Quantitative relationship of two viruses (MrNV and XSV) in white-tail disease of Macrobrachium rosenbergii

Transcription

1 DISEASES OF AQUATIC ORGANISMS Vol. 71: 11 17, 26 Pulished July 11 Dis Aqut Org Quntittive reltionship of two viruses (MrNV nd XSV) in white-til disese of Mcrorchium rosenergii Hujun Zhng 1, Jinmin Wng 1, Junf Yun 1, Lijun Li 1, Jinhong Zhng 1, Jen-Roert Bonmi 2, Zhengli Shi 1, * 1 Stte Key Lortory of Virology, Wuhn Institute of Virology, Chinese Acdemy of Sciences, 4371 Wuhn, Chin 2 Pthogens nd Immunity, UMR5119, ECOLAG, CNRS/UM2, Université Montpellier 2, Montpellier, Frnce ABSTRACT: Mcrorchium rosenergii nodvirus (MrNV) nd extr smll virus (XSV) were purified from disesed freshwter prwns M. rosenergii nd used to infect helthy post-lrve (PL) y n immersion method. Three groups of prwns were chllenged with vrious comined doses of MrNV nd XSV. Signs of white-til disese (WTD) were oserved in Groups 1 nd 2, which hd een chllenged with comintions contining reltively high proportions of MrNV nd low proportions of XSV. By contrst there ws little sign of WTD in Group 3, which hd een chllenged with higher proportion of XSV thn MrNV. A 2-step Tqmn rel-time RT-PCR ws developed nd pplied to quntify virl copy numers in ech chllenged PL. Results showed tht genomic copies of oth viruses were much higher in Groups 1 nd 2 thn they were in Group 3, indicting tht MrNV plys key role in WTD of M. rosenergii. The liner correltion etween MrNV nd XSV genome copies in infected prwns demonstrted tht XSV is stellite virus, dependent on MrNV, ut its role in pthogenicity of WTD remins uncler. KEY WORDS: Mcrorchium rosenergii Nodvirus Extr smll virus Rel-time RT-PCR White-til disese Resle or repuliction not permitted without written consent of the pulisher INTRODUCTION The gint freshwter prwn Mcrorchium rosenergii de Mn is one of the most economiclly importnt crustcens in freshwter quculture in Chin, ut it is lso cultured widely in res of the Crien nd in other Asin countries. Since 199, white-til disese (WTD) hs een prevlent in the min culture res such s Thilnd, Gudeloupe, the Antilles, Chin nd Indi (Nsh et l. 1987, Anderson et l. 199, Arcier et l. 1999, Tung et l. 1999, Qin et l. 22, Shul Hmeed et l. 24). Two kinds of virl prticles hve een isolted from WTD prwns; one is nodvirus (M. rosenergii nodvirus or MrNV) nd the other smller virus ssocited with MrNV (clled extr smll virus or XSV) (Qin et l. 23, Shi et l. 24). Both viruses hve een well chrcterized. MrNV is 26 to 27 nm in dimeter, icoshedrl nd nonenveloped with genome consisting of 2 liner ssrna frgments (3 nd 1.2 k). XSV is 15 nm in dimeter, icoshedrl nd non-enveloped, nd possesses liner ssrna genome of.9 k encoding 2 overlpping structurl proteins of 16 nd 17 kd (Shi et l. 24, Sri Widd & Bonmi 24, Bonmi et l. 25). Vrious methods hve een developed to detect MrNV nd XSV. A sndwich enzyme-linked immunosorent ssy (S-ELISA) nd 3 complementry genome-sed methods, i.e. dot-lot hyridiztion, in situ hyridiztion nd reverse trnscriptsepolymerse chin rection (RT-PCR), re ville for the detection of MrNV (Romestnd & Bonmi 23, Sri Widd et l. 23). Dot-lot hyridiztion *Corresponding uthor. Emil: zlshi@wh.iov.cn Inter-Reserch 26

2 12 Dis Aqut Org 71: 11 17, 26 nd RT-PCR were lso developed to detect XSV (Sri Widd et l. 24). More recently, Yognndhn et l. (25) estlished 1-step multiplex RT-PCR to detect MrNV nd XSV simultneously. These methods hve fcilitted the dignosis of WTD. Due to the smll size nd sence of n RNA-dependent RNA polymerse (RdRp) gene in the XSV genome, it ws elieved tht XSV is stellite virus (Sri Widd & Bonmi 24). In our previous studies, MrNV nd XSV were lwys found co-locted in the connective tissues of disesed prwns (Qin et l. 23, Shi et l. 24). Experimentl infection with mixture of the 2 viruses demonstrted tht WTD in Mcrorchium rosenergii could e ttriuted to one or oth of them. Without purifiction nd seprtion of MrNV nd XSV, the role nd reltionship of these 2 viruses in WTD of M. rosenergii remins uncertin. In this study, MrNV nd XSV were purified nd seprted from disesed Mcrorchium rosenergii nd used to infect helthy post-lrve (PL). Rel-time RT- PCR ws developed nd used to quntify copy numers of the 2 viruses in chllenged PL nd investigte their role nd reltionship in WTD. MATERIALS AND METHODS Post-lrve. Five-d-old helthy Mcrorchium rosenergii PL, with no history of WTD, were purchsed from htchery in Wuhn (Huei Province, Chin). The PL were rered in cm disinfected tnks nd fed powdered eggs 3 times dy. Excret nd food remins were removed dily. Wter temperture ws controlled t 25 to 27 C, nd the tnks were gently erted. Two-thirds of the freshwter ws exchnged ech dy. MrNV nd XSV purifiction. Infected PL were collected from htchery in Zhejing Province (Chin) nd stored t 7 C. Purifiction ws performed s descried previously (Bonmi et l. 25). Briefly, the PL were homogenized in PBS uffer (ph 7.4) nd clrified t 1 g for 25 min. The resultnt superntnt ws centrifuged t 16 g for 4 h t 4 C. The pellets were resuspended in PBS, followed y extrction 2 to 3 times with Freon (1,1, 2-trichloro- 2, 2,1trifluoroethne). Then, the queous lyer ws centrifuged t 16 g for 4 h. The 2 viruses were seprted with 15 to 3% (w/v in PBS) sucrose grdient, followed y CsCl grdient. The viruses were quntified y rel-time RT-PCR s indicted elow. The purified virions were stored t 7 C. Experimentl infections. The 5-d-old PL were rered for 3 d nd strved for 1 d efore chllenge. RT- PCR with MrNV- nd XSV-specific primers ws performed to confirm the helth of the PL. Three groups of helthy PL were chllenged with different comintions of the 2 purified viruses Group 1: MrNV nd XSV ml 1 (i.e. MrNV:XSV = 36:1); Group 2: MrNV nd XSV ml 1 (i.e. MrNV:XSV = 8:1); Group 3: MrNV nd XSV ml 1 (i.e. MrNV:XSV = 1:83). A control group ws treted with PBS only. The PL (81 for ech group) were immersed in virus suspension or PBS solution for 15 min nd then trnsferred to freshwter tnks. The leftover virus suspensions were mixed with the powdered eggs used to feed the PL over the following 3 d. Clinicl signs were monitored dily. PL exhiiting white muscle were recorded nd trnsferred to seprte tnk. Seven PL were smpled from ech group on Dy 8 post-immersion (p.i.), nd the reminder were hrvested on Dy 24 p.i. for storge t 7 C. RNA extrction. Totl RNA ws extrcted from whole PL with TRIzol regent (Invitrogen) ccording to the mnufcturer s protocol. The finl RNA ws resuspended in 4 to 5 µl DEPC wter nd stored t 7 C. For RNA extrction from virl prticles, virus suspensions were digested with 2 µg ml 1 Proteinse K in 1 mm Tris-HCl, 1 mm EDTA (ph 8.) nd.5% SDS t 37 C for 1 h. RNA ws extrcted successively with phenol, phenol/chloroform/isomyl lcohol (25:24:1, v/v/v) nd chloroform/isomyl lcohol (24:1, v/v), nd then precipitted with 2.5 vol of solute ethnol fter ddition of.3 M sodium cette (finl concentrtion) t 2 C for 2 h, followed y wshing with 75% ethnol nd dissolving s ove. Primers nd proes. The primers nd proes (Tle 1) for MrNV nd XSV detection were designed using Primer Express softwre (Version 2., Applied Biosystems) nd trgeted the MrNV RNA1 nd XSV sequences, respectively (GenBnk Nos. AY nd DQ174318). Tqmn proes were leled with the fluorescent reporter dye 6-croxy-fluorescein (FAM) nd the quencher 6-croxy-N,N,N,N-tetr-methylrhodmine (TAMARA) t the 5 - nd 3 -ends, respectively. The primers for 18S rrna were designed from Mcrorchium rosenergii 18S rrna (AY461599). The mplicon sizes for MrNV RNA1, XSV nd 18S rrna were 75, 69 nd 213 p, respectively. Preprtion of quntittive stndrds. The mplicons of MrNV RNA1 nd XSV were cloned into pgem-t esy vector (Promeg). The plsmid DNA ws extrcted with plsmid miniprep kit (Omeg Bio-Tek). The mplicon of 18S rrna y RT-PCR ws purified using n EZNA gel extrction kit (Omeg Bio- Tek). Copy numers were clculted ccording to DNA concentrtions using Lmd 25 UV/VIS spectrometer (Perkin-Elmer). The DNA stocking solutions were liquoted nd stored t 2 C. One liquot ws serilly diluted 1-fold nd used in rel-time PCR with

3 Zhng et l.: White-til disese of Mcrorchium rosenergii 13 Tle 1. Primers (FP: forwrd; RP: reverse) nd proes used in rel-time RT-PCR (MrNV: Mcrorchium rosenergii nodvirus; XSV: extr smll virus). Tm: nneling temperture Trget gene Primer nd proe Sequence (5 3 ) Tm Amplicon (p) MrNV RNA1 FP CAACTCGGTATGGAACTCAAGGT RP AGGAAATACACGAGCAAGAAAAGTC 58 Proe ACCCTTCGACCCCAGCAATGGTG 69 XSV FP AGCCACACTCTCGCATCTGA RP CTCCAGCAAAGTGCGATACG 58 Proe CATGCCCCATGATCCTCGCA 68 18S rrna FP CGCACCGGCTCCGTATCTTT RP GTCCCGCATTGTTATTTTTCGTCA 57 Threshold cycle (C T ) MrNV RNA1 XSV 18S rrna RNA1: y = x R 2 =.9975 XSV: y = x R 2 = S: y = x R 2 = Log of copies/rection Fig. 1. Stndrd curves for MrNV RNA1, XSV nd 18S rrna rel-time PCR ssys either Tqmn proe (MrNV RNA1 nd XSV) or SYBR Green I dye (18S rrna). Two-step rel-time RT-PCR. Reverse trnscription ws performed in 1 µl volume. An liquot of 3 µl RNA with 1 pmol reverse primer nd 2.8 µl of diethylpyrocronte-treted H 2 O were first dentured t 7 C for 1 min, then immeditely quenched on ice nd susequently dded to the RT mixture consisting of.6 mm ech of the 4-deoxynucleoside triphosphtes, 8 U RNsin (BioStr) nd 8 U M-MLV reverse trnscriptse (Promeg). The reverse trnscription rection ws conducted t 42 C for 6 min, followed y heting to 7 C for 5 min nd holding t 4 C. Rel-time PCR ssys for MrNV nd XSV with Tqmn proes were conducted in DNAEngine OPTI- CON mchine (MJ). The finl PCR mixture (25 µl) contined.4 µm ech of forwrd nd reverse primers, 8 nm Tqmn proe,.5 U of Tq polymerse (BioStr) nd 5 µl cdna. The therml cycling conditions were: 94 C for 5 min, then 5 cycles of 94 C for 3 s nd 58 C for 3 s. Fluorescence ws mesured fter ech cycle. In the rel-time PCR ssy with SYBR Green I dye (OPE Tech) to quntify 18S rrna, the mplifiction profile ws 94 C for 5 min, followed y 4 cycles of 94 C for 3 s, 57 C for 3 s, 72 C for 3 s nd 84 C for 5 s for plte reding to collect fluorescence dt. A melting curve from 16 to 94 C ws generted fter the lst extension step t 72 C for 1 min. Sttisticl nlysis. The coefficient of vrition of the rel-time RT-PCR ssys nd stndrd error of the men were clculted using Microsoft Excel 2 nd SPSS Version 1., respectively. Significnt differences were determined using n independent-smples t-test, nd correltion nlysis ws crried out using ivrite correltion test with SPSS softwre. RESULTS Sensitivity nd reproduciility of rel-time PCR ssys To ssess the dynmic rnge of the rel-time PCR ssys, DNA plsmids, or mplicons, frgments were serilly diluted 1-fold nd tested 3 times in triplicte. Stndrd curves were constructed y plotting the logrithm of copy numer ginst mesured C T (threshold cycle) vlues (Fig. 1). The curves covered liner rnge of 5 to , 45.8 to nd to copies per rection (25 µl) for MrNV, XSV nd 18S rrna, respectively. The liner correltions (R 2 ) etween the C T nd the log of the copy numer were.997,.998 nd.999 for the 3 curves, respectively. Reproduciility of the methods ws evluted y intr- nd inter-ssy vrition. Ech point for the seril 1-fold dilutions represented triplicte smples for 3 independent runs. The results re summrized in Tle 2. In fct, Tqmn proe rel-time PCR could detect <1 copies per rection, ut the coefficient of vrition exceeded 5% (dt not shown).

4 14 Dis Aqut Org 71: 11 17, 26 Tle 2. Evlution of reproduciility of quntittive rel-time PCR ssys. C T vlues were determined from 9 replictes; intrssy coefficients of vrition (CV) were determined from 3 replictes of ech dilution; inter-ssy CVs were determined from 3 independent ssys performed on different dys (revitions for trget genes, see Tle 1) Copy numer Men C T vlue Intr-ssy CV (%) Inter-ssy CV (%) RNA1 XSV 18S RNA1 XSV 18S RNA1 XSV 18S RNA1 XSV 18S MrNV, XSV purifiction nd quntifiction By sequentil sucrose grdient nd CsCl isopycnic centrifugtion, electron microscopy reveled tht MrNV nd XSV from the WTD-infected PL were well seprted (Fig. 2). However, quntifiction y Tqmn rel-time RT-PCR showed tht the MrNV frction ( copies µl 1 ) still contined copies µl 1 of XSV (i.e. out 35 times more MrNV thn XSV), while the XSV frction ( copies µl 1 ) contined copies µl 1 of MrNV (1 single MrNV prticle for out 83 XSV prticles). The cumultive percentges of white-til prwns on Dy 24 p.i. were >6 nd 4%, respectively, for Groups 1 nd 2 (Fig. 3). By contrst, mny fewer PL showing gross signs of WTD were seen in Group 3 contining PL given comined virl doses in which XSV dominted. Only 2 suspicious prwns whose dominl muscles were slightly white nd semi-trnsprent were oserved on Dy 11 p.i. In ddition, the verge weight of non-white-til nd white-til prwns in Group 2 decresed y 8 nd 22%, respectively, compred with the control group t Dy 24 p.i. (dt not shown). Experimentl infection nd gross signs of disese At Dy 6 p.i., white spots were oserved on the telson of PL in Groups 1 nd 2, the groups tht were given comined virl doses in which MrNV dominted. The spots then spred to the whole dominl musculture. White-til prwns showed decresed ctivity. Quntifiction nd sttisticl nlysis of MrNV nd XSV Rel-time RT-PCR quntifiction of MrNV nd XSV genomic copies in infected tissue (Fig. 4) reveled no significnt difference for MrNV copies etween Groups 1 nd 2 on Dys 8 nd 24 p.i. (p >.5). How- Fig. 2. Purified virl prticles y trnsmission electron microscopy (TEM). There re some XSV (lck rrows) remining in the MrNV-contining frction (, scle r: 2 nm) nd MrNV (white rrows) remining in the XSV-contining frction (, scle r: 1 nm)

5 Zhng et l.: White-til disese of Mcrorchium rosenergii 15 Cumultive percentge of WTD /(%) lg(mrnv)/μl lg(xsv)/μl Group 1 Group 2 Group 3 Control Dys post infection Fig. 3. Mcrorchium rosenergii. Curve of cumultive count of post-lrve showing signs of white-til disese (WTD) t vrious times during the postimmersion chllenge. Virus inocul in the 3 groups re indicted in the tle, while the control group ws immersed in phosphte-uffered sline (n = 81) Men log of copy numer Group 1 mens Group 2 mens Group 3 mens MrNV8 XSV8 MrNV24 XSV24 18S8 18S24 Virus nd dy Fig. 4. Men copy numers of MrNV, XSV nd 18S rrna t 8 nd 24 d post-immersion chllenge with MrNV nd XSV (n = 7). Brs in the sme group with the sme letters represent mens tht re not significntly different (p >.5) ever, MrNV copies in Group 3 were significntly lower thn they were in Groups 1 nd 2 (p <.5) on Dys 8 nd 24 p.i. This corresponded with the fct tht Group 3 showed few gross signs of WTD. In the cse of XSV, the copy numers in 3 groups did not show significnt differences on Dy 8 p.i. (p >.5), while on Dy 24 p.i., the copies in Group 1 were significntly higher thn those in Group 3 (p <.5). However, the overll XSV copy numers were up to 2 logs or more higher thn those of MrNV on oth dys. In the control group, few smples gve C T vlues ove ckground nd round 35. These vlues were distinctly higher thn those from infected groups (C T = 15 to 26) nd were considered to result from non-specific mplifiction (dt not shown). When looking t MrNV nd XSV copies of individul PL, it seemed tht PL showing white tils hd reltively higher virl copies thn those without white tils (dt not shown). Therefore, on Dy 24 p.i., PL in Group 2 tht showed gross signs of WTD (n = 19) were compred to those (n = 19) from the sme group tht did not (Fig. 5). It ws found tht the men log of MrNV copies in non-white-til prwns ( ) ws 1 times less thn tht in white-til prwns ( ) (p <.5). Accordingly, XSV genomic copies in non-white-til prwns ( ) nd white-til prwns ( ) differed out 14- fold (p <.5). At the sme time, the trnscription of host 18S rrna of the white-til group ( ) ws lso significntly higher thn tht of the non-white-til group ( ) (p <.5), suggesting tht virl repliction could slightly interfere with trnscription of host genes. This ws in greement with results from studies on pnicum mosic virus nd its stellite virus infection in which there is consistently sustined slight reduction of host rrna expression (Scholthof 1999). A sctter chrt constructed y plotting the log of XSV genomic copies ginst the log of MrNV genomic copies, divided y the respective 18S rrna copies of ech tested individul (n = 8) (Fig. 6), resulted in liner plot with positive Person correltion coefficient of.729 clculted y SPSS softwre (p <.1). Men log of copy numer non-white-til mens white-til mens MrNV XSV Virus nd 18S rrna 18S Fig. 5. Men copy numers of MrNV, XSV nd 18S rrna in shrimps with nd without gross signs of white-til disese (n = 19). Brs in the sme group with different letters re significntly different (p <.5)

6 16 Dis Aqut Org 71: 11 17, 26 Log(XSV/18S) y =.6626x R 2 = Log(MrNV/18S) Fig. 6. Correltion etween MrNV nd XSV copy numers (n = 8); x- nd y-xes re the logrithms of MrNV/18S rrna nd XSV/18S rrna, respectively DISCUSSION The rel-time RT-PCR we developed to quntify genomic copies of MrNV nd XSV could detect <1 copies of virus per rection (25 µl) nd ws much more sensitive thn conventionl RT-PCR (Sri Widd et l. 24). There ws strong liner reltionship (R 2 >.99) over wide dynmic rnge, from 1 1 to 1 8 copies per rection. The quntifiction of host 18S rrna y rel-time RT-PCR with SYBR Green I dye lso gve strong liner reltionship, ut with reltively higher CV vlue (>3%). Our TEM results showed tht MrNV nd XSV could not e completely seprted with sucrose nd CsCl grdient centrifugtion, so tht it ws not possile to use pure preprtions of ech virus in the chllenge tests. Despite this limittion, we were le to show, y rel-time RT-PCR, tht genomic copies of oth viruses were similr in Groups 1 nd 2 nd significntly higher thn they were in Group 3. Compring the infection dose of the 2 viruses in the 3 groups, we concluded tht the higher the infection dose of MrNV, the higher the yield of oth MrNV nd XSV. In ddition, gross signs of WTD were seen with high MrNV numers. This result ws further supported y strong positive liner correltion etween these 2 viruses in infected prwns. These results support the contention tht MrNV plys key role in WTD nd tht XSV is stellite virus dependent on MrNV. Men MrNV nd XSV genomic copies per nonwhite-til prwns ( nd , respectively) nd white-til prwns ( nd , respectively) differed significntly (p <.5) y 1 or more times. Our comprison of virl copy numers in nonwhite-til prwns nd white-til prwns from Group 2 reveled tht the non-white-til prwns hd suclinicl infections despite the reltively high virl lods, especilly for XSV. This result is in greement with the work of Shul Hmeed et l. (24). In their study, the 2 viruses filed to cuse clinicl signs or mortlity when injected into dult prwns, lthough oth were detected in mny orgns, except eyestlks nd the heptopncres, y conventionl RT-PCR. Such prwns showing no gross signs of disese could ct s crriers of the virus nd e responsile for virus trnsmission. In most cses, the XSV copy numers were much higher thn those of MrNV, indicting n efficient repliction of XSV. This lrge difference in virl lods of XSV nd MrNV my led to misinterprettion of conventionl RT-PCR detection results. In recent report, Yognndhn et l. (25) found tht some prwns were MrNV negtive, ut XSV positive y conventionl RT-PCR. We detected MrNV in Group 1 prwns on Dy 24 p.i. y multiplex RT-PCR test estlished in our lortory (uthors unpul. dt), ut when genomic copies were <1 4, MrNV could not e detected y conventionl RT-PCR (dt not shown). To dte, 4 plnt stellite viruses, stellite tocco necrosis virus (STNV), stellite mize white line mosic virus (SMWLMV), stellite tocco mosic virus (STMV) nd stellite pnicum mosic virus (SPMV) nd n niml stellite virus (the chronic eeprlysis virus-ssocited stellite) hve een recognized y the ICTV ( Ictv/fr-fst-g.htm). The function of some plnt stellite viruses hs een well nlyzed y trnsgenetic techniques. The SPMV cpsid protein cts s pthogenicity fctor in oth host nd non-host plnts nd interferes with suppression of gene silencing (Qiu & Scholthof 24). STNV ws reported to suppress its helper virus repliction nd meliorte the symptoms induced y the helper virus in different hosts (Jones & Reichmnn 1973, Kssnis 1981, Rodriguez-Alvrdo et l. 1994). However, the presence of STMV did not modify (Vlverde & Dodds 1986, Vlverde et l. 1991) or enhnce the symptoms (Rodriguez-Alvrdo et l. 1994) in different hosts. Although we hve shown tht MrNV is importnt in WTD outreks in prwns, the role of XSV in pthogenicity is still uncler nd further work is needed to determine whether it plys ny role. Acknowledgements. This work ws supported y the Ntionl Nturl Science Foundtion of Chin (Grnt No ). LITERATURE CITED Anderson IG, Lw AT, Shriff M, Nsh G (199) A prvo-like virus in the gint freshwter prwn, Mcrorchium rosenergii. J Inverter Pthol 55: Arcier JM, Hermn F, Lightner DV, Redmn RM, Mri J, Bonmi JR (1999) A virl disese ssocited with mortlities in htchery-rered postlrve of the gint fresh-

7 Zhng et l.: White-til disese of Mcrorchium rosenergii 17 wter prwn Mcrorchium rosenergii. Dis Aqut Org 38: Bonmi JR, Shi Z, Qin D, Sri Widd J (25) White til disese of the gint freshwter prwn, Mcrorchium rosenergii: seprtion of the ssocited virions nd chrcteriztion of MrNV s new type of nodvirus. J Fish Dis 28:23 31 Jones IM, Reichmnn ME (1973) The proteins synthesized in tocco leves infected with tocco necrosis virus nd stellite tocco necrosis virus. Virology 52:49 56 Kssnis B (1981) Portrits of viruses: tocco necrosis virus nd its stellite virus. Intervirology 15:57 7 Nsh G, Chinut S, Limsuwn C (1987) Idopthic muscle necrosis in the freshwter prwn, Mcrorchium rosenergii de Mn, cultured in Thilnd. J Fish Dis 1:19 12 Qin D, Yng G, Liu W, Wng J, Co Z (22) Preliminry studies on the whitish muscle diseses of Mcrorchium rosenergii post-lrve. Act Hydroiol Sin 26: Qin D, Shi Z, Zhng S, Co Z nd 5 others (23) Extr smll virus-like prticles (XSV) nd nodvirus ssocited with whitish muscle disese in the gint freshwter prwn, Mcrorchium rosenergii. J Fish Dis 26: Qiu W, Scholthof KB (24) Stellite pnicum mosic virus cpsid protein elicits symptoms on nonhost plnt nd interferes with suppressor of virus-induced gene silencing. Mol Plnt-Microe Interct 17: Rodriguez-Alvrdo G, Kurth G, Dodds JA (1994) Symptom modifiction y stellite tcco mosic virus in pepper types nd cultivrs infected with helper tomoviruses. Phytopthology 84: Romestnd B, Bonmi JR (23) A sndwich enzyme-linked immunosorent ssy (S-ELISA) for dectection of MrNV in the gint freshwter prwn, Mcrorchium rosenergii. J Fish Dis 26:71 75 Shul Hmeed AS, Yognndhn K, Sri Widd J, Bonmi JR (24) Experimentl trnsmission nd tissue tropism of Mcrorchium rosenergii nodvirus (MrNV) nd its ssocited extr smll virus (XSV). Dis Aqut Org 62: Scholthof KBG (1999) A synergism induced y stellite pnicum mosic virus. Mol Plnt-Microe Interct 12: Shi Z, Qin D, Zhng J, Co Z, Bonmi JR (24) Isoltion, purifiction nd nucleic cid chrcteriztion of two virl prticles from freshwter prwn Mcrorchium rosenergii. Chin J Virol 2:58 61 Sri Widd J, Bonmi JR (24) Chrcteristics of the monocistronic genome of extr smll virus, virus-like prticle ssocited with Mcrorchium rosenergii nodvirus: possile cndidte for new species of stellite virus. J Gen Virol 85: Sri Widd J, Durnd S, Cmournc I, Qin D, Shi Z, Dejonghe E, Richrd V, Bonmi JR (23) Genome-sed detection methods of Mcrorchium rosenergii nodvirus, pthogen of the gint freshwter prwn, Mcrorchium rosenergii, dot-lot, in situ hyridiztion nd RT-PCR. J Fish Dis 26: Sri Widd J, Richrd V, Shi Z, Qin D, Bonmi JR (24) Dotlot hyridiztion nd RT-PCR detection of extr smll virus (XSV) ssocited with white til disese of prwn Mcrorchium rosenergii. Dis Aqut Org 58:83 87 Tung CW, Wng CS, Chen SN (1999) Histologicl nd electron microscopic study on Mcrorchium muscle virus (MMV) infection in the gint freshwter prwn, Mcrorchium rosenergii (de Mn), cultured in Tiwn. J Fish Dis 22: Vlverde RA, Dodds JA (1986) Evidence for stellite RNA ssocited nturlly with the U5 strin nd experimentlly with the U1 strin of tocco mosic virus. J Gen Virol 67: Vlverde RA, Heick JA, Dodds JA (1991) Interctions etween stellite tocco mosic virus, helper tomoviruses, nd their hosts. Phytopthology 81:99 14 Yognndhn K, Sri Widd J, Bonmi JR, Shul Hmeed AS (25) Simultneous detection of Mcrorchium rosenergii nodvirus nd extr smll virus y single tue, one-step multiplex RT-PCR ssy. J Fish Dis 28:65 69 Editoril responsiility: Timothy W. Flegel, Bngkok, Thilnd Sumitted: Septemer 15, 25; Accepted: Ferury 22, 26 Proofs received from uthor(s): June 19, 26