Central Italy: Frantoio, Moraiolo and Santa Caterina have originated on Northern Tuscany; Ascolana Tenera is mostly present in Central Italy; Nostrana di Brisighella is instead only present in Romagna. As concerns frost tolerance, all so far identified cultivars have as a common character tolerance to low temperatures, with the exception of Frantoio, which is the main pollinator for all examined genotypes and is widely adopted due to the top quality of its oil. Finally, all these cultivars are totally or partially self fertile, a character not very common in olive germplasm: its presence explains the presence of isolated trees, which have consequently been able to guarantee a minimum of production over the centuries. The results obtained by the present molecular investigation allow us to draw some conclusions: - Thanks to SSRs it was possible to compare the data of Bologna germplasm with the SSR Database of Parma University (Italy) (Beghè, 2008). - The SSR markers proved to be a very reliable method of analysis. By utilising 1 primers 9 genotypes (out of a total number of 18 accessions) were isolated, and among them resulted to be synonyms of as many national cultivars, while the remainder 4 are 2 groups of accessions and two individual plants (Figs. 1 and 2). - The six national cultivars showing synonymy with the studied germplasm are characterised by having as zone of origin, or main diffusion, Central Italy; they are also considered relatively resistant to low temperatures (with the exception of Frantoio ), and are all more or less self fertile. The introduction of the olive therefore appears to have occurred from Central Italy, and in particular from Northern Tuscany for most genotypes. More work is left to be done to ascertain the provenance of the still unknown genotypes, provided they are still cultivated anywhere. Acknowledgements The Authors wish to thank Matteo Mari and Enrico Licausi for technical assistance. References ANGIOLILLO A., MENCUCCINI M., BALDONI L., Olive genetic diversity assessed using amplified length poly - morphisms. - Theor. Appl. Genet., 98: BALDINI E., Notizie sull olivicoltura Bolognese. - Ed. Accademia Nazionale di Agricoltura, Bologna. BANDELJ D., JAKŠE J., JAVORNIK B., DNA fingerprin - ting of olive varieties by microsatellite markers. - Food. Technol. Biotechnol., 40(3): BARRANCO D., CIMATO A., FIORINO P., RALLO L., TOU- ZANI A., CASTANEDAC., SERAFIN F., TRUJILLO I., World catalogue of olive varieties. - Consejo Oleìcolo Internacional, Madrid, Spain. BEGHÈ D., Studio sulla variabilità genetica e sulla prove - nienza del germoplasma di Olea europaea L. in Emilia. - Ph.D. Thesis, Dipartimento di Biologia Evolutiva e Funzionale, Università di Parma, Italy, pp BELAJ A., CIPRIANI G., TESTOLIN R., RALLO L., TRUJILLO I., Characterization and identification of the main Spa - nish and Italian olive cultivars by simple-sequence-repeat markers. - HortScience, 39(): BELAJ A., SATOVIC Z., CIPRIANI G., BALDONI L., TESTO- LIN R., RALLO L., TRUJILLO I., Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic rela - tionships in olive. - Theor. Appl. Genet., 10: BELAJ A., TRUJILLO I., DE LA ROSA R., RALLO L., Polymorphism and discrimination capacity of randomly ampli - fied polymorphic markers in an olive germplasm bank. - J. Amer. Soc. Hort. Sci., 12(1): 4-1. BESNARD G., KHADARI B., BARADAT P., BERVILLÉ A., Olea europaea (Oleaceae) phylogeography based on chloroplast DNA polymorphism. - Theor. Appl. Genet., 104: CARRIERO F., FONTANAZZA G., CELLINI F., GIORIO G., Identification of simple sequence repeats (SSRs) in olive (Olea europaea L.). - Theor. Appl. Genet., 104:

7 CIMATO A., CANTINI C., SANI G., L olivo in Toscana: il germoplasma autoctono. - Ed. ARSIA Toscana, IPSL, CNR, Regione Toscana, Firenze, Italy. CIPRIANI G., MARRAZZO M.T., MARCONI R., CIMATO A., TESTOLIN R., Microsatellite markers isolated in olive are suitable for individual fingerprinting and reveal poly - morphism within ancient cultivars (Olea europaea L.). - Theor. Appl. Genet., 104: FABBRI A., HORMAZA J.I., POLITO V.S., Random Amplified Polymorphic DNA analysis of olive (Olea europaea L.) cultivars. - J. Amer. Soc. Sci., 120(3): GANINO T., BARTOLINI G., FABBRI A., The classifica - tion of olive germplasm - A review. - J. Hortic. Sci. Biotech., 81(3): GANINO T., BEGHÈ D., VALENTI S., NISI R., FABBRI A., RAPD and SSR markers for characterization and iden - tification of ancient cultivars of Olea europaea L. in the Emilia region, Northern Italy. - Genet. Resour. Crop. Evol., 4(): KIRBY L.T., DNA fingerprinting: an introduction. - Stockton Press, New York, USA, pp. 3. MARRAZZO T., CIPRIANI G., MARCONI R., CIMATO A., TESTOLIN R., Isolation and characterisation of micro - satellite DNAin Olive (Olea europaea L.). - Acta Horticulturae, 8: 1-4. OUAZZANI N., LUMARET R., VILLEMUR P., GIUSTO F.D., Leaf allozyme variation in cultivated and wild olive trees (Olea europea L.). - J. Hered., 84: R DEVELOPMENT CORE TEAM, R: A language and environment for statistical computing. - R Foundation for Statistical Computing, Vienna, Austria. URL h t t p : / / w w w. R - project.org. RALLO L., BARRANCO D., CABALLERO J.M., DEL RIO C., MARTIN A., TOUS J., TRUJILLO I., Variedades de olivo en España. - Ediciones Mundi-Prensa, Madrid, Barcelona, México. RALLO P., DORADO G., MARTIN A., Development of simple sequence repeats (SSRs) in olive tree (Olea europaea L.). - Theor. Appl. Genet., 101: ROTONDI A., BALDONI L., CULTRERA N.G.M., MARIOTTI R., Alla scoperta delle varietà autoctone. - Il Divulgatore Olivo. Un rilancio all insegna della tipicità, XX(9/10): ROTONDI A., MAGLI M., RICCIOLINI C., BALDONI L., Morphological and molecuar analyses for the characteriza - tion of a group of Italian olive cultivars. - Euphytica, 132: ROTONDI A., MARI M., BABINI A.R., GOVONI M., CRISTO- FERI G., L attitudine alla propagazione e la certifica - zione genetica e sanitaria dell olivo in Emilia-Romagna. - Ed. La Mandragola, Imola, Italy. RUGINI E., BALDONI L., Le biotecnologie, pp In: FIORINO P. (ed.) Olea. Trattato di olivicoltura. Il Sole 24 Ore Edagricole, Bologna, Italy, pp. 42. SEFC K.M., LOPES M.S., MENDONÇA D., RODRIGUES DOS SANTOS M., LAIMER DA C Â M A R A M A C H A D O M., DA C Â M A R A MACHADO A., Identification of m i c rosatellite loci in olive (Olea europaea) and their charac - terization in Italian and Iberian olive tre e s. - Mol. Ecol., 9: SIMMONDS N.W., 19 - Evolution of crop plants. - Longman, London and New York. TRUJILLO I., RALLO L., ARUS P., Identifying olive cul - tivars by isozyme analysis. - J. Amer. Soc. Hort. Sci., 120: WAGNER H.W., SEFC K.M., Identity 1.0: freeware pro - gram for the analysis of microsatellite data. - 1

DNA Sequence Analysis of Microsatellite Markers Enhances Their Efficiency for Germplasm Management in an Italian Olive Collection

DNA Sequence Analysis of Microsatellite Markers Enhances Their Efficiency for Germplasm Management in an Italian Olive Collection J. AMER. SOC. HORT. SCI. 131(3):352 359. 2006. DNA Sequence Analysis of Microsatellite Markers Enhances Their Efficiency for Germplasm Management in an Italian Olive Collection Innocenzo Muzzalupo and

More information

Molecular studies of Cumin (Cuminum

Molecular studies of Cumin (Cuminum Molecular studies of Cumin (Cuminum cyminum L.), for diversity and modeling National Research Centre on Seed Spices, Tabiji, Ajmer, Rajsthan-305206 Presented By: Dr. Sharda Choudhary Scientist Introduction

More information

DNA extraction from olive oil and its use in the identification of the production cultivar

DNA extraction from olive oil and its use in the identification of the production cultivar Food Chemistry 83 (2003) 127 134 Analytical, Nutritional and Clinical Methods DNA extraction from olive oil and its use in the identification of the production cultivar Matteo Busconi a, Chiara Foroni

More information

In Roman times, the need to identify and classify

In Roman times, the need to identify and classify Journal of Horticultural Science & Biotechnology (2006) 81 (3) 319 334 Review Article The classification of olive germplasm A review By T. GANINO 1 *, G. BARTOLINI 2 and A. FABBRI 1 1 Dipartimento di Biologia

More information

PERSIC VULGARIS MILL.

PERSIC VULGARIS MILL. //. 2008.. 6,.. 3. 8... //.,. 2008... 4 7. 9... //. 2003. 2.. 8 0. 0. - :.. / -..,. «-.», :...., 2008. 00.. Benbouza H., Jacquemin J.-M., Baudoin J.-P., Mergeai G. Optimization of a reliable, fast, cheap

More information

Chemical and organoleptic characterization of Italian monovarietal olive oils

Chemical and organoleptic characterization of Italian monovarietal olive oils Chemical and organoleptic characterization of Italian monovarietal olive oils Alfei B. 1, Magli M. 2, Rotondi A. 2, Pannelli G. 3 1 ASSAM Via Alpi, 21 60131 Ancona Italy 2 IBIMET-CNR Via Gobetti, 101 40129

More information

MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING

MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING Viktor Korzun Lochow-Petkus GmbH, Grimsehlstr.24, 37574 Einbeck, Germany korzun@lochow-petkus.de Summary The development of molecular techniques

More information

Cross-compatibility of the Parents as the Main Factor for Successful Olive Breeding Crosses

Cross-compatibility of the Parents as the Main Factor for Successful Olive Breeding Crosses J. AMER. SOC. HORT. SCI. 132(6):830 835. 2007. Cross-compatibility of the Parents as the Main Factor for Successful Olive Breeding Crosses Aurora Díaz 1,2 and Antonio Martín Instituto de Agricultura Sostenible-CSIC,

More information

Strawberry and Raspberry Fruit Differentiation Using the Agilent CE 2100 Bioanalyzer

Strawberry and Raspberry Fruit Differentiation Using the Agilent CE 2100 Bioanalyzer Strawberry and Raspberry Fruit Differentiation Using the Agilent CE 2100 Bioanalyzer Application Note Food Author Malcolm Burns, Rebecca Sanders, and Amy Burrell Bio-Molecular Innovation Team, LGC, Queens

More information

DISCRIMINATION AND ASSISTED SELECTION OF SAN MARZANO BY MEAN OF A NEW MOLECULAR MARKER FOR FRUIT SHAPE

DISCRIMINATION AND ASSISTED SELECTION OF SAN MARZANO BY MEAN OF A NEW MOLECULAR MARKER FOR FRUIT SHAPE DISCRIMINATION AND ASSISTED SELECTION OF SAN MARZANO BY MEAN OF A NEW MOLECULAR MARKER FOR FRUIT SHAPE N. ACCIARRI*, E. SABATINI*, S. VOLTATTORNI*,T.CIRIACI*, G. L. ROTINO** *) C.R.A. Istituto Sperimentale

More information

Effect of irrigation on fruit quality of table olives {Olea europaea), cultivar 'Ascolana tenera'

Effect of irrigation on fruit quality of table olives {Olea europaea), cultivar 'Ascolana tenera' New Zealand Journal of Crop and Horticultural Science, 1996, Vol.24: 175-181 0114-0671 /96/2402-0 i 75 $2.50/0 The Royal Society of New Zealand 1996 175 Effect of irrigation on fruit quality of table olives

More information

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA-PROFILING IN PARTICULAR. Eighth Session Tsukuba, Japan, September 3 to 5, 2003

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA-PROFILING IN PARTICULAR. Eighth Session Tsukuba, Japan, September 3 to 5, 2003 E BMT/8/8 ORIGINAL: English DATE: August 14, 200 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA-PROFILING IN PARTICULAR

More information

Traceability of Plant Contribution in Olive Oil by Amplified Fragment Length Polymorphisms

Traceability of Plant Contribution in Olive Oil by Amplified Fragment Length Polymorphisms J. Agric. Food Chem. 2005, 53, 6995 7002 6995 Traceability of Plant Contribution in Olive Oil by Amplified Fragment Length Polymorphisms SIMONA PAFUNDO, CATERINA AGRIMONTI, AND NELSON MARMIROLI* Division

More information

Flowering and Pollination Time Affect Fruit Set of Foreign Almond Cultivars in Morocco

Flowering and Pollination Time Affect Fruit Set of Foreign Almond Cultivars in Morocco Flowering and Pollination Time Affect Fruit Set of Foreign Almond Cultivars in Morocco O. Kodad 1 *, A. Oukabli 1, A. Mamouni 1, M. Lahlou 1 and R. Socias i Company 2 1 Unit of Plant Breeding and Genetic

More information

Mustard breeding in India, some recent developments

Mustard breeding in India, some recent developments Mustard breeding in India, some recent developments D. Pental and A. K. Pradhan Department of Genetics and Centre for Genetic Manipulation of Crop Plants University of Delhi South Campus, Benito Juarez

More information

FUTURE TRENDS IN CORN GENETICS AND BIOTECHNOLOGY. Bill Curran 1 INTRODUCTION

FUTURE TRENDS IN CORN GENETICS AND BIOTECHNOLOGY. Bill Curran 1 INTRODUCTION FUTURE TRENDS IN CORN GENETICS AND BIOTECHNOLOGY Bill Curran 1 INTRODUCTION Commercial corn breeding and trait integration have changed modern corn production. In recent years, technology advances for

More information

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C. Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH

More information

Policies - Italy Introduction. chain and. In addition, oil yields. their olives, costs. UN) 2009) Life. Employment in.

Policies - Italy Introduction. chain and. In addition, oil yields. their olives, costs. UN) 2009) Life. Employment in. Policies - Italy 2012 1. GENERAL DESCRIPTION OF OLIVE GROWING IN ITALY 1.1. Introduction Figure 1. Location of Italy (Source: UN) (Source: UNAPROL, 2010) The 2009/100 crop year was a complex period for

More information

Policies - Israel 2012

Policies - Israel 2012 1. GENERAL DESCRIPTION OF OLIVE GROWING IN ISRAEL 1.1. Introduction Figure 1. Location of Israel (Source: UN) About 8 percent of Israel's population lives in rural areas, mostly in villages in two unique

More information

Genetic Diversity and Correlation Analysis of Main Botany Characters in Watermelon Genetic Resources

Genetic Diversity and Correlation Analysis of Main Botany Characters in Watermelon Genetic Resources 2012 13 1 11-15 21 Journal of Plant Genetic Resources 450009 1200 12 12 1. 70 2. 37 1. 02 31. 8 1 ~ 3 4 4 Genetic Diversity and Correlation Analysis of Main Botany Characters in Watermelon Genetic Resources

More information

Analysis of Genetic Diversity Among Natural Hybrid Progenies of Camellia sinensis Huangshanzhong

Analysis of Genetic Diversity Among Natural Hybrid Progenies of Camellia sinensis Huangshanzhong 2010 37 8 1357 1362 Acta Horticulturae Sinica * 266109 ISSR 20.5% 12.5% ~ 33.2% Shannon-weave 1.89 1.60 ~ 2.07 22 ISSR 402 396 98.5% PIC 0.90 H Shannon I 0.32 0.49 Mantel r = 0.61 P = 0.01 ISSR ISSR S

More information

TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS

TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS J.-M. Lacape, T.-B. Nguyen, B. Hau, and M. Giband CIRAD-CA, Programme Coton, TA 70/03, Avenue Agropolis, 34398 Montpellier Cede

More information

Using Molecular Markers in Plant Genetics Research Unlocking genetic potential for increased productivity

Using Molecular Markers in Plant Genetics Research Unlocking genetic potential for increased productivity Using Molecular Markers in Plant enetics Research Unlocking genetic potential for increased productivity Molecular Markers Researchers at Pioneer blaze a new genetic trail. Identifying molecular markers

More information

Italian National Database of Monovarietal Extra Virgin Olive Oils

Italian National Database of Monovarietal Extra Virgin Olive Oils Chapter 8 Italian National Database of Monovarietal Extra Virgin Olive Oils Annalisa Rotondi, Massimiliano Magli, Lucia Morrone, Barbara Alfei and Giorgio Pannelli Additional information is available at

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-8 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Genomic Mapping & Mapping Databases High resolution, genome-wide maps of DNA markers. Integrated maps, genome catalogs and comprehensive

More information

Azienda Agricola Borghese Cavazza

Azienda Agricola Borghese Cavazza Azienda Agricola Borghese Cavazza The Farm The Borghese Cavazza Family has been olive farming on the western shores of lake Garda since the late 19 th century. The Farm occupies most of the San Fermo promontory

More information

An investigation of the self- and inter-incompatibility of the olive cultivars Arbequina and Koroneiki in the Mediterranean climate of Sicily

An investigation of the self- and inter-incompatibility of the olive cultivars Arbequina and Koroneiki in the Mediterranean climate of Sicily AJCS 10:88-93 (2016) ISSN:1835-2707 An investigation of the self- and inter-incompatibility of the olive cultivars Arbequina and Koroneiki in the Mediterranean climate of Sicily Annalisa Marchese*, Francesco

More information

Genetic Engineering of Poinsettia with the Aim of Enhancing its Resistance to Poinsettia Mosaic Virus

Genetic Engineering of Poinsettia with the Aim of Enhancing its Resistance to Poinsettia Mosaic Virus Genetic Engineering of Poinsettia with the Aim of Enhancing its Resistance to Poinsettia Mosaic Virus J.L. Clarke ¹, S.S. Klemsdal ¹, E. Fløistad ¹, A.K. Hvoslef-Eide 2, S. Haugslien ¹, R. Moe ², and D.R.

More information

Molecular Characterization of Opium Poppy (Papaver somniferum) Germplasm

Molecular Characterization of Opium Poppy (Papaver somniferum) Germplasm American Journal of Infectious Diseases 5 (2): 148-153, 2009 ISSN 1553-6203 2009 Science Publications Molecular Characterization of Opium Poppy (Papaver somniferum) Germplasm Hari Shanker Acharya and Vimal

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

(3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS

(3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS (3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS Ebenezer A. Ogundiwin 1, Antonio Granell 2, Thomas M. Gradziel 1, and Carlos H. Crisosto 1 1 Department of Plant Sciences,

More information

The Roman Republic. The Growth and Expansion

The Roman Republic. The Growth and Expansion The Roman Republic The Growth and Expansion January 4, 2016 AIM: To what extent does the political legacy of Ancient Rome continue today? DO NOW: Prepare for outline quiz. Homework: Outline The Rise of

More information

Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento. Università degli Studi di Napoli Federico II BIOGEM.

Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento. Università degli Studi di Napoli Federico II BIOGEM. Società Botanica Italiana Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento Università degli Studi di Napoli Federico II BIOGEM Organize the Summer School Challenges, methods

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

THE POLYMERASE CHAIN REACTION (PCR)

THE POLYMERASE CHAIN REACTION (PCR) THE POLYMERASE CHAIN REACTION (PCR) OBTECTIVE: To amplify a region of ribosomal DNA from a small amount of genomic DNA. INTRODUCTION: The polymerase chain reaction (PCR) was developed in 1983 by Kary Mullis,

More information

Proposta di studio multicentrico A.I.S.F. Genetica della PBC e PSC

Proposta di studio multicentrico A.I.S.F. Genetica della PBC e PSC Proposta di studio multicentrico A.I.S.F. Genetica della PBC e PSC Coordinatore Pietro Invernizzi A.I.S.F., Rome, 25 February 2011 STUDY 1 Primary biliary cirrhosis Identification of common and uncommon

More information

Amplification of fluorescent-labelled microsatellite markers in olives by a novel, economic method

Amplification of fluorescent-labelled microsatellite markers in olives by a novel, economic method Acta agriculturae slovenica, 83-2, november 2004 str. 323-329 Agrovoc descriptors: Olea europaea, olives, genotypes, microsatellites, genetic markers, pcr, loci Agris category code: F30 University of Primorska

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

EVALUATION OF GENETIC DIVERSITY IN WHEAT CULTIVARS AND BREEDING LINES USING INTER SIMPLE SEQUENCE REPEAT MARKERS

EVALUATION OF GENETIC DIVERSITY IN WHEAT CULTIVARS AND BREEDING LINES USING INTER SIMPLE SEQUENCE REPEAT MARKERS Article DOI: 10.5504/bbeq.2011.0093 B&E EVALUATION OF GENETIC DIVERSITY IN WHEAT CULTIVARS AND BREEDING LINES USING INTER SIMPLE SEQUENCE REPEAT MARKERS Abdollah Najaphy 1, Reza Ashrafi Parchin 1,2 and

More information

OF OLIVE. and table. 8 th in table exports. for over. Area: (World Bank, 2008) Bank, 2008) (Source: UN) Page 1 / 8

OF OLIVE. and table. 8 th in table exports. for over. Area: (World Bank, 2008) Bank, 2008) (Source: UN) Page 1 / 8 Policies - Argentina 2012 1. GENERAL DESCRIPTION OF OLIVE GROWING IN ARGENTINA 1.1. Introduction Figure 1. Location of Argentina (Source: UN) In recent years, Argentina has climbed to join the ranks of

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

ARIMNet 2 Call 2014-15

ARIMNet 2 Call 2014-15 Coordination of the Agricultural Research In the Mediterranean Area Call i text ARIMNet 2 Call 2014-15 SUBMISSION Pre-proposal by December 1 st, 2014 Full Proposal by May 11 th 2015 on http://arimnet-call.eu/

More information

Identification of apple cultivars on the basis of simple sequence repeat markers

Identification of apple cultivars on the basis of simple sequence repeat markers Identification of apple cultivars on the basis of simple sequence repeat markers G.S. Liu 1,2, Y.G. Zhang 2, R. Tao 3, J.G. Fang 3 and H.Y. Dai 2 1 College of Horticulture & Landscape, Hunan Agricultural

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Introduction to DiversiLab

Introduction to DiversiLab Introduction to DiversiLab Knokke 11 oktober 2011 Dirk Jansen Application Specialist BioMerieux Benelux 1 Content Introduction DiversiLab Explanation System Libraries Questions 2 - 2006 BBCI Bacterial

More information

New general objectives in breeding of berries and fruits and how they comply with societal targets

New general objectives in breeding of berries and fruits and how they comply with societal targets Questions to be discussed in the working groups and answered: On behalf of MTT Horitcultural production; Saila Karhu, Tuuli Haikonen, Hilma Kinnanen 2013-02-25 1) How can the Nordic bio-economy transformation

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

四川省主要杂交稻亲本的 SSR 多态性分析和指纹图谱的 构建与应用

四川省主要杂交稻亲本的 SSR 多态性分析和指纹图谱的 构建与应用 ( Chinese J Rice Sci), 2006, 20 (1) :1 7 http :/ / www. ricescience. org 1 SSR 1,2,3, # 1,2, # 1,2 1,2, 3 1,2, 3 ( 1, 611130 ; 2, 625014 ; 3, 610041 ; # ; 3, E2mail :lishigui_sc @263. net) SSR Marker2based

More information

WILLOCHRA BASIN GROUNDWATER STATUS REPORT 2009-10

WILLOCHRA BASIN GROUNDWATER STATUS REPORT 2009-10 WILLOCHRA BASIN GROUNDWATER STATUS REPORT 2009-10 SUMMARY 2009-10 The Willochra Basin is situated in the southern Flinders Ranges in the Mid-North of South Australia, approximately 50 km east of Port Augusta

More information

PCR-based technologies

PCR-based technologies Using molecular marker technology in studies on plant genetic diversity DNA-based technologies PCR-based technologies PCR basics Copyright: IPGRI and Cornell University, 2003 PCR basics 1 Contents! The

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

20-10-2015. DNA profiles in DUS testing of grasses. A new UPOV model? Lolium perenne (perennial ryegrass) Pilot study (2014)

20-10-2015. DNA profiles in DUS testing of grasses. A new UPOV model? Lolium perenne (perennial ryegrass) Pilot study (2014) 2--25 DNA profiles in DUS testing of grasses A new UPOV model? Henk Bonthuis Naktuinbouw Aanvragersoverleg Rvp Wageningsche Berg 9 oktober 25 Lolium perenne (perennial ryegrass) Challenges Genetically

More information

Perfect Match PCR Enhancer

Perfect Match PCR Enhancer Perfect Match PCR Enhancer Instruction Manual Catalog #600129 (100 U) and #600130 (200 U) Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 600129-12 LIMITED PRODUCT WARRANTY This

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Paul C Winter, Belfast City Hospital, Belfast, UK The polymerase chain reaction is a technique that allows DNA molecules of interest (usually gene sequences) to be copied

More information

ADOPTION OF METHYL BROMIDE ALTERNATIVES IN TOMATO AND VEGETABLE PRODUCTION IN SARDINIA

ADOPTION OF METHYL BROMIDE ALTERNATIVES IN TOMATO AND VEGETABLE PRODUCTION IN SARDINIA ADOPTION OF METHYL BROMIDE ALTERNATIVES IN TOMATO AND VEGETABLE PRODUCTION IN SARDINIA S. Leoni, L. Ledda, G. F. Marras Università degli Studi di Sassari Dipartimento di Scienze Agronomiche e Genetica

More information

The Role of Quality Evaluation in Seed Production as Exemplified by Soybean Seed Production. Francisco Carlos Krzyzanowski, Ph.D.

The Role of Quality Evaluation in Seed Production as Exemplified by Soybean Seed Production. Francisco Carlos Krzyzanowski, Ph.D. The Role of Quality Evaluation in Seed Production as Exemplified by Soybean Seed Production Francisco Carlos Krzyzanowski, Ph.D. Embrapa Soybean SEED CERTIFICATION SYSTEM STANDARDS To reach them, several

More information

SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2.

SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2. 41 1 () Vol. 41 No. 1 2002 1 Journal of Xiamen University (Natural Science) Jan. 2002 :043820479 (2002)20089205 SSR,,, (, 361005) :, GEN E BAN K, 2 SSR (Bn92A,Bn72A). PCR ( Touchdown PCR),,,, 12 DNA PCR.,PCR.

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... 66.1.1.1 Reagents and Equipment Required... 66.1.1.2 General Considerations

More information

E.Z.N.A. Plant Seed Direct PCR Kit

E.Z.N.A. Plant Seed Direct PCR Kit E.Z.N.A. Plant Seed Direct PCR Kit TQ2900-00 TQ2900-01 20 preps 100 preps June 2013 E.Z.N.A. Plant Seed Direct PCR Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3 Suggested

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

~I can identify modern day countries that were affected by ancient Rome. ~I can compare and contrast the geography of Rome and Greece.

~I can identify modern day countries that were affected by ancient Rome. ~I can compare and contrast the geography of Rome and Greece. Objective: I can examine and analyze thematic maps to learn about the physical geography of ancient Rome and how it influenced the development of Roman civilization. ~I can identify modern day countries

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Olive oil Italian focus

Olive oil Italian focus Olive oil Italian focus January 2015 Company profile Mintec Limited Mintec is the principal independent source of global information for commodities and raw materials. Mintec has a suite of unique procurement

More information

Portunidae 幷 [1] Genetic diversity. * 2006BAD03B Z M

Portunidae 幷 [1] Genetic diversity. * 2006BAD03B Z M Mar. 2010, Volume 4, No.2 (Serial No.27) Journal of Life Sciences, ISSN 1934-7391, USA 200090 幷 1. 幷 [1] [2] [3] [4] Scylla spp. Crustacea Decapoda Brachyura Portunidae 1. Genetic diversity * 2006BAD03B08-09

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

DEVELOPMENT OF RENEWABLE ENERGY IN SICILY

DEVELOPMENT OF RENEWABLE ENERGY IN SICILY DEVELOPMENT OF RENEWABLE ENERGY IN SICILY Claudio Basso (1), Fabio V. Matera* (2) (1) Regione Siciliana Assessorato Industria Ufficio Speciale per il Coordinamento delle Iniziative Energetiche, Unità Operativa

More information

Integration of Protein-protein Interaction Data in a Genomic and proteomic Data Warehouse

Integration of Protein-protein Interaction Data in a Genomic and proteomic Data Warehouse Integration of Protein-protein Interaction Data in a Genomic and proteomic Data Warehouse CANAKOGLU A, GHISALBERTI G, MASSEROLI M Dipartimentodi Elettronicae Informazione,Politecnicodi Milano, PiazzaLeonardoda

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

Programme Specification MSc in Molecular Genetics

Programme Specification MSc in Molecular Genetics Programme Specification MSc in Molecular Genetics Entry-level Honours degree in Bioscience subject or a science degree with a relevant bioscience component. Overall minimum level 2:2. International applicants

More information

Exercise 5: Detection of a Human Alu Element by PCR

Exercise 5: Detection of a Human Alu Element by PCR Exercise 5: Detection of a Human Alu Element by PCR (adapted from Dolan DNA Learning Center, Cold Spring Harbor Laboratory, NY and Science Outreach, Washington University, St. Louis, MO) Background Information

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

TRACING THE PEDIGREE OF CYNTHIANA GRAPE BY DNA MICROSATELLITE MARKERS

TRACING THE PEDIGREE OF CYNTHIANA GRAPE BY DNA MICROSATELLITE MARKERS Proc. Fla. State Hort. Soc. 118:200-204. 2005. TRACING THE PEDIGREE OF CYNTHIANA GRAPE BY DNA MICROSATELLITE MARKERS LELAN PARKER, PATRICIA BORDALLO AND VIOLETA COLOVA* Florida A & M University Center

More information

APPLICATION INFORMATION

APPLICATION INFORMATION -1895A APPLICATION INFORMATION Automated Solutions AUTOMATED METHODS FOR PCR SETUP ON THE IOMEK FX Lisa Knapp, Jason Fawcett, and Laura Pajak, Ph.D. eckman Coulter, Inc. Introduction Since the development

More information

GUIDELINE FOR THE ACCREDITATION OF LABORATORIES TESTING FOR GENETICALLY MODIFIED ORGANISMS (GMO)

GUIDELINE FOR THE ACCREDITATION OF LABORATORIES TESTING FOR GENETICALLY MODIFIED ORGANISMS (GMO) GUIDELINE FOR THE ACCREDITATION OF LABORATORIES TESTING FOR GENETICALLY MODIFIED ORGANISMS (GMO) ESYD G-GMO/01/00/20-10-2016 1/9 ESYD G-GMO Issue: 01 Revision: 00 Issue Date: 20-10-2016 Revision Date:

More information

Optimisation of Nitrogen Management for groundwater quality improvement and conservation LIFE04ENV/IT/000454 - OPTIMA-N

Optimisation of Nitrogen Management for groundwater quality improvement and conservation LIFE04ENV/IT/000454 - OPTIMA-N Optimisation of Nitrogen Management for groundwater quality improvement and conservation LIFE04ENV/IT/000454 - OPTIMA-N GENERAL OBJECTIVES! To verify the real contribution of the main agricultural practices

More information

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Super One-step RT-PCR Kit for Virus Detection

Super One-step RT-PCR Kit for Virus Detection Super One-step RT-PCR Kit for Virus Detection For fast and sensitive one-step RT-PCR with highly specificity www.tiangen.com/en SD121221 Super One-step RT-PCR Kit Kit Contents Contents Cat. no. SD103 SD103

More information

Stepping Towards Highly Flexible Aptamers: Enzymatic Recognition Studies of Unlocked Nucleic Acid Nucleotides

Stepping Towards Highly Flexible Aptamers: Enzymatic Recognition Studies of Unlocked Nucleic Acid Nucleotides Stepping Towards Highly Flexible Aptamers: Enzymatic Recognition Studies of Unlocked Nucleic Acid Nucleotides Camille Dubois, Meghan A. Campbell, Stacey Edwards, Jesper Wengel and Rakesh N. Veedu* Additional

More information

ITALIA GENERAL INFORMATION

ITALIA GENERAL INFORMATION Andrea Penasa Daniele Pasini Davide Boscaro Tommaso Marchesini ITALIA GENERAL INFORMATION Area: 301.340 km 2 Inhabitants: 59,7 million 20 Regions 24 Natural Parks Composition: Mountain 33,5% Hill 41,6%

More information

Effects of Space-induced Mutation and Analysis of Polymorphsim by AFLP Molecular Marker in Sesame

Effects of Space-induced Mutation and Analysis of Polymorphsim by AFLP Molecular Marker in Sesame 华北农学报 2013,28 ( 1 ) : 2 27-2 3 3 AFLP 1 1 1 1 1 2 1. 450008 2. 453003 8 11 D15 05N01 06ms198 5 SP3 SP4 11 AFLP 53 cm 77 cm 16 cm 122 / 0. 53 g 478. 54 kg /hm 2 36 cm 30 cm 19 cm 197 / 0. 64 g 1 013. 81

More information

APPLICATION INFORMATION

APPLICATION INFORMATION A-10484A APPLICATION INFORMATION Genetic Analysis SNPS. MUTATIONS AND DNA SEQUENCE VARIATION ANALYSIS USING THE GENOMELAB SNPSTART KIT Nitin Udar, Jana Mariana, Margaret Porter and Doni Clark Beckman Coulter

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

CHARACTERIZATION, CHALLENGES, AND USES OF SORGHUM DIVERSITY TO IMPROVE SORGHUM THROUGH PLANT BREEDING

CHARACTERIZATION, CHALLENGES, AND USES OF SORGHUM DIVERSITY TO IMPROVE SORGHUM THROUGH PLANT BREEDING 1 ST EUROPEAN SORGHUM CONGRESS WORKSHOP INNOVATIVE RESEARCH TOWARDS GENETIC PROGRESS CHARACTERIZATION, CHALLENGES, AND USES OF SORGHUM DIVERSITY TO IMPROVE SORGHUM THROUGH PLANT BREEDING MAXIMISING RESULTS

More information

Extension Viticulture Program

Extension Viticulture Program Extension Viticulture Program Bernd Maier Extension Viticulture Specialist 575 642 6553 bemaier@nmsu.edu viticulture.nmsu.edu Cooperative Extension Service Subjects of Engagement Supporting agents with

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Next Generation Polymerase Chain Reaction

Next Generation Polymerase Chain Reaction Next Generation Polymerase Chain Reaction Developed by Nobel laureate Kary Mullis in the 1980s, Polymerase Chain Reaction (PCR) is a molecular technology that allows fast and in vitro. It has since become

More information

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents Scientific Working Group on DNA Analysis Methods Validation Guidelines for DNA Analysis Methods Table of Contents Introduction.2 1. Definitions. 2 2. General Considerations 3 3. Developmental Validation..5

More information

COFFEE LEAF RUST: INDIA S EXPERIENCE

COFFEE LEAF RUST: INDIA S EXPERIENCE COFFEE LEAF RUST: INDIA S EXPERIENCE Jawaid Akhtar Chairman, Coffee Board of India Coffee leaf rust Indian perspective Coffee leaf rust (CLR) spread to India from Sri Lanka during 1870 s and caused large

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

A guide to the analysis of KASP genotyping data using cluster plots

A guide to the analysis of KASP genotyping data using cluster plots extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing A guide to the analysis of KASP genotyping data using cluster plots Contents of

More information