PHYLOGENETIC STUDIES IN APIACEAE USING RAPD AND SSR MARKERS

Transcription

1 J. CYTOL. GENET. VOL. 18 (NS): 9 20 (2017) PHYLOGENETIC STUDIES IN APIACEAE USING RAPD AND SSR MARKERS M. GOWRI NEELIMA Department of Biotechnology, Maharani Lakshmi Ammani College for Women, Malleswaram, Bengaluru , India For correspondence. mgowrineelima@gmail.com (Received 17 January 2017, revised accepted 7 July 2017) SUMMARY SSR markers developed for Apiaceae and other families were successfully checked for polymorphism among the selected plants Anethum graveolens, Apium graveolens, Coriandrum sativum, Petroselinum crispum, Angelica archangelica, Daucus carota, Centella asiatica, Begonia erythrophylla and Regelia sp. Primers designed for the selected SSRs and RAPD primers were randomly selected from Operon systems. The designed primers show the presence of common SSRs among both the families of Apiaceae and Brassicaceae. The phylogenetic analysis performed by DARWIN software for SSRs revealed close relationship between coriander and parsely, celery and coriander as well as begonia and regelia. Even though, coriander native and hybrid come in the same cluster, significant distant relationship was observed between them which was not expected. RAPD scoring data for the same plants were performed using UPGMA software, showed close relationship between anthem and regelia, carrot and begonia as well as Apium graveolens and P. crispum. Coriander native and Centella asiatica showed distant relationship for the selected markers. Keywords: Apiaceae, genetic distances, polymorphism, phylogenetic analysis. INTRODUCTION Apiaceae includes many important vegetable and spice crop species. Among flowering plants, Apiaceae is ranked sixteenth and includes well known plants like asafoetida, carrot, celery, coriander, cumin, parsley, centella, etc. Familiar vegetables, flavorings or garnishes belonging to this family include angelica, anise, caraway, celery, chervil, coriander, cilantro, cumin, dill, fennel, lovage, parsley and parsnip. This family also includes some deadly poisonous plants like water hemlock, poison hemlock, hemlock water-dropwort, and fool s parsley. However, despite their large size, widespread distribution and economic importance, no widely acceptable modern classification is available. Molecular method is one of the best methods for identification and classification of different species of herbs and medicinal plants and also for evaluation of genetic diversity within and among J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2,

2 GOWRI NEELIMA: species as well as plant populations (Abdul et al. 2012, Ilham Eroz Payraz et al. 2012, Meng-Yao Li et al. 2014, Solonki et al. 2012). Molecular markers are most widely used to track loci in plant genomes for crop breeding programmes (Powell et al. 1996). A large number of molecular markers that are tightly linked to disease resistance traits were identified and made it available in major crop species (Joshi et al. 1999). The majority of molecular markers have been identified from genomic DNA libraries or from libraries of randomly amplified PCR fragments (Islam et al. 2012, Prabakaran et al. 2010). Molecular markers play a very important role for mapping genes of interest, marker assisted breeding, and cloning genes using mapping-based cloning strategies (Antonio et al. 2004, Guo Qi Song et al. 2010, Islam et al. 2012). There are many plant species which we consume every day and many of them are not exploited to understand the polymorphism among them. The traditional and medicinal values perspective of these species made it inevitable to understand the genetic diversity among them. The development and assessment of genotypes on the basis of molecular markers in recent years has opened a new era in understanding varied species (Joshi et al. 1999). In this study, we are making an attempt to exploit the use of the molecular markers among different plant species, viz., Anethum graveolens, Apium graveolens, Coriandrum sativum, Petroselinum crispum, Angelica archangelica, Daucus carota, Centella asiatica, Begonia erythrophylla and Regalia sp. MATERIALS AND METHODS The fresh plant materials were collected from local gardens and genomic DNA was extracted by using modified CTAB method (Doyle & Doyle 1990). Primer designing for SSRs Sequences containing >7 bp microsatellite regions were selected for primer designing using Primer BLAST software. Parameters considered for designing primers are, GC: 50 60%; Tm: difference not more than 5; primer length: bp; product length: bp Quality >80 was done using Fast PCR. The SSR primers designed were named and given in Table 1. The oligos were custom synthesized as desalted oligos (Bioserve). Universal primers of RAPD were selected for the present work and listed in Table 2. Standardization of SSR primers Designed primers were standardized by using genomic DNA as template to arrive at the optimum annealing temperature for each primer. PCR amplifications were carried out in a 15 µl reaction volume containing genomic DNA (20 ng/µl), PCR Buffer (1x), MgCl 2 (2.5 mm), 2 mm dntps, 2 µm forward and reverse primers and 1 unit Taq DNA polymerase. Amplification was performed in a Eppendorf Master Cycler programmed for initial denaturation at 94 C for 5 min, followed by 30 cycles of which each cycle consisting of denaturation at 94 C for 1 min, gradient annealing temperature (± 5 C of oligos Tm) for 50 sec primer extension at 72 C for 40 sec and a final extension of 10 min at 72 C. The amplified products were resolved on 4% agarose gel in 1x TAE (Tris-base, Acetic acid, EDTA Disodium salt, ph 8.0) buffer. The gel was documented using SynGene Gel Documentation system. 10 J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2, 2017

3 MOLECULAR DIVERSITY IN APIACEAE TABLE 1: Primers selected for SSR. Suitable Working Primer Motif FP/ Sequence mers annealing annealing Product R P temperature temperature size (bp) in Celcius in Celcius Caulissr (GTCA)3 F P CCACAGCCACAACCATTTC R P CCATCAACCTCTAACGCC Basellchlsssr (AATG)3 F P CGGGGATTATATATAGGGGGCG R P GCACACGGCTTTCCCTATG Spinassr ( T GT T ) 5 F P CATTGCCCCTGCCTTTATGG R P CATGATGGGGCTGTCACCAAG Baraicassr ( TATA) 4 F P GATCGGACGGTGGAGATGAG R P GAGCAAGTACGCACAGAGAG Spiachlssr ( AT TA) 4 F P GTTCGAGTACCAGGCG R P CTTCCCTTGACCTTCCG Apium (GA)5 F P GCTCTGGAAACGTGAACTGGA R P TGGCCAATGTCTTTCCGCAT Petrosi (GCA)4 F P TTGTTTGGACCCACCATTGC R P CGAATCATCTCCCTGCACCT Centellassr (TA)7 F P GAACCACTAGACGATGG R P CTGACGAACCAAACACTC Corissr (GAAGA)2 F P GTCGCTTCTTGACTTCAG R P CCAACCTCATAACACCTCAC Trigossr (CAGAGT)2 F P CACTGCATCGAACTAAGGC R P GTTCCCACTGCTCCAAATC Data analysis Phylogenetic analysis was done by DARWIN software. Gene diversity is often referred to as expected heterozygosity and is defined as the probability that two randomly chosen alleles from the population are different. An unbiased estimator of gene diversity at the lth locus is J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2,

4 GOWRI NEELIMA: TABLE 2: Primers used for RAPD analysis. Primer Sequence Working annealing temperature in Celcius OPB-09 TGGGGGACTC 3 3 OPD-11 AGCGCCATTG 3 4 OPW-16 CAGCCTACCA 3 4 OPA-18 AGGTGACCGT 3 2 D 1= (1 A Plu 2 (1 u=1 n where the inbreeding coefficient, f, is estimated from the data using the method of moments. The user can also request the common biased estimator of the gene diversity: D 1= (1 A Plu 2 u=1 The genetic similarity and distance estimated by Nei s coefficient between pairs and dendrogram based upon the Unweighted Pair Group Method with Arithmetical Averages (UPGMA) were analyzed using DendroUPGMA ( genomes.urv.cat/upgma/) software. The UPGMA algorithm constructs a rooted tree (dendrogram) that reflects the structure present in a pairwise similarity matrix (or a dissimilarity matrix). At each step, the nearest 2 clusters are combined into a higher-level cluster. The distance between any 2 clusters A and B is taken to be the average of all distances between pairs of objects x in A and y in B, i.e., the mean distance between elements of each cluster. OBSERVATIONS The present study was initiated for generating genetic diversity among selected species of Apiaceae (Umbelliferae) and understand the presence or absence of selected SSRs. Identified SSRs from genomic data from NCBI was used to synthesize primers and were used to check their expandability in different related species like celery, parsley, centella, dill, celery-green, coriander hybrid, coriander native, carrot and thereby indicating their genetic variability and polymorphism. The study also emphasises that the SSRs designed from one family can be exploited to understand their differences and relatedness with other families and in turn diversity among them. Designing of primers All the available EST sequences from the database for the selected plants was analyzed for the presence of SSRs using software mreps. Among the EST sequences single repeats were available but not di, tri, tetra and penta and hence we decided to find SSRs from nucleotide sequences from the available database and we were able to identify good microsatellite regions with di, tri, tetra, penta and hexa repeats etc. 12 J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2, 2017

5 MOLECULAR DIVERSITY IN APIACEAE The selected sequences with microsatellite repeats was used to design primers using primer3 software. All the primers designed were further checked for Insilico analysis by means of Fast PCR. Certain primers were manually designed using Fast PCR to obtain conditions such as GC:50 60%; Tm: difference not more than 5; primer length: bp; product length: bp and quality >80. The analyzed primers having all the characteristics were ordered and procured from BioServe, Hyderabad. Thus, obtained primers were diluted according to Bioserve report to make up to 100 Pico moles. This was further diluted to 10 Pico moles and used for PCR reactions with the genomic DNA of selected plants. Primers from Apiaceae and other related family were also included in this work to check the transferability of the microsatellite in other families. Transferability of SSRs markers within the family and across the family was observed. Hence, primers designed had been taken not only from Apiaceae but also from Brassicaceae. The designed primers were listed in Table 1. RAPD primers are in general universal and hence selected from operon systems and tabulated in Table 2. DNA isolation Plant genomic DNA from the 10 selected plants was extracted using CTAB method and confirmed by means of agarose gel electrophoresis (Fig.1). RAPD and SSR amplification Amplification of genomic DNA was performed in thermal cycler Eppendorf with following regimes: initial heat denaturation of the DNA at 95º C for 3 min, 35 cycles of denaturation at 95º C for 45 sec, annealing temperature for 45 sec (depends on the primer used), initial extention 72º C for one min and final extension was carried out at 72º C for10 min. The amplified DNA was verified on 4% agarose gel for SSRs and 2% agarose gel for RAPD. The presence of bands using SSR primers confirmed amplification of the SSR markers (Figs 2, 3). Multiple bands of RAPD analysis was observed on 2% agarose gel electrophoresis (Figs 4, 5). Thus, amplification of the DNA suggests that the primer used has a complementary sequence to anneal and amplify the sample DNA thereby proving its efficacy and the presence of simple sequence repeats in the DNA sample. The bands were scored based on the presence or absence of clear, visible and reproducible bands. The results were analyzed based on the principle that band is considered to be polymorphic if it is present in some variety and absent in others and monomorphic if present in all the varities. J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2,

6 GOWRI NEELIMA: Fig. 1: Gel picture showing bands of DNA isolation. 1. Anethum graveolens. 2. Apium graveolens. 3. Coriandrum sativum. 4. Coriander native. 5. Petroselinum crispum. 6. Angelica archangelica. 7. Daucus carota. 8. Centella asiatica. 9. Begonia erythrophylla. 10. Regelia sp. Fig. 2: Amplification of SSR markers of Apium and Petrosi primers. 1 & 11. Anethum graveolens 2 & 12. Apium graveolens. 3 & 13. Coriandrum sativum. 4 & 14. Coriander native. 5 & 15. Petroselinum crispum. 6 & 16. Angelica archangelica. 7 & 17. Daucus carota. 8 & 18. Centella asiatica. 9 & 19. Begonia erythrophylla. 10 & 20. Regelia sp. 14 J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2, 2017

7 MOLECULAR DIVERSITY IN APIACEAE Fig. 3: Amplification of SSR marker by Corissr and Trigossr primers. 1 & 11. Anethum graveolens. 2 & 12. Apium graveolens. 3 & 13. Coriandrum sativum. 4 & 14. Coriander native. 5 & 15. Petroselinum crispum. 6 & 16. Angelica archangelica. 7 & 17. Daucus carota. 8 & 18. Centella asiatica. 9 & 19. Begonia erythrophylla. 10 & 20. Regelia sp. Fig. 4: Amplification of RAPD marker by OPW-16 & OPA-18 primers. 1. Anethum graveolens. 2. Apium graveolens. 3. Coriandrum sativum. 4. Coriander native. 5. Petroselinum crispum. 6. Angelica archangelica. 7. Daucus carota. 8. Centella asiatica. 9. Begonia erythrophylla. 10. Regelia sp. J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2,

8 GOWRI NEELIMA: Fig. 5: Gel picture showing amplification of RAPD marker by OPB-09 primer 1. Anethum graveolens, 2. Apium graveolens, 3. Coriandrum sativum, 4. Coriander native, 5. Petroselinum crispum, 6. Angelica archangelica, 7. Daucus carota, 8. Centella asiatica, 9. Begonia erythrophylla, 10. Regelia sp. DISCUSSION Molecular weight of the DNA was determined using Gene Tool software by using mid-range ladder (0.1 3 Kb) procured from Aristogene, Bengaluru as reference. The data obtained from scoring was used to calculate genetic diversity and Polymorphic Information Content (PIC) using DARWIN software. The information based on SSR data was used to calculate the similarity and the genetic distance between members of selected plants of Apiaceae. The obtained values of similarity were used to establish the phylogenetic tree using DARWIN software which showed the relationships among the different varieties (Fig. 6). The phylogenetic tree consists of 3 main clusters (Fig. 6). Cluster I was divided into 2 groups, one group contains Anethum graveolens, Coriandrum sativum, Centella asiatica and other group contains Angelica archangelica and Daucus carota. Cluster II consists of 4 members which were further divided into 2 groups, one group contains Apium graveolens, Petroselinum crispum and coriander native and the second group contains Begonia. Cluster III contains only one member that is Regelia sp. UPGMA analysis for RAPD The UPGMA algorithm constructs a rooted tree (dendrogram) that reflects the structure present in a pairwise similarity matrix (or a dissimilarity matrix). The information based on RAPD 16 J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2, 2017

9 MOLECULAR DIVERSITY IN APIACEAE Anethum graveolens 2. Apium graveolens 3. Coriandrum sativum 4. Coriander native 5. Petroselinum crispum 6. Angelica archangelica 7. Daucus carota 8. Centella asiatica 9. Begonia erythrophylla 10. Regelia sp. Fig. 6: Hierarchical tree representations in 10 species of Apiaceae. data was used to calculate the similarity and the genetic distance between different plants in Apiaceae. The obtained values of similarity were used to establish the dendrogram generated by UPGMA showing the relationships among the different varieties (Table 3). The dendrogram consists of 4 main clusters (Fig. 7). Cluster I is divided into 2 sub-clusters, one sub-cluster is again divided into 2 groups, Out of these 4 groups, one group contains Anethum graveolens and Regelia sp. and second group contains Angelica archangelica, third group contains Apium graveolens, Petroselinum crispum and fourth one contains Coriander sativum hybrid. Cluster II contains Coriandrum sativum native and Cluster III contains Daucus carota and Begonia erythrophylla. Cluster 4 contains Centella asiatica. Divergence of 49.64% was observed among the 24 varieties of Coriandrum sativum as understood by hierarchial cluster analysis performed using Toucher method (Hung et al. 2012). Multilocus genotyping by nine RAPD primers detected on average of intraspecific variations amounting to 66.18% polymorphism in C. sativum (Singh et al. 2012). Around 87% polymorphism was observed in Centella asiatica when checked for different morphological parameters and RAPD markers (Padmalatha & Prasad 2008). Genetic clustering using ISSSRs and chemical clustering using HPLC showed four distinct groups of C. asiatica (Zhang et al. 2012) mer primers showed 69% variation in Dill varieties (Solonki et al. 2012). J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2,

10 GOWRI NEELIMA: TABLE 3: Distance matrix generated for RAPD. P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P P P P P P P P P P Anethum graveolens 2. Apium graveolens 3. Coriandrum sativum 4. Coriander native 5. Petroselinum crispum 6. Angelica archangelica 7. Daucus carota 8. Centella asiatica 9. Begonia erythrophylla 10. Regelia sp. Fig. 7: UPGMA type dendrogram of similarities found in 10 plants of Apiaceae. 18 J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2, 2017

11 MOLECULAR DIVERSITY IN APIACEAE The markers developed were efficient in revealing the genomic variation among selected plants. Further, the markers were capable of transferring to closely related species belonging to Apiaceae and Brassicaceae and furthermore to explain the genetic diversity existing among them. The polymorphic information obtained by these markers had proved the markers identified are good and are capable of showing molecular diversity within and across the families. The presence of markers across the species may give us a better understanding about the evolution of those species. The use of markers across the species and genera gives us a hope to understand unexploited plants. Studies like this will help in understanding their relatedness and can be further exploited for any important trait in these plants. ACKNOWLEDGEMENTS My most sincere thanks go to Dr. Udaya Kumar, Department of Crop Physiology, University of Agricultural Sciences for his guidance and Dr. T. L. Shantha, Director and Dr. M. B. Nagaveni, Head of the Department of Biotechnology, Maharani Lakshmi Ammani College for Women for their support. REFERENCES ABDUL M SAJIB, MD MUSHARAF HOSSAIN, MOSNAZ ATM J, HOSNEARA HOSSAIN, MD MONIRUL ISLAM, MD SHAMSHER ALI & SHAMSUL H PRODHAN 2012 SSR marker-based molecular characterization and genetic diversity analysis of aromatic land races of rice (Oryza sativa L) J Biosci Biotech ANTONIO A F, GARCIA, LUCIANA L, BÉCHAMEL, ANTONIA M M, BARBOSA, ISAIAS O, GERALDI, CLÁUDIOL SOUZA JR & ANETE P DE SOUZA 2004 Comparison of RAPD RFLP AFLP and SSR markers for diversity studies in tropical maize inbred lines Genet Mol Biol DOYLE J J & DOYLE D J 1990 Isolation of plant DNA from leaf tissue Focus GUO QI SONG, MENG JUN LI SCIENCES, HAN XIAO, XING JUN WANG, RONGHUA TANG, HAN XIA CHUANZHI ZHAO & YU PING BI 2010 EST sequencing and SSR marker development from cultivated peanut (Arachis hypogaea L) Mol Bio Gent 13 3 HUNG H Y, BROWNE C, GUILL K, COLES N, ELLER M, GARCIA A, LEPAK N, MELIA-HANCOCK S, OROPEZA- ROSAS S, SALVO S, UPADYAYULA N, BUCKLER E S, FLINT-GARCIA S, MCMULLEN M D, ROCHEFORD T R & HOLLAND J B 2012 The relationship between parental genetic or phenotypic divergence and progeny variation in the maize nested association mapping population Heredity ILHAM EROZ POYRAZ, EMEL SOZEN, EBRU ATASLAR, ISMAIL POYRAZ & TURK 2012 Determination of genetic relationships among Velezia L (Caryophyllaceae) species using RAPD markers J Biol ISLAM S, HAQUE M S, EMON R M, ISLAM M M & BEGUM S N 2012 Molecular characterization of wheat (Triticum aestivum L) genotypes through SSR markers Bangladesh J Agri Res JOSHI S P, RANJANEKAR P K & GUPTA V S 1999 Molecular markers in plant genome analysis Curr Sci MENG-YAO LI, FENG WANG, QIAN JIANG, JING M A & AI-SHENG XIONG 2014 Identification of SSRs and differentially expressed genes in two cultivars of celery (Apium graveolens L) by deep transcriptome sequencing Hort Res 1 10 J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2,

12 GOWRI NEELIMA : MOLECULAR DIVERSITY IN APIACEAE PADMALATHA K & PRASAD M N V 2008 Optimization of DNA isolation and PCR protocol for RAPD analysis of selected medicinal and aromatic plants of conservation concern from Penninsular India Afr J Biotech POWELL W, MORGANTE M, ANDRE C, HANAFEY M, VOGEL J, TINGEY S & RAFALSKI A 1996 The utility of RFLP RAPD AFLP & SSR (microsatellite) markers for germplasm analysis Mol Bre PRABAKARAN A, PARAMASIVAM K, RAJESH T & RAJARAJAN D 2010 Molecular characterization of rice land races using SSR markers Elect Bre SINGH S K, KAKANI R K, MEENA R S, ANJLY PANCHOLY & RAKESH PATHAK 2012 Studies on genetic divergence among Indian varieties of a spice herb Coriandrum sativum Env Biol SOLONKI M, HOSEINI S B, SIAHSAR B A & TAVASSOLI A 2012 Genetic diversity in dill (Anethum graveolens L) populations on the basis of morphological traits and molecular markers Afr Biotech ZHANG, XIAO-GANG HAN, TING H E, ZHI-GAO ZHANG & QIAO-YAN E T 2012 Genetic diversity of Centella asiatica in China analyzed by inter-simple sequence repeat (ISSR) markers: combination analysis with chemical diversity Nat Med J. CYTOL. GENET. VOL. 18 (NS), NOS 1 & 2, 2017