Dermcidin: a novel human antibiotic peptide secreted by sweat glands



Similar documents
Evaluation of chemical and biological consequences of soil sterilization methods

GENERAL OPERATING PRINCIPLES

Word Wisdom Correlations to the Common Core State Standards, Grade 6

CHAPTER 31 CAPACITOR

Dcx reexpression reduces subcortical band heterotopia and seizure threshold in an animal model of neuronal migration disorder

British Journal of Nutrition

Maximum area of polygon

MATH PLACEMENT REVIEW GUIDE

2. Use of Internet attacks in terrorist activities is termed as a. Internet-attack b. National attack c. Cyberterrorism d.

OxCORT v4 Quick Guide Revision Class Reports

SUPPLEMENTARY MATERIAL

The activating effect of IFN-c on monocytes/macrophages is regulated by the LIF trophoblast IL-10 axis via Stat1 inhibition and Stat3 activation

MODAL VARIATIONS WITHIN GRANITIC OUTCROPS D. O. EruBnsoN, Department of Geology, Uni'ttersity of C alif ornia, Dattis, C ali'f orni,a'

Biophysical mechanism of T-cell receptor triggering in a reconstituted system

A new form of long-term depression in the perirhinal cortex

DiaGen: A Generator for Diagram Editors Based on a Hypergraph Model

1 Fractions from an advanced point of view

Visualization of characteristics of the contact network between spheres in 3D assembly

Citation for the original published paper (version of record): Creative Commons CC BY 3.0:

The art of Paperarchitecture (PA). MANUAL

Fluent Merging: A General Technique to Improve Reachability Heuristics and Factored Planning

OUTLINE SYSTEM-ON-CHIP DESIGN. GETTING STARTED WITH VHDL August 31, 2015 GAJSKI S Y-CHART (1983) TOP-DOWN DESIGN (1)

Abbott RealTime 2N40 HBV /R1. Customer Service: Key to symbols used

ORGANIZER QUICK START GUIDE

Hydromagnetic Unsteady Mixed Convection Flow Past an Infinite Vertical Porous Plate

JCM TRAINING OVERVIEW Multi-Download Module 2

On Equivalence Between Network Topologies

Volumes by Cylindrical Shells: the Shell Method

Determinants of Chlorpyrifos Exposures and Urinary 3,5,6-Trichloro-2-Pyridinol Levels Among Termiticide Applicators

Module 5. Three-phase AC Circuits. Version 2 EE IIT, Kharagpur

Distinct contribution of stem and progenitor cells to epidermal maintenance

Revised products from the Medicare Learning Network (MLN) ICD-10-CM/PCS Myths and Facts, Fact Sheet, ICN , downloadable.

Rotating DC Motors Part II

Corrigendum-II Dated:

1. Definition, Basic concepts, Types 2. Addition and Subtraction of Matrices 3. Scalar Multiplication 4. Assignment and answer key 5.

Lesson 2.1 Inductive Reasoning

Effect of Polyunsaturated Fatty Acids on Doxorubicin Cytotoxicity in Glioma Cells in vitro*

Copia autorizada por CDR

Angles 2.1. Exercise Find the size of the lettered angles. Give reasons for your answers. a) b) c) Example

Original Research. Immunohistochemical panel for differentiating renal cell carcinoma with clear and papillary features. Hanan AlSaeid Alshenawy

Plant Physiology and Biochemistry

Step-by-step full mouth rehabilitation of a nasopharyngeal carcinoma patient with tooth and implant-supported prostheses: A clinical report

Swelling and Mechanical Properties of Hydrogels Composed of. Binary Blends of Inter-linked ph-responsive Microgel Particles

Formal concept analysis-based class hierarchy design in object-oriented software development

Boğaziçi University Department of Economics Spring 2016 EC 102 PRINCIPLES of MACROECONOMICS Problem Set 5 Answer Key

Bidirectional processing of pri-mirnas with branched terminal loops by Arabidopsis Dicer-like1

- DAY 1 - Website Design and Project Planning

85 BACTERIAL ENDOTOXINS TEST

Antibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening

Vectors Summary. Projection vector AC = ( Shortest distance from B to line A C D [OR = where m1. and m

Lesson 1: Getting started

Calculating Principal Strains using a Rectangular Strain Gage Rosette

c b N/m 2 (0.120 m m 3 ), = J. W total = W a b + W b c 2.00

Enterprise Digital Signage Create a New Sign

6. developed the process that separated morphine from opium in a. F.W. Serturner b. Thomas DeQuincey c. Alder Wright d.

Activation of insulin-like growth factor I receptor-mediated pathway by ginsenoside Rg1

50 MATHCOUNTS LECTURES (10) RATIOS, RATES, AND PROPORTIONS

StyleView SV32 Change Power System Batteries

SECTION 7-2 Law of Cosines

BEC TESTS Gli ascolti sono disponibili all indirizzo

Granulocyte Colony-Stimulating Factor (Filgrastim) Treatment Primes for Increased ex Vivo Inducible Prostanoid Release

The homologous HD-Zip I transcription factors HaHB1 and AtHB13 confer cold tolerance via the induction of pathogenesis-related and glucanase proteins

Computing the 3D Voronoi Diagram Robustly: An Easy Explanation

S-Scrum: a Secure Methodology for Agile Development of Web Services

Metabolomic changes in fatty liver can be modified by dietary protein and calcium during energy restriction

European Convention on Social and Medical Assistance

letters Solution structure of the DNA-binding domain of MafG

ELECTROVALUE: a LCA Approach

COMPONENTS: COMBINED LOADING

Euler Hermes Services Ireland Ltd. Terms & Conditions of Business for your Debt Collection Services

KEY SKILLS INFORMATION TECHNOLOGY Level 3. Question Paper. 29 January 9 February 2001

Answer, Key Homework 10 David McIntyre 1

PLWAP Sequential Mining: Open Source Code

GUIDELINES. under THE PRIVATE HOSPITALS AND MEDICAL CLINICS ACT (1980) AND REGULATIONS (1991) MINISTRY OF HEALTH SINGAPORE

Small Businesses Decisions to Offer Health Insurance to Employees

The Integrated Competencies for Dietetic Education and Practice ICDEP. Developed by the Partnership for Dietetic Education and Practice

Study on enzyme-assisted aqueous extraction of oil from soybean

The design and functionalization of porous materials have

Data Security 1. 1 What is the function of the Jump instruction? 2 What are the main parts of the virus code? 3 What is the last act of the virus?

Innovation in Software Development Process by Introducing Toyota Production System

COVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION

THE LONGITUDINAL FIELD IN THE GTEM 1750 AND THE NATURE OF THE TERMINATION.

WHAT HAPPENS WHEN YOU MIX COMPLEX NUMBERS WITH PRIME NUMBERS?

Ratio and Proportion

Transcription:

Dermiin: novel humn ntiioti peptie serete y swet glns Birgit Shittek 1, Riner Hipfel 1, Birgit Suer 1, Jürgen Buer 1, Huert Klher 2, Stefn Stevnovi 3, Mrkus Shirle 4, Kristin Shroeer 5, Nikolus Blin 5, Frieegun Meier 1, Gernot Rssner 1 n Clus Gre 1 Pulishe online: 5 Novemer 2001, DOI: 10.1038/ni732 Antimiroil pepties re n importnt omponent of the innte response in mny speies. Here we esrie the isoltion of the gene Dermiin, whih enoes n ntimiroil peptie tht hs ro spetrum of tivity n no homology to other known ntimiroil pepties.this protein ws speifilly n onstitutively expresse in the swet glns, serete into the swet n trnsporte to the epierml surfe. In swet, proteolytilly proesse 47 mino i peptie ws generte tht showe ntimiroil tivity in response to vriety of pthogeni miroorgnisms.the tivity of the peptie ws mintine over ro ph rnge n in high slt onentrtions tht resemle the onitions in humn swet.this inite tht swet plys role in the regultion of humn skin flor through the presene of n ntimiroil peptie.this peptie my help limit infetion y potentil pthogens in the first few hours following teril oloniztion. The epitheli of multiellulr orgnisms represent mjor rrier to the environment n provie the first line of efense ginst inving miroorgnisms. In the epitheli, ntimiroil pepties prtiipte in the efense system of mny orgnisms, inluing plnts, insets, mphiins n mmmls. They ontrol miroil growth in the first hours fter epithelil injury n uring woun heling n re espeilly prevlent uring some inflmmtory skin isorers. In mmmlin skin, two lsses of ntimiroil pepties hve een ientifie: theliiins 1 n β-efensins 2. They re expresse in humn kertinytes fter inution y inflmmtory stimuli n funtion primrily in the response to injury. The theliiins re omponents of woun flui 1 n re expresse y humn skin kertinoytes t sites of inflmmtion in isorers suh s psorisis, nikel ontt ermtitis n systemi lupus erythemtosus 3. Defensins re smll (3 5 kd) tioni pepties tht n e groupe into the α-n β-efensins. The α-efensins humn neutrophil pepties 1 4 re expresse in humn leukoytes n humn efensins 5 n 6 re expresse in Pneth ells in the smll intestine 4,5. Humn β-efensins 1 3 re foun in vrious epithelil ells 4. In mmmlin skin, humn β-efensins 2 n 3 re expresse fter inution in kertinoytes in response to infetion n inflmmtion 2,6. Humn β-efensins 1 n 2 show miroiil tivity preominntly ginst Grm-negtive teri suh s Esherihi oli n yests, wheres humn β-efensin 3 is lso effetive ginst Grm-positive teri suh s Stphyloous ureus, mjor use of skin infetions, prtiulrly in topi ermtitis. We esrie here the isoltion of new ntimiroil protein tht hs no homology to known ntimiroil pepties. This protein ws speifilly n onstitutively expresse in swet glns, serete into the swet n trnsporte in swet to the epierml surfe. This inite tht humn swet ontins t lest one ntimiroil protein, whih my ply role in the regultion of humn skin flor. Results Isoltion n mpping of DCD Sreening of sutrte DNA lirry of primry melnom n enign melnoyti nevus tissues with DNA rrys ientifie lone whih we lter esignte Dermiin (DCD) tht h no homology to ny pulishe gene sequene 7. Sequening of overlpping polymerse hin retion (PCR) prouts ientifie full-length DCD DNA of 458 p with n open-reing frme of 330 p tht enoe 110 mino i () resiues (see We Fig. 1 on the supplementry informtion pge of Nture Immunology online). The gene onsists of five exons n four introns n is expresse s single trnsript 7. Two short overlpping pepties generte from the 5 en of the gene re esrie s humn hexi-ssoite protein 8,9 n survivl-promoting peptie for neuronl ells 10,11. We etermine the hromosoml loliztion of DCD y nlyzing olletion of humn-roent somti hyri ells tht ontine efine humn hromosomes or their frgments on roent kgroun. First, monohromosoml hyri ell pnel ws investigte with humn DCD-speifi primers in PCR experiments. For etile suhromosoml mpping, the sme tehnique ws use with rition hyri mpping pnel. With these pprohes, we were le to ssign DCD to hromosome 12q13 etween the mrkers D12S1896 n D12S1632 (lo sore 14.11). 1 Deprtment of Dermtology, Eerhr-Krls-University Tüingen, Germny. 2 Meil n Nturl Sienes Reserh Center, Eerhr-Krls-University Tüingen, Germny. 3 Institute for Cell Biology, Deprtment of Immunology, University of Tüingen,Tüingen, Germny. 4 Institute for Cell Biology, Deprtment of Moleulr Biology, University of Tüingen,Tüingen, Germny. 5 Institute of Anthropology n Humn Genetis, Eerhr-Krls-University Tüingen, Germny. Corresponene shoul e resse to B. S. (irgit.shittek@uni-tueingen.e). http://immunol.nture.om eemer 2001 volume 2 no 12 nture immunology 1133

A RTICLES Figure 1. DCD expression ws restrite to ells in the skin. RT-PCR nlysis of vrious tissues with humn MTC pnels n DCD-speifi primers.as shown, eh smple ws nlyze twie with 40 PCR yles. For eh smple, GAPDH oul e suessfully mplifie (t not shown). () Tissue pnel I () tissue pnel II () tumor pnel n () fetl pnel. wek n mrkely reue stining ws seen (t not shown). Finlly, we use immunoeletronmirosopy to ultrstruturlly lolize DCD insie the erine swet glns of norml xillry skin; we foun tht DCD ws expresse in the rk muous ells of the seretory oil (Fig. 2e). DCD loliztion ws exmine further n ws foun to our within the golgi omplex n in the seretory grnules (Fig. 2f), whih suggeste DCD is serete protein. DCD is proteolytilly proesse Expression pttern of DCD To etermine the overll expression profile of DCD, ot lot in whih RNA from 50 ifferent tissues t ifferent evelopmentl stges were spotte onto nylon memrne ws one with the use of lele DCD DNA s hyriizing proe. No etetle signl ws foun in ny of the 50 smples, whih inite tht DCD h restritive expression pttern (t not shown). To etermine whether DCD ws expresse only t low mounts in humn tissues or ell lines, we nlyze DCD expression with reverse trnsrie PCR (RT-PCR). DCD ws highly expresse in humn skin, melnoyti nevus tissue n utneous melnom tissue (Fig. 1). However, expression ws not etete in ny of the 16 humn tissues nlyze (spleen, thymus, prostte, testis, ovry, smll intestine, olon, peripherl loo lymphoytes, hert, rin, plent, lung, liver, skeletl musle, kiney n pnres) n ws not expresse in severl fetl n tumor tissues. In ition, in pnel tht ontine vrious prts of the humn igestive system n severl ifferent tumor ell lines, no mplifition prout ws etete y RT-PCR fter 40 yles (t not shown). These t inite tht DCD expression ws restrite to ells in the skin. To efine the ell types tht expresse DCD we use in situ hyriiztion, immunohistohemistry, immunofluoresene n immunoeletronmirosopy. In situ hyriiztion showe tht the gene ws expresse in erine swet glns within the ermis of humn skin (Fig. 2). With the use of sense proe for DCD s negtive ontrol no signls were etete (Fig. 2). We use n ntiserum rise in rits to rry out immunohistology on skin setions (Fig. 2). Agin, we sw strong stining on the erine swet glns, ut no expression on other skin ell types. Confol lser snning mirosopy showe strong immunofluoresene stining in the seretory oils of erine swet glns (Fig. 2). In the seretory grnules of porine swet glns only Figure 2. DCD ws expresse in humn erine swet glns. (,) In situ hyriiztion with igoxigenin-lele sense proe tht ws trnsrie in vitro (negtive ontrol) or n ntisense proe for DCD showe tht DCD ws lolize to the erine swet glns. () The immunohistohemistry of DCD ws ssesse with rit nti-dcd serum n seonry rit ntioy.as speifiity ontrol, the setions were inute with preimmune rit serum + the seonry ntioy or the seonry ntioy lone. () Immunofluoresene of trnsete seretory oil of n erine swet gln showe DCD+ (re) serous ells surroune y tin+ myoepithelil ells (lue). Nulei stine with YOPRO (green). Originl mgnifition: 800. (e,f) Immunoeletronmirosopy ws use to exmine n erine swet gln. (e) Seretory tuule of n erine swet gln showe rk muous ells (MC) with seretory grnules, serous ells (SC) n myoepithelil ell (ME). Originl mgnifition: 3000. (f) Higher mgnifition of e. Groupe gol prtiles, whih revele DCD loliztion, were foun in the seretory grnules (SG) n in the golgi omplex (GC) of muous swet gln ells. Originl mgnifition: 12,000. 1134 nture immunology volume 2 no 12 To etermine whether DCD or DCD-erive pepties were serete into humn swet, we isolte severl protein frtions erive from humn swet fter high performne liqui hromtogrphy (HPLC) frtiontion (Fig. 3). To etermine the peptie sequene in swet frtions, we use Emn mirosequening n nnoeletrospry mss spetrometry. The mss spetrum of swet frtion 4 showe n unnt signl tht orrespone to neutrl mss of 4,702.57 Dltons. Emn nlysis ws use to ientify 1 46 of this peptie, n tnem mss spetrometry ws use to etermine tht the COOH-terminl sequene ws V(I/L)DSV-COOH. Tken together these t showe tht this peptie represente proesse form of the DCD protein tht enompsse 47 of its COOH-terminl prt (Fig. 3,). We terme this peptie DCD1; it h lulte neutrl mss of 4,702.54 Dltons. We nlyze swet smples from four iniviuls n, from the t we otine, estimte tht the DCD-1 peptie ws present in swet t onentrtion of 1 10 µg/ml. It remins to e etermine whether proessing of full-length DCD, whih hs lulte moleulr weight of e f eemer 2001 http://immunol.nture.om

Figure 3. DCD ws serete into humn swet. () RP-HPLC nlysis of humn swet.antimiroil ssys were one with pek frtions 1 4. () Nnoeletrospry mss spetrometry of frtion 4 showe quruply hrge signl t m/z=1176.64, whih orrespone to neutrl mss of 4702.57 Dltons (lulte neutrl mss 4702.54 Dltons). () Amino i sequene of full-length DCD.The signl peptie is in itlis; the peptie elute from frtion 4 of humn swet is unerline.this peptie, esignte DCD-1, enompsse 63 109 of full-length DCD. 9.3 kd without the signl peptie tkes ple in the swet gln ells or fter it hs een serete into swet. Antimiroil tivity of DCD-1 peptie Antimiroil pepties, suh s the efensins, re proue s intive preursor proteins tht re proteolytilly proesse to give rise to tive 25 45 pepties from the COOH-terminl region of the protein 12. Although the mino i sequene of DCD h no homology with other known ntimiroil pepties, the size of DCD n its proesse pepties resemle the struturl hrteristis of the efensin fmily of ntimiroil proteins. Therefore, with purifie pepties generte from the DCD mino i sequene n the HPLC-purifie swet frtions 1 4, we nlyze the pthogens E. oli, Enteroous felis, S. ureus n Cni lins with ntimiroil ssys. The tivity of two syntheti DCD-erive pepties (Y-P30 n DCD- 1L) n ontrol peptie (DPI) were teste. The 30- peptie Y-P30 is erive from the NH 2-terminl en of DCD ( 20 49) 10 ; DCD-1L omprise 48 from the COOH-terminl en of the DCD protein; n DPI ws 30- ontrol peptie without homology to DCD (Fig. 4). All pepties were teste t onentrtions of 0.1 100 µg/ml. Y-P30 n DPI h no toxi effet on the miroorgnisms (men ell eth ws 5.6% with Y-P30 n 3.7% with DPI). However, DCD-1L, whih ws erive from the 3 en of DCD n enompsse the DCD-1 peptie sequene plus the lst leuine in the DCD sequene (Fig. 4), showe ose- n time-epenent ntimiroil tivity ginst the teri (Fig. 4). It ws highly effetive ginst E. oli, E. felis n S. ureus n, t 10 µg/ml, kille 100% of the orgnisms fter only 4 h of inution. DCD- 1L ws lso highly fungiil, s shown y its toxi effet on C. lins (Fig. 4). The miniml inhiitory onentrtion (MIC) of the DCD-1L peptie, efine s the lowest onentrtion of peptie tht prevente visile miroil growth fter 4 h of inution, ws 1 µg/ml for E. oli, E. felis n S. ureus n 10 µg/ml for C. lins. Inresing the inution time to 18 h le to greter miroiil effet (t not shown). A shorter version of the DCD-1L peptie tht enompsse 31 of the DCD COOH-terminl en h no toxi effet on the miroorgnisms (t not shown). Swet is ii, with ph of 4 6.8, n minly onsists of wter, soium (20 60 mm), hlorie (20 80 mm), potssium (10 mm) n mgnesium (1 mm). The ntimiroil ssys were one in soium phosphte uffer t ph 7.4, s is use for efensins 13. To strengthen support for the ntimiroil funtion of DCD n to show tht the peptie ws lso tive in swet, we i the ntimiroil ssys in severl uffers tht h ph n ioni omposition similr to tht of humn swet. We teste phosphte uffers in whih the ph vrie etween 5.5 7.4 or the soium hlorie vrie etween 25 150 mm; we lso use uffer with ph of 5.5 or 6.5 tht h similr omposition to humn swet (referre to s swet uffer). Figure 4. DCD h ntimiroil tivity n ws slt- n phinsensitive. () Amino i sequenes of Y-P30, DCD-1L n DPI (the ontrol peptie). () To ssess DCD-1L tivity, DCD01L ws inute with E. oli, E. felis, S. ureus n C. lins for 4 h in 10 mm phosphte uffer (ph 7.4) t onentrtions of 1 µg/ml (open rs), 10 µg/ml (hekere rs), 50 µg/ml (otte rs) n 100 µg/ml (fille rs).the numer of teril or yest olonies were ounte n perentge ell eth lulte. ( f) To ssess DCD ntimiroil tivity in ifferent uffers over ro ph rnge n slt onentrtions, DCD-1L (10 µg/ml) ws inute for 4 h with vrious uffers + () E. oli () E. felis (e) S. ureus n (f) C. lins. Buffer 1, soium phosphte uffer ph 5.5; 2, soium phosphte uffer ph 6.5; 3, soium phosphte uffer ph 7.4; 4, soium phosphte uffer ph 7.4 + 25 mm NCl; 5, soium phosphte uffer ph 7.4 + 100 mm NCl; 6, soium phosphte uffer ph 7.4 + 150 mm NCl; 7, swet uffer ph 5.5; 8, swet uffer ph 6.5. (g) To ssess the ntimiroil e f g tivity of n HPLC-erive swet frtion (frtion 4 in Fig. 3, protein onentrtion, 10 µg/ml), smples were inute for 4 h with ifferent miroorgnisms.the inution uffers were 10 mm phosphte uffer ph 7.4 (white rs), swet uffer ph 5.5 (hekere rs) n swet uffer ph 6.5 (fille rs). http://immunol.nture.om eemer 2001 volume 2 no 12 nture immunology 1135

We foun tht the ntimiroil tivity profile of the DCD-1L peptie ws similr in ph 5.5 phosphte uffer or with soium hlorie onentrtions of 25 150 nm n in swet uffer ompre to ph 7.4 phosphte uffer (Fig. 4 f). Wheres the tivity of DCD-1L in response to E. oli roppe when teste in swet uffer or when the soium hlorie onentrtion inrese to 100 mm (Fig. 4), the ntimiroil tivity of DCD-1L ginst E. felis n S. ureus i not hnge in the ifferent inution uffers. DCD-1L h no ntiioti tivity ginst S. ureus in phosphte uffer t ph 5.5, lthough in swet uffer of the sme ph its tivity ws retine (Fig. 4 f). In ph 5.5 or 6.5 phosphte uffer, in ph 5.5 swet uffer or with soium hlorie onentrtions t 25 100 mm, DCD-1L showe more tivity ginst C. lins thn it i in ph 7.4 phosphte uffer (Fig. 4f). Next, we teste the ntimiroil tivity of four protein frtions erive from humn swet fter HPLC frtiontion (Fig. 3). Wheres frtions 1 3 h no toxi effet on the miroorgnisms, frtion 4 kille ll miroorgnisms in ose-epenent mnner (Fig. 4g). With mss spetrometry n peptie sequening, we ientifie the DCD-1 peptie in frtion 4 (Fig. 3,). When swet uffers were use s inution uffers, the tivity ginst the ifferent miroorgnisms hrly hnge. The ntimiroil tivity of this peptie frtion ginst E. oli i not rop when swet uffer, ompre to phosphte uffer, ws use for inution. This ontrste with the results otine with DCD-1L, whih my hve een ue to ifferenes in the peptie sequenes euse the lst leuines in DCD-1 n DCD-1L iffere. Thus, these t inite tht humn swet ontine proteolytilly proesse DCD peptie tht h ntiioti tivity ginst severl miroorgnisms. Disussion We hve esrie here the isoltion of gene enoing n ntimiroil peptie with ro spetrum of tivity n without ny homology to known ntimiroil pepties. This protein ws speifilly n onstitutively expresse in swet glns, serete into the swet n trnsporte to the epierml surfe. In swet proteolytilly proesse DCD peptie ws present tht hs ntimiroil tivity ginst vriety of pthogeni miroorgnisms. This tivity ws mintine over ro ph rnge n in high slt onentrtions, whih resemle the onitions in humn swet. Humn swet glns re ivie into erine, porine n poerine; poerine glns shre the properties of the erine n porine glns. The erine swet gln is ompose of epithelil n myoepithelil ells tht re orgnize into the seretory oil, erml ut n epierml ut or rosyringium. The seretory oil of the erine swet gln is involve in the proution of preursor swet, whih is isotoni or slightly hypertoni n is essentilly n ultrfiltrte of plsm. The swet then psses through the oile ut, stright ut n rosyringium to the epierml surfe. During pssge through the intrerml ut the swet is moifie y seletive resorption of soium, whih minly ours within the oile ut 14. The seretory unit onsists of three ell types: ler (serous) n rk (muous) ells, whih re involve in seretion, n myoepithelil ells, whih funtion s smooth musle ells 14. The ler ells serete preursor swet vi the tive trnsport of soium into the lumen of the seretory oil, wheres the rk ells proue muins, suh s glyoproteins, tht n e foun long the erine gln lumin. The tuuli of erine glns re involve in resorption of soium n hlorie, whih results in hypotoniity of the serete swet. Swet minly onsists of wter, soium, hlorie, potssium, ure n ltte. A vriety of other sustnes my e foun in swet, inluing phrmologilly tive sustnes, inhiitors, ntigens, ntioies n rugs 14. The mjority of pepties in swet re of smll moleulr weight. The onentrtion of high moleulr weight proteins (>10 kd) is positively orrelte with the swet rte; this is ue to ifferent egree of proteolyti egrtion uring the outflow of swet, seretion of proteins from ifferent intrellulr storge sites or iffering protein synthesis 14. Immunogloulin A 15, interleukin 1 (IL-1) n IL-8 16,17, IL-6 n tumor nerosis ftor-α 18, trnsforming growth ftor β reeptor 19, epierml growth ftor 14 n proltin-inuile protein 19 hve ll een ientifie in humn swet. We etermine tht 1 10 µg/ml of the peptie DCD-1 ws present in swet, onentrtion tht prove toxi to most miroorgnisms we teste. The ntiserum we use for immunohistologil nlysis ws irete ginst peptie lote in n ntigeni region t the enter of the DCD protein ( 42 65). Thus, most likely, we h ientifie either nonproesse, full-length protein or DCD-erive peptie tht enompsse the ntigeni region. The ntiiotilly tive DCD-1 peptie lke the ntigeni eterminnt use for immuniztion n oul not e etete y the ntiserum. Therefore, it remins to e etermine whether the full-length DCD protein h lrey een proesse in the erine swet gln ells or in the swet. Beuse humn swet ontins vrious proteses 21,22 it is likely tht the DCD protein ws proesse there. The onentrtion of proteolytilly proesse peptie proly iffers etween iniviuls n is epenent on the onentrtion of proteolyti enzymes in the swet s well s the rte t whih n iniviul swets. We hve shown here tht the pepties DCD-1, whih enompsses the COOH-terminl prt of DCD ( 62 109), n DCD-1L, whih hs n itionl leuine t the COOH en, were toxi to vrious miroorgnisms in meium tht h similr ph n ioni omposition to humn swet. In ontrst to the tivity profile of DCD-1, memers of the efensin fmily re only tive in the presene of low slt onentrtions; they re intive t high slt onentrtions 23,24. As moeling stuies suggest, like mny ntimiroil pepties inluing inset eropins, frog mginins n some mmmlin theliiins DCD is likely to opt n mphipthi α-helix 25. However, unlike most ntimiroil pepties whih re enrihe in rginine or lysine resiues n re therefore tioni 26 ntimiroil DCD-1 hs net negtive hrge of 5. Therefore, the moe of tion of this peptie in response to miroorgnisms is proly ifferent to tht of the tioni efensins, whih n in to nioni omponents of the trget memrne n kill the miroorgnisms y pore formtion n permeiliztion of the ell memrne 24. It remins to e etermine whether DCD is toxi to miroorgnisms tht re resistnt to estlishe ntiioti therpies. In onlusion, DCD-1, 47- peptie, ws proteolytilly proesse from DCD n serete y muous ells of the swet gln oil into the swet. Uner ph n slt onitions tht were hrteristi of humn swet, it ws ntimiroilly tive ginst E. oli, E. felis, S. ureus n C. lins. DCD showe no homology to known ntimiroil pepties n ws hrterize y restritive expression pttern tht ws limite to swet glns. This peptie proly plys key role in the innte immune responses of the skin. Methos Gene mpping. Humn-roent somti ell hyri (Coriell Cell Repositories, Cmen, NJ) n rition hyri mpping pnels (Stnfor Humn Genome Center, Stnfor, CA) were use to etermine the hromosoml loliztion of DCD. RNA expression nlysis of DCD. To etet DCD expression, RT-PCR ws one with RNA from vrious tissues n ell lines. Isoltion of RNA from enign melnoyti nevi, primry utneous melnom n skin tissues ws one with moifie proeure s esrie 27. In ition, DNA from the multiple tissue DNA (MTC) pnels humn I n II, humn fetl, humn igestive system n humn tumor (Clonteh, Heielerg, Germny) were nlyze y PCR. The PCR mplifition mixture ontine 5 µl of the templte, 1 Tq PCR retion uffer, 0.5 µl of Tq-polymerse (Amershm Phrmi, Freiurg, Germny), 0.4 mm NTP 1136 nture immunology volume 2 no 12 eemer 2001 http://immunol.nture.om

n 0.4 µm of eh primer. The primers we use were 5 AGCATGAGGTTCAT- GACTCTC 3 n 5 CACGCTTTCTAGATCTTCGAC 3. The PCR prout ws 290 p. As ontrol, GAPDH ws mplifie with the primers: 5 AATGCCTCCTGCACCACC 3 n 5 ATGCCAGTGAGCTTCCCG 3. The PCR onitions were 30 yles for GAPDH or 30 40 yles for DCD t 96 C for 1 min, 54 C for 1 min n 72 C for 80 s. Eh PCR ws one t lest twie n inlue two negtive ontrols n t lest one positive ontrol. A 100- p mrker ws use s referene mrker in grose gel eletrophoresis (MBI Ferments, St. Leon-Rot, Germny). In situ hyriiztion, immunohistohemistry, immunofluoresene n immunogol eletron mirosopy. In situ hyriiztion ws one on 5-µm prffin tissue setions tht were fixe in formlin with single-strne ntisense or ontrol sense igoxigenin-lele proes. The proes were synthesize y in vitro trnsription of DCD DNA in pbluesript SK with the DIG RNA leling kit (Rohe, Mnnheim, Germny) n T3 n T7 RNA polymerse. Severl melnoyti nevi, iopsies of norml skin n two primry melnom were exmine. For the ientifition of DCD protein with immunohistology or immunofluoresene, 2- or 5-µm vertil prffin setions of norml skin were ehyrte, loke with norml horse serum n inute for 1 h with 1:3000 ilution of polylonl rit ntiserum to DCD. The ntiserum ws otine fter repete immuniztion with the peptie KENAGEDPGLARQAPKPRKQRSSL, whih ws ouple to keyhole limpet hemoynin. The setions were inute with iotinylte nti rit IgG (Vetor, Burlingme, CA), followe y inution with the Vetstin ABC-AP system (Vetor), evelope with neufuhsin n ounterstine with hemtoxylin. For immunofluoresene nlysis, the setions were stine with polylonl ntiserum to DCD n inute for 1 h with 1:500 ilution of Cy5-onkey nti rit serum (Dinov, Hmurg, Germny). The myoepithelil ells of the seretory oil of erine swet glns were then lele with monolonl nti-tin (Enzo Dignostis, Loxo, Dossenheim, Germny), stine with Cy3-onkey nti mouse serum (Dinov) n ll nulei were stine with YOPRO (Moleulr Proes, Leien, Netherlns). The setions were nlyze with onfol lser snning mirosope (Lei TCS SP, Lei Mirosystems, Bensheim, Germny) n mgnifie 250 times. For ultrstruturl loliztion of DCD, norml xill skin ws trete s esrie 28. The setions were ounterstine with urnyl ette n le itrte n exmine with ZEISS EM 109 eletron mirosope (Zeiss, Jen, Germny). Peptie synthesis, HPLC nlysis, mss spetrometry n protein sequening. Pepties were synthesize y the soli phse metho with the Fmo/But-strtegy on MilliGen 9050 ontinuous flow synthesizer (Millipore, Befor, MA). The leve, prouts were purifie y grient reverse phse (RP-HPLC) to purity of 95 %. Peptie ientity ws onfirme y eletrospry mss spetrometry on Finnign MAT 700 instrument (Finnign Corp., Sn Jose, CA). Isoltion of proteins from humn swet ws one s follows. Humn swet (25 ml) ws lyophilize overnight to yiel olorless, hygrosopi soli prout. The resiue ws issolve in 500 µl of 10 % eti i in wter n sonite for 1 min. Nonsoluilize mteril ws remove y entrifugtion t 10,000g for 5 min. The superntnt (100 µl) ws sujete RP-HPLC on Nuleosil C18 olumn (125 4 mm) with 5-µm prtiles n 120-Å pore size) with flow rte of 1 ml/min. Solvent A ws 0.055% queous trifluoroeti i; solvent B ws 80% etonitrile in 0.05% queous trifluoroeti i. A liner grient of 0% B to 60 % B over 40 min ws use. The resulting elution peks were ollete n onentrte with spee v to volume of 15 µl. Smples of 1 µl of eh frtion were use for MALDI-TOF nlysis (G2025A, Hewlett-Pkr, Wlronn, Germny), 2,5,-ihyroxyetophenone ws use s mtrix. The pek tht elute t 20.72 min ws highly homogeneous n ontine the DCD-1 peptie (whih h moleulr mss of 4.702 kd). This frtion ws nlyze y utomte Emn egrtion with n Applie Biosystems 494 protein sequener. (Applie Biosystems-MDS Siex, Conor, Cn). Nnoeletrospry mss spetrometry ws one on n QSTAR Pulsr i QqoTof mss spetrometer (Applie Biosystems-MDS Siex) with meium Protn NnoES spry pillries. For tnem mss spetrometry experiments, the resolution of the first qurupole ws set to trnsmit the isotopi envelope of the ion of interest. Nitrogen ws use s the ollision gs. For Emn mirosequening, liquots of the HPLC frtions were pplie onto TFA-trete glss filter iss tht were ote with 0.75 mg of polyrene, rie n sequene in protein sequener Proise 494A (Applie Biosystems, Weiterstt, Germny) following the mnufturer s protools. Antimiroil ssy. The ntimiroil tivity of DCD-1L, Y-P30, DPI n four swet frtions ws nlyze with olony-forming unit ssy s esrie 13 ; E. oli, S. ureus, E. felis n C. lins were ssesse. E. oli were grown in LB meium, E. felis n S. ureus in Columi meium (Difo, BD Heielerg, Germny) n C. lins in seinhyrolyste meium (Merk, Drmstt, Germny). The teril n yest onentrtions were etermine photometrilly. Bteril strins were ulture to n A600 of 0.4 0.7 n the yest strin to n A450 of 0.4 0.6. Before nlysis, we etermine the onentrtion of the orgnisms in ulture y plting ifferent teril n yest ilutions. At A600, 1.0 orrespone to 8.2 10 9 /ml for E. oli, 1.9 10 10 /ml for S. ureus n 9.0 10 9 /ml for E. felis. At A450, 1 orrespone to 1.4 10 8 /ml for C. lins. Cells were wshe twie with 10 mm soium phosphte uffer (ph 7.4) n ilute to onentrtion of 2 10 6 ells/ml (for E. oli, E. felis n C. lins) or 2 10 7 ells/ml (for S. ureus) in phosphte uffer. Cells were inute t 37 C for 4 h with vrious onentrtions of pepties or swet frtions (protein onentrtion, 10 µg/ml) in 200 µl of soium phosphte uffer. The ells were ilute 1:50 500, n 50 µl n 100 µl of the solutions were plte in uplite on gr pltes. At lest four pltes from eh experiment were evlute n the men numer of olonies etermine. The teriil tivity of the teste regents were expresse s: [1 (ell survivl fter peptie inution)/(ell survivl fter ontrol peptie inution)] 100, whih represente the perentge of ells tht were kille. To exmine the tivity profile of DCD-1L n the ntiioti swet frtion tht ontine DCD-1, we inute the miroorgnisms for 4 h with 10 µg/ml of DCD-1L or swet frtion uner the following onitions. Phosphte uffer (10 mm) + either 25, 100 or 150 mm soium hlorie; phosphte uffer (10 mm) t ph 5.5, 6.5 or 7.4; swet uffer (40 mm NCl, 10 mm KCl, 1 mm CCl2, 1 mm MgCl2 n 1mM N-ihyrogenphosphte) t ph 5.5 or 6.5. Then ntimiroil tivity ws ssesse s outline ove. Gennk ession numer. The Gennk ession numer for the DCD DNA sequene we ientifie is AF144011. Another group hs lso eposite DCD sequene, the ession numer for this t is AY044239. Aknowlegements We thnk T. Iftner n ollegues for DNA sequening; M. Shwrz n ollegues for the use of rioisotopes n Phosphorimger; B. Fehrenher n H. Bishof for eletron mirosopy;a. Norheim for mss spetrometry; E. Mzey for tehnil ssistne; n P. Gött,T. Pul, M. Strk n F. Lng for isussions. Supporte y the Fortüne-progrm of the Eerhr-Krls-University Tüingen (432-0-1), the Bunesministerium für Bilung un Forshung (IZKF, Fö01KS9602) n the Deutshe Forshungsgemeinshft (SFB510). Reeive 8 June 2001; epte 11 Otoer 2001. 1. Gllo, R. L. et l. Synens, ell surfe heprn sulfte proteoglyns, re inue y proline-rih ntimiroil peptie from wouns. Pro. Ntl A. Si. USA 91, 11035 11039 (1994). 2. Hrer, J., Brtels, J., Christophers, E. & Shroer, J. M.A peptie ntiioti from humn skin. Nture 387, 861 (1997). 3. Frohm, M. et l. The expression of the gene oing for the ntiteril peptie LL-37 is inue in humn kertinoytes uring inflmmtory isorers. J. Biol. Chem. 272, 15258 15263 (1997). 4. Hnok, R. E. & Lehrer, R. Ctioni pepties: new soure of ntiiotis. Trens Biotehnol. 16, 82 88 (1998). 5. Jones, D. E. & Bevins, C. L. Defensin-6 mrna in humn Pneth ells: implitions for ntimiroil pepties in host efense of the humn owel. FEBS Lett. 315, 187 192 (1993). 6. Hrer, J., Brtels, J., Christophers, E. & Shroer, J. M. Isoltion n hrteriztion of Humn β- Defensin-3, novel humn inuile peptie ntiioti. J. Biol. Chem. 276, 5707 5713 (2000). 7. Hipfel, R., Shittek, B., Boinguer,Y. & Gre, C. Speifilly regulte genes in mlignnt melnom tissues ientifie y sutrtive hyriiztion. Br. J. Cner 82, 1149 1157 (2000). 8. Toorov, P. et l. Chrteriztion of ner heti ftor. Nture 379, 739 742 (1996). 9. Toorov, P.T., Deon, M. & Tisle, M. J. Struturl nlysis of tumor-proue sulfte glyoprotein ple of inititing musle protein egrtion. J. Biol. Chem. 272, 12279 12288 (1997). 10. Cunninghm,T. J. et l. Ientifition of survivl-promoting peptie in meium onitione y oxitively stresse ell lines of nervous system origin. J. Neurosi. 18, 7047 7060 (1998). 11. Cunninghm,T. J., Jing, H.,Wng,Y. & Hoge, L. Clretiulin ining n other iologil tivities of survivl peptie Y-P30 inluing effets of systemi tretment of rts. Exp. Neurol. 163, 457 468 (2000). 12. Bls, R. Epithelil ntimiroil pepties in host efense ginst infetion. Respir. Res. 1, 141 150 (2000). 13. Vlore, E.V. et l. Humn β-efensin-1: n ntimiroil peptie of urogenitl tissues. J. Clin. Invest. 101, 1633 1642 (1998). 14. Sto, K., Kng,W. H., Sg, K. & Sto, K.T. Biology of swet glns n their isorers. I. Norml swet gln funtion. J.Am.A. Dermtol. 20, 537 563 (1989). 15. Ok,T., Konishi, H., Ito, M., Ngur, H. & Asi, J. Ientifition of seretory immunogloulin A in humn swet n swet glns. J. Invest. Dermtol. 90, 648 651 (1988). 16. Jones,A. P.,We, L. M.,Anerson,A. O., Leonr, E. J. & Rot,A. Norml humn swet ontins interleukin-8. J. Leuko. Biol. 57, 434 437 (1995). 17. Diierjen, L. et l. Biologilly tive interleukin 1 in humn erine swet: site-epenent vritions in lph/et rtios n stress-inue inrese exretion. Cytokine 2, 438 446 (1990). 18. Ahme,A.A., Norlin, K., Shultzerg, M. & Lien, S. Interleukin-1α- n β-, interleukin-6- n tumour nerosis ftor-β-like immunoretivities in hroni grnulomtous skin onitions. At Derm.Venereol. 74, 435 440 (1994). 19. Wollin, U. et l. Erine swet glns: expression of trnsforming growth ftor-β n one morphogeneti protein type I reeptors n their intrellulr signlling Sm proteins. At Derm.Venereol. 79, 183 186 (1999). 20. Myl,Y. et l. The proltin-inuile protein (PIP/GCDFP-15) gene: loning, struture n regultion. Mol. Cell. Enorinol. 80, 165 175 (1991). 21. Frki, J. E. Humn skin proteses. Seprtion n hrteriztion of two i proteses resemling thepsin B1 n thepsin D n of n inhiitor of thepsin B1. Arh. Dermtol. Res. 255, 317 330 (1976). 22. Frki, J. E., Jnsen, C.T. & Hopsu-Hvu,V. K. Humn swet kllikrein. Biohemil emonstrtion n hromtogrphi seprtion from severl other esteropeptises in the swet. At Derm.Venereol. 50, 321 326 (1970). 23. Golmn, M. J. et l. Humn β-efensin-1 is slt-sensitive ntiioti in lung tht is intivte in ysti firosis. Cell 88, 553-560 (1997). 24. Gllo, R. L. & Huttner, K. M.Antimiroil pepties: n emerging onept in utneous iology. J. Invest. Dermtol. 111, 739 743 (1998). 25. Tossi,A., Snri, L. & Gingspero,A.Amphipthi α-helil ntimiroil pepties. Biopolymers 55, 4 30 (2000). 26. Hnok, R. E. & Lehrer, R. Ctioni pepties: new soure of ntiiotis.trens Biotehnol. 16, 82 88 (1998). 27. Hipfel, R., Gre, C. & Shittek, B. RNA isoltion from humn skin tissues for olorimetri ifferentil isply. J. Biohem. Biophys. Meth. 37, 131 135 (1998). 28. Shumurg-Lever, G. Ultrstruturl loliztion of letin-ining sites in norml skin. J. Invest. Dermtol. 94, 465 470 (1990). http://immunol.nture.om eemer 2001 volume 2 no 12 nture immunology 1137