Wolchi uses host microrna to regulte trnscripts of methyltrnsferse, contriuting to dengue virus inhiition in Aedes egypti Gungmei Zhng, Mzhr Hussin, Scott L. O Neill,c, nd Sssn Asgri,1 Austrlin Infectious Disese Reserch Centre, School of iologicl Sciences, University of Queenslnd, St. Luci, QLD 4072, Austrli; School of iologicl Sciences, Monsh University, Clyton, VIC 3800, Austrli; nd c Institute of Moleculr iosciences, University of Queenslnd, St. Luci, QLD 4072, Austrli Edited y Nncy A. Morn, Yle University, West Hven, CT, nd pproved My 7, 2013 (received for review Ferury 25, 2013) The endosymiont Wolchi is common mong insects nd known for the reproductive mnipultions it exerts on hosts s well s inhiition of virus repliction in their hosts. Recently, we showed tht Wolchi uses host micrornas to mnipulte host gene expression for its efficient mintennce in the dengue mosquito vector, Aedes egypti. Cytosine methyltion is medited y group of proteins clled DNA (cytosine-5) methyltrnsferses, which re structurlly nd functionlly conserved from prokryotes to eukryotes. The iologicl functions of cytosine methyltion include host defense, genome stility, gene regultion, developmentl promotion of orgns, nd lifespn regultion. Ae. egypti hs only one DNA methyltrnsferse gene (ADnmt2) elonging to the cytosine methyltrnsferse fmily 2, which is the most deeply conserved nd widely distriuted gene mong metzons. Here, we show tht in mosquitoes the introduced endosymiont, Wolchi, significntly suppresses expression of ADnmt2, ut dengue virus induces expression of ADnmt2. Interestingly, we found tht e-mir-2940 microrna, which is exclusively expressed in Wolchi-infected mosquitoes, down-regultes the expression of ADnmt2. Reversely, overexpression of ADnmt2 in mosquito cells led to inhiition of Wolchi repliction, ut significntly promoted repliction of dengue virus, suggesting cusl link etween this Wolchi mnipultion nd the locking of dengue repliction in Wolchiinfected mosquitoes. In ddition, our findings provide n explntion for hypomethyltion of the genome in Wolchi-infected Ae. egypti. endosymiosis Wolchi pipientis Dengue is endemic in more thn 110 tropicl countries, with 2.5 3.0 illion people living t risk for infection. Ech yer, it is reported to infect more thn 50 million people worldwide (1). Dengue virus (DENV) from the genus Flvivirus is positive-strnd RNA virus, which is primrily trnsmitted to humns y femle Aedes mosquitoes. ecuse there re currently neither specific ntivirl drugs nor pproved vccines ginst DENV, insect vector control is still considered the est pproch to prevent dengue trnsmission. In recent yers, Wolchi infections of mosquitoes hve een proposed s novel pproch for re-wide dengue control tht is inexpensive to implement nd self-sustining (2, 3). Wolchi, mternlly inherited Grm-negtive endosymiotic cteri, re estimted to occur nturlly in more thn 40% of ll insect species nd 28% of surveyed mosquito species (4, 5). However, with some exceptions, they hve not een found in importnt species tht re the vectors of humn pthogens such s dengue nd mlri. Recently, severl strins of Wolchi hve een successfully introduced into Aedes egypti (6, 7). Mosquitoes with wmelpop strin trnsinfection showed out 50% reduction in dult femle lifespn (8). Interestingly, Ae. egypti infected with Wolchi induces very strong resistnce to severl roviruses including DENV, yellow fever, nd Chikunguny viruses, Plsmodium, nd filril nemtodes (9 12). MicroRNAs (mirnas) re n evolutionrily conserved clss of smll 22 nucleotides noncoding RNAs tht regulte gene expression vi prtilly or completely mtching to their trget genes (13). They ply importnt roles in cellulr processes including development, differentition, poptosis, nd immunity. Until now, more thn 25,000 mirna sequences hve een identified from different orgnisms including protozons, plnts, nimls, nd viruses (mirse v19) (14). It hs een reported tht the expression levels of cellulr mirnas drmticlly chnge in response to cteril nd virl infections in nimls nd plnts (15 20). In humn, liver-specific mirna, mir-122, cn trget the 5 UTR of heptitis C virus to enhnce virl repliction (21). Hung et l. (2007) (17) reported tht HIV lso uses host mirnas to trget its genes to its own dvntge. Recently, we reported differentil expression of severl mirnas in Wolchi-infected Ae. egypti mosquitoes with n mirna, e-mir-2940, which is exclusively expressed in Wolchi-infected mosquitoes. y using the host e-mir-2940, Wolchi up-regultes the expression of host metlloprotese gene, metlloprotese m41 ftsh, which is essentil for the endosymiont s mintennce (18). In this study, we identified nother trget gene of e-mir- 2940, ADnmt2. ADnmt2 elongs to cytosine methyltrnsferse fmily 2, which is the only DNA methyltrnsferse found in Dipter. In Drosophil, ddnmt2 is primrily loclized in the cytoplsm nd much less in the nucleus nd could medite oth DNA nd RNA methyltions (22, 23). Here, we imed to investigte the impct of Wolchi nd consequently up-regultion of e-mir-2940 on ADnmt2. In ddition, we investigted the possile impct of regultion of the trget gene on DENV repliction. Our results suggest tht ADnmt2 plys n importnt role not only in the mintennce of Wolchi infection in mosquito cells, ut lso in the resistnce of mosquito cells to DENV infection. Results Expression Profile of ADnmt2 in Ae. Aegypti. y using Ntionl Center for iotechnology Informtion (NCI) LAST, RNA- Hyrid, nd RNA22 softwre, puttive 5-cytosine DNA methyltrnsferse (ADnmt2, Gennk ID: XM_001657505) from Ae. egypti ws identified s nother trget of differentilly expressed mirna, e-mir-2940, which ws previously shown to up-regulte the trnscript levels of metlloprotese gene in Wolchi-infected mosquitoes (18). Further nlysis of the sequence showed tht ADnmt2 is homolog of pmt1 from fission Author contriutions: G.Z., M.H., nd S.A. designed reserch; G.Z. nd M.H. performed reserch; S.L.O. nd S.A. contriuted new regents/nlytic tools; G.Z. nd S.A. nlyzed dt; nd G.Z., M.H., S.L.O., nd S.A. wrote the pper. The uthors declre no conflict of interest. This rticle is PNAS Direct Sumission. 1 To whom correspondence should e ddressed. E-mil: s.sgri@uq.edu.u. This rticle contins supporting informtion online t www.pns.org/lookup/suppl/doi:10. 1073/pns.1303603110/-/DCSupplementl. 10276 10281 PNAS June 18, 2013 vol. 110 no. 25 www.pns.org/cgi/doi/10.1073/pns.1303603110
yest (24) nd Dnmt2 from humn, Drosophil, nd other orgnisms (25 27). ADnmt2 is 344- protein with 47% identity to the Drosophil Dnmt2 protein. Like other Dnmt2 proteins, ADnmt2 contins ll 10 dignostic nd ctlytic motifs of ctive DNA methyltrnsferses. In ddition, similr to Drosophil, there is only one Dnmt gene present in Ae. egypti genome. In Drosophil, humn, nd zerfish, the expression of Dnmt2 is developmentlly nd tissue-specificlly regulted (22, 23, 25, 28). In this study, we investigted the expression pttern of ADnmt2 in Ae. egypti y RT-PCR using ADnmt2 gene specific primers. We found tht the trnscript levels of ADnmt2 gene were not detectle in ny of the lrvl stges, ut could e detected in dults (Fig. 1A). The trnscript levels of ADnmt2 were lower in 1-d-old dults compred with 4-d-old dults (Fig. 1A). We lso found tht ADnmt2 is minly expressed in the domen of oth mle nd femle mosquitoes, which suggests tht ADnmt2 could e specificlly expressed in some orgns in the domen (Fig. 1). Tissue-specific RT-quntittive PCR (qpcr) nlysis of four tissues (ovry, slivry glnds, midgut, nd thorcic muscles) from Ae. egypti femles t 4 nd 12 d fter emergence confirmed tht the highest trnscript levels of AeDnmt2 were found in the ovries (see elow). Ae. egypti is the host nd vector of n importnt humn pthogen, DENV. Recently, the insect endosymiont Wolchi ws successfully introduced into Ae. egypti nd found to inhiit the ility of pthogens such s DENV to infect this mosquito species (10, 11). sed on this, we investigted the expression profile of ADnmt2 in mosquitoes infected with Wolchi or DENV. In Wolchi-infected mosquitoes t 4 d fter emergence, ADnmt2 ws not detected y RT-PCR, ut it could e detected in its tetrcycline-cured (tet-cured) counterprt mosquitoes (Fig. 2A). ADnmt2 ws minly expressed in the domen of tetcured mosquitoes (Fig. 2). Interestingly, in 3-d-old femles infected with Wolchi, ADnmt2 could not e detected in either the hed nd thorx or the domen (Fig. 2). Consistently, when specific tissues from 4- nd 12-d-old femle mosquitoes were nlyzed using RT-qPCR, in generl, out twofold less AeDnmt2 trnscripts were found in Wolchi-infected mosquito tissues (Fig. 3). In tet-cured mosquitoes infected with DENV, RT-PCR results showed tht ADnmt2 ws expressed t much higher levels compred with the mosquitoes without DENV (Fig. 2C). e-mir-2940 Down-regultes the Expression of ADnmt2. The trget sequences of e-mir-2940 were predicted in the coding region of ADnmt2 (nucleotides 1011 1035) with significnt complementrity to e-mir-2940 (Fig. 4A). In Ae. egypti Ag2 cells s well s wmelpop-cla infected Ag2 cells (g2.wmelpop-cla), ADnmt2 trnscripts could not e detected (Fig. 2). The reson for lck of detection of ADnmt2 in Ag2 cells, compred with Wolchi-free mosquitoes (Fig. 2), is the expression of e-mir- 2940 in noninfected mosquito cell lines compred with whole mosquitoes, lthough t lower level compred with Wolchiinfected cells (18). To confirm this, the Dicer-1 gene ws silenced in Ag2 cells using RNAi. After confirming gene silencing, RT- PCR results showed tht the trnscript levels of ADnmt2 were considerly higher compred with mock-trnsfected Ag2 cells (Fig. 4), which confirmed tht inhiition of ADnmt2 expression in Ag2 cells is medited y mirnas. To further confirm tht emir-2940 contriutes in this inhiition, we trnsfected Ae. egypti Ag2 cells with synthetic e-mir-2940 specific nd e-mir- 2940* specific inhiitors, respectively. RT-PCR results showed incresed trnscript levels of ADnmt2 in cells trnsfected with e-mir-2940 specific inhiitor compred with cells trnsfected with control e-mir-2940* specific inhiitor nd mock-trnsfected cells (Fig. 4). These results suggest tht e-mir-2940 downregultes the trnscript levels of ADnmt2, which is consistent with the expression pttern of ADnmt2 gene in mosquitoes with or without Wolchi (Figs. 2 A nd nd 3). ADnmt2 Suppresses Wolchi Repliction. In previous study, we reported tht e-mir-2940 up-regultes the trnscript levels of the host metlloprotese, which is required for Wolchi repliction nd mintennce in mosquito cells (18). Considering tht e-mir-2940 down-regultes the trnscript levels of ADnmt2, we investigted whether ADnmt2 hs ny effect on Wolchi repliction. For this, ADnmt2 ws overexpressed in g2.wmelpop- CLA cells nd the density of Wolchi ws nlyzed y PCR. Twodifferentmountsof/ADnmt2wereusedtotrnsfect g2.wmelpop-cla cells resulting in one line expressing the gene t higher level (L1) compred with the other (L2) (Fig. 5A). PCR results with wsp gene specific primers reveled tht Wolchi density ws considerly lower in cells trnsfected with the /ADnmt2 vector compred with cells trnsfected with the empty vector () (Fig. 5). This effect ws found to e dose-dependent ecuse PCR results showed tht Wolchi density ws much lower in L1, where ADnmt2 is expressed t higher level compred with L2, the lower overexpressing ADnmt2 line (Fig. 5). However, Wolchi density ws lower in L2 compred with empty vector trnsfected cells (Fig. 5). A qpcr nlysis further confirmed tht overexpression of ADnmt2 leds to lower Wolchi density (Fig. 5C). These results suggest tht ADnmt2 suppresses Wolchi repliction in the cell line nd the suppression is concentrtion-dependent, which is consistent with the expression profile tht ADnmt2 is detected t considerly lower levels in Wolchi-infected mosquitoes compred with tetrcycline-cured counterprt mosquitoes (Figs. 2A nd 3). ADnmt2 Enhnces DENV Repliction. In oth Ae. egypti nd mosquito cell lines, Wolchi ws found to limit repliction of DENV (10, 11), which could e due to mnipultion of the host genes expression vi mirnas y Wolchi. To explore the effect of ADnmt2 on DENV repliction, we overexpressed ADnmt2 in Ag2 cells tht were susequently infected with DENV. Totl RNA t 72 h fter virl infection ws isolted nd nlyzed y RT-PCR with DENV-specific primers. The results showed tht the reltive undnce of DENV ws significntly higher in the cells overexpressing ADnmt2 compred with cells trnsfected with the empty vector (Fig. 6A). This result ws lso confirmed y RT-qPCR (Fig. 6). These results suggest tht ADnmt2 enhnces repliction of DENV in cells, which is consistent with the expression profile tht ADnmt2 trnscripts levels were induced in mosquitoes infected with DENV (Fig. 2C). However, when MICROIOLOGY A ADnmt2 Lrve 1st 2nd 3rd 4th Adults 1 d 4 d 4d 4d HT A HT A ADnmt2 Fig. 1. ADnmt2 expression profile. (A) RT-PCR nlysis ws performed using the totl RNA smples from Ae. egypti mosquito lrve nd dults. () RT-PCR nlysis ws performed with hed + thorx (HT) nd domen (A) of mosquito femles nd mles. gene ws used s control to show the integrity of RNA., positive control using Ag2 genomic DNA (gdna);, RT-PCR control rections in which reverse trnscriptse ws not dded. Zhng et l. PNAS June 18, 2013 vol. 110 no. 25 10277
A Wol - Wol Hed+thorx 2 d 3 d domen 2 d 3 d ADnmt2 Wol C ADnmt2 Mock DENV Wol Fig. 2. ADnmt2 expression profile in Wolchi or DENV-infected mosquitoes. (A) RT-PCR nlysis ws performed using totl RNA smples from 4-d-old Wolchi-infected (Wol+) nd uninfected (Wol ) femle mosquitoes. () RT-PCR nlysis ws performed using totl RNA smples from Wol+ nd Wol hed + thorx (HT) nd domen (A) of femle mosquitoes t 2 nd 3 d fter emergence. (C ) RT-PCR nlysis ws performed using totl RNA smples from 3-d DENV-infected nd uninfected mosquitoes (without Wolchi). gene ws used s control to show the integrity of RNA. ina serves s positive control for C ecuse the rections were done t the sme time. g2.wmelpop-cla cells were trnsfected with /ADnmt2 ndtheninfectedwithdenv,virusreplictionwsnotenhncedyadnmt2compredwithcellstrnsfectedwiththe empty vector (Fig. 6C). Consistently, when wmelpop-cla cells were trnsfected with e-mir-2940 specific inhiitornd susequently infected with DENV, virus repliction incresed over time compred with wmelpop-cla cells trnsfected with Reltive trnscript levels of ADnmt2 Ovry 4d-Wol Midgut Slivry Muscle Ovry Midgut Slivry Muscle 4d+Wol 4 dys -Wol 4 dys +Wol 12 dys -Wol Ovry c 12d-Wol 12d+Wol 1.20E-03 8.00E-04 4.00E-04 Ovry Midgut Slivry Muscle 4d-Wol 4d+Wol 12 dys +Wol Slivry glnds 12d-Wol 12d+Wol Fig. 3. Tissue-specific expression of AeDnmt2 in femle Ae. egypti mosquitoes. RT-qPCR nlysis of AeDnmt2 trnscript levels in the ovry, midgut, slivry glnds, nd thorcic muscle tissues (muscle) of 4- nd 12-d-old Wol+ nd Wol femle mosquitoes. Trnscript levels of AeDnmt2 were lso compred in the ovries nd slivry glnds in the smples (ottom two grphs). There re sttisticlly significnt differences etween groups with different letters t P < 0.0001 (one-wy ANOVA with Tukey s post-hoc test). the control inhiitor; however, the effect ws moderte (1.5 timest72h)ndnotsttisticllysignificnt (P > 0.05; Fig. 7). The moderte effect could e due to regultion of AeDnmt2 trnscripts y more thn one mirna; therefore, when emir-2940 is specificlly inhiited, nother mirna my still down-regulte AeDnmt2 trnscript levels leding to only prtil up-regultion of AeDnmt2 trnscript levels resulting from emir-2940 inhiition. In fct, when Dicer-1 ws silenced in Ag2 cells, which ffects mirna iogenesis in generl, considerly more AeDnmt2 trnscripts were mplified compred with when e-mir-2940 ws specificlly inhiited using the mirna-specific inhiitor (Fig. 4; compre Dicer 1 RNAi with 2940 inhiitor), which further supports the ssumption. It hs lredy een shown tht one mrna cn e trget of more thn one mirna (29 31). Our preliminry ioinformtics serch showed tht numer of other Ae. egypti mirnas (Fig. S1), which re differentilly expressed in Wolchi-infected mosquitoes (18), could potentilly trget AeDnmt2; however, their interctions with AeDnmt2 need to e experimentlly vlidted. Discussion In recent study, we reported tht wmelpop strin of Wolchi ltered the expression of numer of host mirnas, including e-mir-2940 in the host mosquito Ae. egypti (18). In turn, emir-2940 up-regulted the trnscript levels of trget gene, metlloprotese ftsh. Metlloprotese ws found to e crucil for efficient repliction nd mintennce of the endosymiont in Ae. egypti (18). However, the role of induced mirnas in the immune response to DENV nd other microorgnisms hs not een explored. The present study identified ADnmt2, methyltrnsferse, s nother trget gene of e-mir-2940 in Ae. egypti, which is highly expressed in the ovries. We found tht in the sence of the mirna, either y Dicer-1 silencing or specificlly using synthetic inhiitor of e-mir-2940, AeDnmt2 ws upregulted, suggesting tht e-mir-2940 negtively regultes the trnscripts of AeDnmt2. In ddition, y investigting the expression ptterns, we found tht the trnscription levels of ADnmt2 were significntly suppressed y Wolchi in mosquitoes nd y e-mir-2940 in the mosquito cell line. This trend ws lso oserved in specific tissues of the mosquitoes tested. The trnscription levels of ADnmt2 were incresed y DENV infection in mosquitoes. Interestingly, overexpression of ADnmt2 in g2.wmelpop-cla cells resulted in significnt decline in Wolchi density. Overexpression nd coinfection with DENV in Ag2 cells showed significnt increse in DENV repliction, ut not in g2.wmelpop-cla cells. These results 10278 www.pns.org/cgi/doi/10.1073/pns.1303603110 Zhng et l.
A ADnmt2 mrna 5 Coding region 1039 1164 t 1011-1035 Trget 5' G UUAUUU 3' CUCG GAUGAGAUGGACUG GAGC CUAUUCUAUUUGGU mirna 3' CG UGU 5' ADnmt2 Fig. 4. ADnmt2 trnscription is down-regulted y e-mir-2940. (A) Schemtic digrm showing ADnmt2 mrna nd its trget sequences with complete complementrity of e-mir-2940 seed region (old nd underlined) with the sequences. () RT-PCR nlysis of RNA extrcted from mock-trnsfected Ag2 nd g2.wmelpop-cla (Pop) cells, nd Ag2 cells trnsfected with Dicer-1 dsrna, e-mir-2940, nd e-mir-2940* (control) synthetic inhiitors. gene ws used s control to show the integrity of RNA. suggest tht y inducing the expression of e-mir-2940, Wolchi could down-regulte ADnmt2, which in turn inhiits repliction of DENV. This descries potentil mechnism of suppression of DENV repliction y Wolchi. Insects use vriety of immune responses such s RNA interference, the Jnus kinse (JAK)-signl trnsducer nd ctivtor of trnscription (STAT) (JAK/STAT), Toll, nd Immune Deficiency (IMD) pthwys nd utophgy to contin virl infections (32 36). In their originl host Drosophil, some strins of Wolchi could induce resistnce to vrious viruses such s Drosophil C virus, cricket prlysis virus, Nor virus, flock house virus, nd West Nile virus (37 39). Drosophil synergisticlly uses severl pthwys to control virl infections (40 42). Recently, some strins of Wolchi were successfully introduced into vrious mosquito species such s Ae. egypti, Aedes lopictus, nd Anopheles gmie (somtic infection) in n effort to limit repliction nd spred of vrious vector-orne pthogens such s DENV nd mlri (6, 7, 43). Wolchi effectively suppress DENV, Chikunguny virus, yellow fever virus, nd Plsmodium in their new hosts (9 12, 43, 44). Studies hve shown tht in Ae. egypti, the symionts up-regulte the expression of lrge numer of host immune genes such s defensins, cecropins, JAK-STAT, nd Toll pthwy genes (10, 33, 35, 43, 44). These suggest tht similr to Drosophil, Wolchi-infected Ae. egypti my lso use multiple pthwys ctivted y Wolchi to control pthogen infections. ADnmt2 down-regultion might e used synergisticlly to suppress DENV y Ae. egypti. Reductions in ADnmt2, the only methyltrnsferse in Ae. egypti, y Wolchi vi induction of e-mir-2940, would imply hypomethyltion of the genome in Wolchi-infected mosquitoes, which hs significnt implictions in epigenetic regultion of gene expression. Role of mirnas in regultion of methyltion vi controlling DNA methyltrnsferses hs een documented. For exmple, mir-148 down-regultes Dnmt3 in humn HeL cells y trgeting its trnscripts in the coding region (45) nd Dnmt1 in oth humn cholngiocrcinom nd systemic lupus erythemtosus cell lines y trgeting either 3 UTR or the coding region (46, 47). Overexpression of mir-148 decresed Dnmt1, which in turn promoted DNA hypomethyltion nd enhnced the expression of vrious methyltion-sensitive genes. Considering sustntil chnges in the trnscriptome profile of Wolchi-infected mosquitoes reltive to noninfected ones (12), it is conceivle tht some of these chnges re due to differentil/hypo methyltion of the mosquito genome. Indeed, recent report demonstrted tht in wmelpop-infected Ae. egypti mosquitoes the pttern of cytosine methyltion of the genome is widely disrupted leding to n overll hypomethyltion of the genome in Wolchi-infected mosquitoes compred with noninfected mosquitoes (48). Tken together, our studies suggest tht e-mir-2940 plys n importnt role not only in the mintennce of Wolchi infection in mosquito cells, ut lso contriutes to the resistnce to DENV infection in mosquito cells. Our findings descrie mechnism for Wolchi to regulte host gene expression y ffecting methyltion nd limit DENV infection y using host mirnas in Ae. egypti. Our results demonstrted criticl functionl link etween Wolchi, mirnas, nd DENV, which furthers our understnding of Wolchi virus mosquito interctions. MICROIOLOGY A /ADnmt2 L1 L2 C ADnmt2 Wolchi /ADnmt2 L1 L2 /ADnmt2 Fig. 5. ADnmt2 reduces Wolchi repliction. (A) RT-PCR nlysis ws performed to confirm tht ADnmt2 ws overexpressed in /ADnmt2 plsmidtrnsfected g2.wmelpop-cla cells. L1 nd L2 refer to two trnsfected lines estlished using two different concentrtions of /AeDnmt2; L1 reflects concentrtion of 2 μg; L2 concentrtion of 1 μg. primers were used s control to show the integrity of RNA. () PCR nlysis of Wolchi density 72 h fter trnsfection with or /ADnmt2 plsmid in L1 nd L2 (s in A) in g2.wmelpop-cla cells using primers specific tothewolchi wsp gene. primers were used s control to show the integrity of DNA. (C) qpcr nlysis of DNA extrcted from g2.wmelpop-cla cells 72 h fter trnsfection with or /ADnmt2. Three iologicl with three technicl replictes were crried out for ech trnsfection. Asterisks indicte significnt difference etween mock nd ADnmt2 trnsfections (P < 0.001; t test). Zhng et l. PNAS June 18, 2013 vol. 110 no. 25 10279
A C ns DENV /ADnmt2 /ADnmt2 Fig. 6. ADnmt2 enhnces DENV repliction in cells without Wolchi. (A) RT-PCR nlysis of RNA using DENV-specific primers 72 h fter trnsfection with or /ADnmt2 in Ag2 cells., primers to the gene showing the integrity of RNA. () RT-qPCR nlysis of DENV undnce 72 h fter trnsfection with or /ADnmt2 in Ag2 cells. (C) RT-qPCR nlysis of RNA using DENV-specific primers in g2.wmelpop-cla cells 72 h fter trnsfection with or /ADnmt2. For nd C, three iologicl replictes with three technicl replictes were crried out for ech trnsfection. Asterisks indicte significnt difference etween mock nd ADnmt2 trnsfections (P < 0.001; t test); NS indictes no significnt differences etween mock nd /ADnmt2 trnsfections (P > 0.05; t test). Mterils nd Methods Mosquitoes, Insect Cell Lines, nd DENV Infection. Ae. egypti infected with wmelpop-cla strin of Wolchi (Wol+) nd Wolchi-free strin, tetcured line (Wol ), were the stocks s previously descried (7). Adults nd lrve were rered t 25 C with 80% reltive humidity nd 12-h light regimen. Lrve were mintined with fish food pellets (Tetrmin, Tetr) t density of 50 lrve per liter of wter in flt trys; dults were offered 10% (wt/vol) sucrose solution, d liitum. Ae. egypti Ag2 cells nd those infected with Wolchi (denoted s g2.wmelpop-cla) (49) were mintined in medi with 1:1 mixture of Mitsuhsgi-Mrmorosch nd Schneider s insect medi (Invitrogen) supplemented with 10% FS. RNA Extrction, cdna Synthesis, nd PCR. Totl RNA from mosquitoes nd cell lines ws isolted using Tri-Regent (Amion Inc.), nd susequently treted with DNse I efore eing used for reverse trnscription. The first-strnd cdna for ADnmt2 ws synthesized y RT with ADnmt2 gene-specific primers (forwrd: 5 -ATGAGTGCTACCGACGTA-3 ; reverse: 5 -TCACCAGTC- CATCTCATC-3 ). In ech RT rection, 2 μg of totl RNA ws used s templte in totl volume of 20 μl. Amplifiction following cdna synthesis ws crried out in totl rection volume of 25 μl with 2 μl of RT products. The mplifiction ws performed t 94 C for 3 min, followed y 35 cycles of 94 C for 30 s, 56 C for 30 s, 68 C for 1 min, nd finl extension t 68 C for 10 min. The riosoml protein S17 (RPS17) gene ws used for normlizing dt s descried previously (18). Quntittive PCR of Wolchi Density. Totl genomic DNA ws extrcted from cells s descried previously (50). Wolchi density in cells ws determined y qpcr using the wsp gene-specific primers s descried previously (18). qpcr ws performed using Pltinum SYR Green Mix (Invitrogen) with 20 ng of totl genomic DNA in Rotor-Gene therml cycler (Qigen) under the following conditions: 95 C hold for 30 s, then 40 cycles of 95 C for 15 s, 50 C for 15 s, nd 72 C for 20 s, following y the melting curve (68 95 C). For this experiment, three iologicl replictes with three technicl replictes were nlyzed. The RPS17 gene ws used for normliztion of DNA templtes. The Student t test ws used to compre the differences in mens etween different tretments. qrt-pcr. Totl RNA ws extrcted nd reverse trnscried s descried previously using specific reverse primer to DENV (reverse, CCATCCCGTACCAG- CATCCG). Following RT, qpcr with DENV gene-specific primers (forwrd, GTGGTGGTGACTGAGGACTG) ws performed to determine DENV density in cells. This mplified 138-nt frgment from nucleotides 3273 3409 of the DENV genome. Pltinum SYR Green Mix (Invitrogen) ws used for qpcr with 1 μl of RT products s descried previously. For this experiment, three iologicl replictes with three technicl replictes were nlyzed. The RPS17 gene ws used for normliztion of RNA templtes. The Student t test ws used to compre the differences in mens. For tissue-specific nlysis of ADnmt2 trnscript levels, totl RNA ws extrcted from ovries, thorcic muscle tissue, slivry glnds, nd midgut dissected from 4- nd 12-d-old Wol+ nd Wol femle mosquitoes s descried previously. RT-qPCR rections were crried out s descried previously using primers specific to ADnmt2 gene (forwrd, GTAGTATCAGCAATTGA- CATCA; reverse, TGGGGGTGACATGAGAATAAG). Similrly, three iologicl replictes with three technicl replictes were nlyzed for ech tissue nd mosquito type. Ech iologicl replicte consisted of pull of totl RNA extrcted from specific tissues of five mosquitoes. The RPS17 gene ws lso used for normliztion of RNA templtes. Overexpression of ADnmt2 in Insect Cell Lines. The cdna of ADnmt2 gene (Gennk ccession no. XM_001657505) ws synthesized y RT-PCR using genespecific primers with KpnI nd ScII restriction sites (forwrd: 5 -GGTAC- CATGGGGAGTGCTACCGACGTA-3 ; reverse: 5 -CCGCGGCCAGTCCATCTCATC-3 ; restriction sites re underlined). ADnmt2 ws cloned into /V5-His vector contining n insect-specific promoter (Life Technologies). Two microgrms of the produced plsmid with ADnmt2 gene ws trnsfected into Ag2 or g2.wmelpop-cla cell lines using Cellfectin (Life Technologies) s trnsfection regent. Cells trnsfected with the empty /V5-His vector were used s controls. Cells were collected t 72 h fter trnsfection, nd totl RNA ws isolted nd nlyzed y RT-PCR nd/or RT-qPCR with gene-specific primers s required. Inhiition of e-mir-2940 in Wolchi-Infected Cells. e-mir-2940 (5 - GCCUCGACAGAUAAGAUAAACCA-3 ) nd e-mir-2940* (5 -AGUGAUUUAU- CUCCCUGUCGAC-3, s control) inhiitors were synthesized y Genephrm. A ns ns Fig. 7. Effect of inhiition of e-mir-2940 on DENV repliction. g2.wmelpop-cla cells were trnsfected with synthetic e-mir-2940 inhiitor (2940In) nd control inhiitor (Inhiitor-C) 48 h efore infection with DENV. RNA smples were extrcted from cells t (A) 24 h nd () 72 h fter infection nd nlyzed y RT-qPCR using specific primers to DENV. Three iologicl with three technicl replictes were crried out for ech trnsfection. NS, no significnt differences etween Inhiitor-C nd 2940In (P > 0.05; t test). 10280 www.pns.org/cgi/doi/10.1073/pns.1303603110 Zhng et l.
In this experiment, 100 ng of the e-mir-2940 nd e-mir-2940* inhiitors were trnsfected into g2.wmelpop-cla cells using the Cellfectin trnsfection regent. Cells were collected t 72 h fter trnsfections, totl RNA ws extrcted, nd RT-PCR nlyses were performed with ADnmt2 gene specific primers s previously. RNA-Medited Gene Silencing. For RNAi-sed experiments, dsrna ws synthesized in vitro y using the T7 Megscript trnscription kit ccording to the mnufcturer s instructions (Amion Inc.). T7 promoter sequences (TAA- TACGACTCACTATAGGG) were incorported in oth forwrd nd reverse primers designed to mplify 450 p of the Ae. egypti Dicer-1 gene (forwrd: 5 -CCCGGACCAAGTCCTAGTA-3 ; reverse:5 -CAACTCTTTCGGCACGTAA-3 ). Aout 1 μg of the PCR product ws used in 4-h incution t 37 C for dsrna synthesis. After DNse tretment, RNA ws precipitted y lithium chloride. Aout 500 ng of dsrna ws used for trnsfection of Ag2 cells, which were trnsfected gin t 48 h fter the first trnsfection. Cells were collected for RNA isoltion for nlysis 48 h fter the second trnsfection. Gene silencing ws confirmed y RT-qPCR with Dicer-1 specific primers. Prediction of Cellulr Trgets of e-mir-2940. NCI LAST, RNAHyrid, nd RNA22 softwre were used to identify the potentil trgets of e-mir-2940. tlastn ws performed to serch for homologous sequences. The ioedit progrm ws used to lign sequences nd to clculte the identities nd similrities of sequences. ACKNOWLEDGMENTS. We thnk Gungjin Lu from rin Ky s lortory (Queenslnd Institute of Medicl Reserch) for providing mosquito lrvl smples. This work ws supported y Austrlin Reserch Council Discovery Grnt DP110102112 (to S.A.), Austrlin Reserch Council Discovery Erly Creer Resercher Awrd fellowship DE120101512 (to M.H.), nd grnt from the Foundtion of the Ntionl Institutes of Helth through the Grnd Chllenges in Glol Helth inititive of the ill nd Melind Gtes Foundtion (to S.L.O.). 1. WHO (2009) Dengue nd Dengue Hemorrhgic Fever. Fct Sheet No. 117. (World Helth Orgniztion, Genev). 2. Hoffmnn AA, et l. (2011) Successful estlishment of Wolchi in Aedes popultions to suppress dengue trnsmission. Nture 476(7361):454 457. 3. Wlker T, et l. (2011) The wmel Wolchi strin locks dengue nd invdes cged Aedes egypti popultions. Nture 476(7361):450 453. 4. Zug R, Hmmerstein P (2012) Still host of hosts for Wolchi: Anlysis of recent dt suggests tht 40% of terrestril rthropod species re infected. PLoS ONE 7: e38544. 5. Jeyprksh A, Hoy MA (2000) Long PCR improves Wolchi DNA mplifiction: wsp sequences found in 76% of sixty-three rthropod species. Insect Mol iol 9(4): 393 405. 6. Xi ZY, Khoo CCH, Doson SL (2005) Wolchi estlishment nd invsion in n Aedes egypti lortory popultion. Science 310(5746):326 328. 7. McMenimn CJ, et l. (2009) Stle introduction of life-shortening Wolchi infection into the mosquito Aedes egypti. Science 323(5910):141 144. 8. Moreir LA, et l. (2009) Humn proing ehvior of Aedes egypti when infected with life-shortening strin of Wolchi. PLoS Negl Trop Dis 3(12):e568. 9. vn den Hurk AF, et l. (2012) Impct of Wolchi on infection with chikunguny nd yellow fever viruses in the mosquito vector Aedes egypti. PLoS Negl Trop Dis 6(11):e1892. 10. Moreir LA, et l. (2009) A Wolchi symiont in Aedes egypti limits infection with dengue, Chikunguny, nd Plsmodium. Cell 139(7):1268 1278. 11. in G, Xu Y, Lu P, Xie Y, Xi Z (2010) The endosymiotic cterium Wolchi induces resistnce to dengue virus in Aedes egypti. PLoS Pthog 6(4):e1000833. 12. Kmris Z, Cook PE, Phuc HK, Sinkins SP (2009) Immune ctivtion y life-shortening Wolchi nd reduced filril competence in mosquitoes. Science 326(5949): 134 136. 13. Asgri S (2013) MicroRNA functions in insects. Insect iochem Mol iol 43(4):388 397. 14. Griffiths-Jones S, Sini HK, vn Dongen S, Enright AJ (2008) mirse: Tools for microrna genomics. Nucleic Acids Res 36(Dtse issue):d154 D158. 15. Fssi Fehri L, et l. (2010) Helicocter pylori induces mir-155 in T cells in camp- Foxp3-dependent mnner. PLoS ONE 5(3):e9500. 16. Go CP, et l. (2010) Reduced microrna-218 expression is ssocited with high nucler fctor kpp ctivtion in gstric cncer. Cncer 116(1):41 49. 17. Hung JL, et l. (2007) Cellulr micrornas contriute to HIV-1 ltency in resting primry CD4+ T lymphocytes. Nt Med 13(10):1241 1247. 18. Hussin M, Frentiu FD, Moreir LA, O Neill SL, Asgri S (2011) Wolchi uses host micrornas to mnipulte host gene expression nd fcilitte coloniztion of the dengue vector Aedes egypti. Proc Ntl Acd Sci USA 108(22):9250 9255. 19. Lu F, et l. (2008) Epstein-rr virus-induced mir-155 ttenutes NF-kpp signling nd stilizes ltent virus persistence. J Virol 82(21):10436 10443. 20. Tili E, et l. (2007) Modultion of mir-155 nd mir-125 levels following lipopolyscchride/tnf-lph stimultion nd their possile roles in regulting the response to endotoxin shock. J Immunol 179(8):5082 5089. 21. Jopling CL (2008) Regultion of heptitis C virus y microrna-122. iochem Soc Trns 36(Pt 6):1220 1223. 22. Kunert N, Mrhold J, Stnke J, Stch D, Lyko F (2003) A Dnmt2-like protein medites DNA methyltion in Drosophil. Development 130(21):5083 5090. 23. Schefer M, Steringer JP, Lyko F (2008) The Drosophil cytosine-5 methyltrnsferse Dnmt2 is ssocited with the nucler mtrix nd cn ccess DNA during mitosis. PLoS ONE 3(1):e1414. 24. Wilkinson CRM, rtlett R, Nurse P, ird AP (1995) The fission yest gene pmt1+ encodes DNA methyltrnsferse homologue. Nucleic Acids Res 23(2):203 210. 25. Okno M, Xie SP, Li E (1998) Dnmt2 is not required for de novo nd mintennce methyltion of virl DNA in emryonic stem cells. Nucleic Acids Res 26(11):2536 2540. 26. Tweedie S, et l. (1999) Vestiges of DNA methyltion system in Drosophil melnogster? Nt Genet 23(4):389 390. 27. Yoder JA, estor TH (1998) A cndidte mmmlin DNA methyltrnsferse relted to pmt1p of fission yest. Hum Mol Genet 7(2):279 284. 28. Ri K, et l. (2007) Dnmt2 functions in the cytoplsm to promote liver, rin, nd retin development in zerfish. Genes Dev 21(3):261 266. 29. Thomson DW, rcken CP, Goodll GJ (2011) Experimentl strtegies for microrna trget identifiction. Nucleic Acids Res 39(16):6845 6853. 30. Vo NK, Dlton RP, Liu N, Olson EN, Goodmn RH (2010) Affinity purifiction of microrna-133 with the crdic trnscription fctor, Hnd2. Proc Ntl Acd Sci USA 107(45):19231 19236. 31. Wu S, et l. (2010) Multiple micrornas modulte p21cip1/wf1 expression y directly trgeting its 3 untrnslted region. Oncogene 29(15):2302 2308. 32. Ding S-W (2010) RNA-sed ntivirl immunity. Nt Rev Immunol 10(9):632 644. 33. Pn X, et l. (2012) Wolchi induces rective oxygen species (ROS)-dependent ctivtion of the Toll pthwy to control dengue virus in the mosquito Aedes egypti. Proc Ntl Acd Sci USA 109(1):E23 E31. 34. Sin LR, et l. (2009) Ars2 regultes oth mirna- nd sirna-dependent silencing nd suppresses RNA virus infection in Drosophil. Cell 138(2):340 351. 35. Souz-Neto JA, Sim S, Dimopoulos G (2009) An evolutionry conserved function of the JAK-STAT pthwy in nti-dengue defense. Proc Ntl Acd Sci USA 106(42): 17841 17846. 36. Xi Z, Gvotte L, Xie Y, Doson SL (2008) Genome-wide nlysis of the interction etween the endosymiotic cterium Wolchi nd its Drosophil host. MC Genomics 9:1. 37. Glser RL, Meol MA (2010) The ntive Wolchi endosymionts of Drosophil melnogster nd Culex quinquefscitus increse host resistnce to West Nile virus infection. PLoS ONE 5(8):e11977. 38. Hedges LM, rownlie JC, O Neill SL, Johnson KN (2008) Wolchi nd virus protection in insects. Science 322(5902):702. 39. Teixeir L, Ferreir A, Ashurner M (2008) The cteril symiont Wolchi induces resistnce to RNA virl infections in Drosophil melnogster. PLoS iol 6(12):e2. 40. Dostert C, et l. (2005) The Jk-STAT signling pthwy is required ut not sufficient for the ntivirl response of drosophil. Nt Immunol 6(9):946 953. 41. Tnji T, Hu XD, Weer ANR, Ip YT (2007) Toll nd IMD pthwys synergisticlly ctivte n innte immune response in Drosophil melnogster. Mol Cell iol 27(12): 4578 4588. 42. Zmon RA, Nndkumr M, Vkhri VN, Wu LP (2005) The Toll pthwy is importnt for n ntivirl response in Drosophil. Proc Ntl Acd Sci USA 102(20): 7257 7262. 43. lgrove MSC, Aris-Goet C, Filloux A-, Sinkins SP (2012) Wolchi strin wmel induces cytoplsmic incomptiility nd locks dengue trnsmission in Aedes lopictus. Proc Ntl Acd Sci USA 109(1):255 260. 44. Hughes GL, Kog R, Xue P, Fuktsu T, Rsgon JL (2011) Wolchi infections re virulent nd inhiit the humn mlri prsite Plsmodium flciprum in Anopheles gmie. PLoS Pthog 7(5):e1002043. 45. Duursm AM, Kedde M, Schrier M, le Sge C, Agmi R (2008) mir-148 trgets humn DNMT3 protein coding region. RNA 14(5):872 877. 46. rconi C, Hung N, Ptel T (2010) MicroRNA-dependent regultion of DNA methyltrnsferse-1 nd tumor suppressor gene expression y interleukin-6 in humn mlignnt cholngiocytes. Heptology 51(3):881 890. 47. Pn W, et l. (2010) MicroRNA-21 nd microrna-148 contriute to DNA hypomethyltion in lupus CD4+ T cells y directly nd indirectly trgeting DNA methyltrnsferse 1. J Immunol 184(12):6773 6781. 48. Ye YH, et l. (2013) Infection with virulent strin of Wolchi disrupts genome wide-ptterns of cytosine methyltion in the mosquito Aedes egypti. PLoS ONE, 10.1371/journl.pone.0066482. 49. Frentiu FD, Roinson J, Young PR, McGrw EA, O Neill SL (2010) Wolchi-medited resistnce to dengue virus infection nd deth t the cellulr level. PLoS ONE 5(10): e13398. 50. Gltz R, et l. (2004) Lectin-induced hemocyte inctivtion in insects. J Insect Physiol 50(10):955 963. MICROIOLOGY Zhng et l. PNAS June 18, 2013 vol. 110 no. 25 10281