Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide

For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. TO THE FULLEST EXTENT ALLOWED BY LAW, IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING BUT NOT LIMITED TO THE USE THEREOF, WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. NOTICE TO PURCHASER: LIMITED LICENSE A license to perform the patented 5' Nuclease Process for research is obtained by the purchase of (i) both Licensed Probe and Authorized 5' Nuclease Core Kit, (ii) a Licensed 5 Nuclease Kit, or (iii) license rights from Applied Biosystems. The TaqMan SNP Genotyping Assays and TaqMan Gene Expression Assays contain Licensed Probe. Use of this product is covered by US patent claims and patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research. The right to use this product in the 5 Nuclease Process under the applicable claims of US patent claims and corresponding patent claims outside the United States, can be obtained through purchase of an Authorized 5' Nuclease Core Kit. Except under separate license rights available from Applied Biosystems, no right under any other patent claim, or to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, or to sublicense, repackage with other products, or resell in any form, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained from the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA. TRADEMARKS Trademarks of Life Technologies Corporation and its affiliates include: Applied Biosystems, AB Logo, FAM, Life Technologies (Stylized), SNPBrowser, and VIC. TaqMan is a trademark of Roche Molecular Systems, Inc. BLAST is a trademark of the National Library of Medicine. Windows is a registered trademark of the Microsoft Corporation in the US and other countries. All other trademarks are the sole property of their respective owners. 2010 Life Technologies Corporation. All rights reserved. Part Number 4367671 Rev. F 07/2010

Contents About This Guide........................................... 5 Purpose........................................................................ 5 Prerequisites................................................................... 5 Safety information............................................................... 5 PROTOCOL Custom TaqMan Assays.................................... 7 Product information............................................................. 7 Section 1 Custom TaqMan SNP Genotyping Assays....................... 11 Design Custom TaqMan SNP Genotyping Assays.................................. 12 Order Custom TaqMan SNP Genotyping Assays................................... 16 Section 2 Custom TaqMan Gene Expression Assays...................... 25 Design Custom TaqMan Gene Expression Assays.................................. 26 Order Custom TaqMan Gene Expression Assays................................... 27 Section 3 Reorder Custom TaqMan Assays.............................. 41 Reorder online................................................................. 42 Reorder legacy assays.......................................................... 44 APPENDIX A Order Other TaqMan Assays............................... 47 Section A.1 Order Other TaqMan SNP Genotyping Assays................. 49 Enter custom primer/probe pairs................................................. 49 Search for Pre-designed TaqMan SNP Genotyping Assays.......................... 52 Section A.2 Order Other TaqMan Gene Expression Assays................. 53 Enter custom primer/probe pairs................................................. 53 Search for Pre-designed TaqMan Gene Expression Assays.......................... 56 APPENDIX B Bioinformatics Tools for Evaluating Target Sequences........ 57 Verify sequence uniqueness with a BLAST database search.......................... 58 Find exon-exon boundaries (gene expression assays only)........................... 63 Find exon information using the Vertebrate Genome Annotation Database............. 66 Mask sequence repeats......................................................... 69 Detect and mask nontarget sequence polymorphisms............................... 73 Custom TaqMan Assays Design and Ordering Guide 3

Contents APPENDIX C Using File Builder Software................................ 75 Overview...................................................................... 75 Create the submission file....................................................... 76 Validate the format............................................................. 77 Send the sequence information to Applied Biosystems.............................. 80 APPENDIX D Troubleshooting........................................... 83 Assay failed design............................................................. 83 Assay failed manufacturing...................................................... 84 Documentation and Support................................ 87 Related documentation......................................................... 87 Obtaining support.............................................................. 87 4 Custom TaqMan Assays Design and Ordering Guide

About This Guide Purpose The Custom TaqMan Assays Design and Ordering Guide provides reference information for ordering Custom TaqMan Assays using the Custom TaqMan Assay Design Tool on the Applied Biosystems web site. Prerequisites This guide is intended for scientists and technicians who want to order Custom TaqMan SNP Genotyping Assays, Custom TaqMan Gene Expression Assays, and Custom Plus TaqMan RNA Assays from the Applied Biosystems website. It uses conventions and terminology that assume a working knowledge of molecular biology, PCR, TaqMan Assays, the internet, and internet-based browsers. Safety information Safety alert words Four safety alert words appear in Applied Biosystems user documentation at points in the document where you need to be aware of relevant hazards. Each alert word IMPORTANT, CAUTION, WARNING, DANGER implies a particular level of observation or action, as defined below: IMPORTANT! Indicates information that is necessary for proper instrument operation, accurate chemistry kit use, or safe use of a chemical. CAUTION! Indicates a potentially hazardous situation that, if not avoided, may result in minor or moderate injury. It may also be used to alert against unsafe practices. WARNING! Indicates a potentially hazardous situation that, if not avoided, could result in death or serious injury. DANGER! Indicates an imminently hazardous situation that, if not avoided, will result in death or serious injury. This signal word is to be limited to the most extreme situations. Custom TaqMan Assays Design and Ordering Guide 5

About This Guide Safety information 6 Custom TaqMan Assays Design and Ordering Guide

DESIGN AND ORDERING GUIDE Custom TaqMan Assays Product information About the design pipeline Applied Biosystems designs, synthesizes, and delivers analytically quality-controlled Custom TaqMan Assays sets based on sequence information that you supply. All information that you supply is secure and confidential. Use the Custom TaqMan Assays Design Tool to order: Custom TaqMan SNP Genotyping Assays Custom assays for performing genotyping studies with single-nucleotide polymorphisms (SNPs), multiple nucleotide polymorphisms (MNPs), or insertions/deletions (in/dels). Custom TaqMan Gene Expression Assays Custom assays for quantitative gene expression analysis and DNA sequence detection. Custom Plus TaqMan RNA Assays Custom assays, for quantitative analysis of coding and non-coding transcripts, that are designed using the bioinformatics feature of the Custom TaqMan Assays Design Pipeline. For Custom Plus Taqman RNA Assays, the design pipeline performs bioinformatic analysis and quality control of the input sequences to ensure the best possible assay designs. IMPORTANT! Applied Biosystems does not provide the assay sequences for Custom Plus TaqMan RNA Assays. Custom TaqMan Assays Design and Ordering Guide 7

Custom TaqMan Assays Product information About the Custom TaqMan Assay Design Tool After you select the sequences to study, access the Custom TaqMan Assay Design Tool on the Applied Biosystems web site to enter target sequences, import sequence information from a file, or search the Applied Biosystems database for sequences. After selecting the target sequences, submit the sequences to Applied Biosystems for custom designs. From the Custom TaqMan Assay Design Tool, you can select assays to order, then submit your order. Applied Biosystems manufactures, packages, and ships the TaqMan Assays to you. Using the Custom TaqMan Assay Design Tool, you can also: Enter custom primer/probe pairs Submit the sequences for the forward primer, reverse primer, and probe(s), then Applied Biosystems synthesizes the oligos and formulates a custom assay using your oligonucleotide sequences. Search for Pre-Designed TaqMan Assays Search the Applied Biosystems database for pre-designed Inventoried or Made-to-Order TaqMan Assays. Perform a bioinformatics analysis of input sequences Have the design tool perform bioinformatic analysis on your input sequences to design the best custom TaqMan assays for your needs. The bioinformatics analysis of the design tool: Generates custom assay designs using data from public molecular biology resources (Entrez and GeneBank). Provides enhanced search that can restrict the assay design to include sequences that are unique to a specific organism (for transgenic experiments). Displays candidate assay designs in context with genomic and transcript data. Masks input sequences for SNPs and low-complexity sequence. Performs in silico quality control of candidate assay designs to ensure accuracy and uniqueness of potential assays. IMPORTANT! Applied Biosystems does not provide the sequences for assays designed using the bioinformatics analysis feature of the assay design pipeline. 8 Custom TaqMan Assays Design and Ordering Guide

Custom TaqMan Assays Product information Part numbers Part numbers for the Custom TaqMan Assays indicate the type of assay and the number of reactions you want to order (see Table 1 and Table 2). For SNP assays, you can order human and nonhuman assays; the next section, Considerations for selecting SNP Genotyping Assays for human sequences, explains instances when you should not choose a human assay, even when the sequence is human. Table 1 Part numbers for TaqMan SNP Genotyping Assays Product Scale Part number Number of 5-μL reactions Assay mix concentration Custom TaqMan SNP Genotyping Assays, Human Small 4331349 1,500 40 Medium 4332072 5,000 40 Large 4332073 12,000 80 Custom TaqMan SNP Genotyping Assays, Non Human Small 4332077 1,500 40 Medium 4332075 5,000 40 Large 4332076 12,000 80 Table 2 Part numbers for TaqMan Gene Expression Assays Product Scale Part number Number of 20-μL reactions Assay mix concentration Custom TaqMan Gene Expression Assays Small 4331348 360 20 Medium 4332078 750 20 Large 4332079 2,900 60 Custom Plus TaqMan RNA Assays Small 4441114 360 20 Medium 4441117 750 20 Large 4441118 2,900 60 Assay sequences are not provided for Custom Plus TaqMan RNA Assay orders. Considerations for selecting SNP Genotyping Assays for human sequences Applied Biosystems performs a functional test on all human SNP Genotyping Assays. Genomic DNAs (gdnas) from 20 unrelated individuals (from 4 populations and both sexes) are amplified under universal conditions with the SNP Genotyping Assay to test for amplification and clustering. Human SNP Genotyping Assays that fail this test are not shipped. Consequently, if you expect SNP Genotyping Assays to human targets to fail the functional test, order the nonhuman SNP Genotyping Assays. Failures can occur for the following reasons: For human cdna sequences, the test fails because intronic sequences prevent primer or probe binding, or separate assay component binding sites and prevent efficient amplification because of longer amplicon size. For human Y-chromosome-specific sequences, the test fails because >90% of the samples in the test must amplify to pass, and the female samples in the functional test do not amplify. Custom TaqMan Assays Design and Ordering Guide 9

Custom TaqMan Assays Product information Custom assay design workflow This workflow is for submitting target sequences for Applied Biosystems to design and manufacture Custom TaqMan Assays. Design Custom TaqMan Assays Select target sequence Select and qualify target sites Order Custom TaqMan Assays Using the Custom TaqMan Assay Design Tool Access the Custom TaqMan Assays Design Tool (Gene expression assays only) Configure the bioinformatics settings Enter sequences Enter or copy and paste the sequence information Find target sequences Import sequence information from a file (File Builder or FASTA) Select assays Review and order 10 Custom TaqMan Assays Design and Ordering Guide

SECTION 1 1 Section 1 Custom TaqMan SNP Genotyping Assays This section covers: Design Custom TaqMan SNP Genotyping Assays........................ 12 Review target sequences............................................... 12 Select target sites...................................................... 15 Order Custom TaqMan SNP Genotyping Assays......................... 16 Access the Custom TaqMan Assay Design Tool.......................... 16 Enter sequences....................................................... 17 Select assays.......................................................... 20 Review and order..................................................... 21 Custom TaqMan Assays Design and Ordering Guide 11

1 Custom TaqMan Assays Design Custom TaqMan SNP Genotyping Assays Design Custom TaqMan SNP Genotyping Assays Review target sequences Overview The success of your Custom TaqMan Assay depends largely on the quality of the sequence data that you submit for the design process. After you select your target sequence, verify that it meets criteria for: Allele frequency Length Accuracy Uniqueness IMPORTANT! The quality assurance that is performed during manufacture of the primers and probes can ensure only that the yield and content of the primers and probes meet specifications. Although Applied Biosystems cannot guarantee the biological performance of the assays, reviewing your sequences as described in this document improves the possibility of success for your assay. Note: Human assays are tested against 20 unique DNA samples to ensure that the assays generate at least one cluster. Biological significance Verify that: The SNP is confirmed by more than one line of experimental evidence, for example, that the SNP is a double hit or a validated SNP. Minor Allele Frequency (MAF) data are available for the SNP. The SNP occurs in the population (ethnic group) that you are examining. These biological qualifiers give confidence that a SNP is well studied and may be useful as a marker in your particular study. Allele frequency criteria The minor allele frequency (MAF) indicates the frequency of the uncommon allele in a population (Traditionally, only the minor allele frequency is reported. The major allele frequency is implied, and it is calculated as 1 MAF.). From the MAF, you can estimate the size of the sample population that you need to detect a specified minor allele and to provide statistically significant results. If your sample is considerably smaller than the calculated value, consider using an assay for another SNP (one with a larger MAF) or increasing the sample size. For a known SNP, try to find the allele frequency from resources such as the NCBI dbsnp, HapMap, or other project databases. Use the Hardy-Weinberg Equilibrium equation to determine the likelihood that a SNP with a known MAF in a specified population is detectable in a sample of a particular size in the same population. The Hardy-Weinberg Equilibrium equation is: p 2 + 2pq + q 2 = 1 where p and q represent the allele frequencies. The values for p 2, 2pq, and q 2 correspond to the fraction of a known population that would be homozygous for the p allele (p:p), heterozygous (p:q), and homozygous for the q allele (q:q). 12 Custom TaqMan Assays Design and Ordering Guide

Section 1 Custom TaqMan SNP Genotyping Assays Design Custom TaqMan SNP Genotyping Assays 1 MAF example calculation For a SNP with a MAF of 5% (0.05), the predicted spread of genotypes is 0.0025 q:q, 0.095 p:q, and 0.9025 p:p. In a test of 20 genomic DNA samples from this population, you might expect to see: Approximately 0 homozygotes for q, the minor allele 2 heterozygotes 18 homozygotes for p, the major allele To detect a homozygote for the minor allele, the sample size would need to be approximately 400 individuals. Sequence length criteria A sequence length of approximately 600 bases is optimal, but the sequence length can vary from 100 to 5000 bases. Increasing the sequence length increases the assay design possibilities, although usually SNP assays produce amplicons of <200 base pairs. Provide a longer input sequence if your target sequence has low-complexity or contains N-masked nucleotides. Select the sequence so that the target site is near the center of the submitted sequence. About masking sequences The Custom TaqMan Assays Design Pipeline does not design a primer or probe that spans an ambiguous base (an N). The presence of one or more Ns at a site forces the design pipeline to design the assay at another site in the sequence. You can use Ns, therefore, to mask (hide) sites where you do not want an assay to be designed, such as sites that contain ambiguous bases, known repeats, and/or polymorphisms. Keep in mind, however, that the more Ns you use to mask undesired sites, the more you restrict the assay design possibilities. The next topic describes specific situations where you should consider masking your target sequence. Evaluate sequence accuracy and uniqueness criteria For more information about the tools that are used to evaluate target sequences, refer to Bioinformatic Evaluation of a Sequence for Custom TaqMan SNP Genotyping Assays (PN 4371003). 1. If you performed the sequencing yourself, perform multiple sequencing reactions to eliminate any ambiguities. 2. Except for the SNP(s) that you want to study, mask each ambiguous base in your sequence with an N. For example, the bases in bold text in the sequence below are ambiguous: ACGTGACGTGACGTGACGTGACGTGGATYGTGRSRSTCCT If you mask each ambiguous base with an N, the resulting sequence is: ACGTGACGTGACGTGACGTGACGTGGATNGTGNNNNTCCT Too many Ns can restrict the possibilities for assay design. It may be better to resequence your gene to eliminate ambiguities than to mask the ambiguities with Ns. Custom TaqMan Assays Design and Ordering Guide 13

1 Custom TaqMan Assays Design Custom TaqMan SNP Genotyping Assays 3. Using other resources such as public databases, determine if your target sequence is unique within the organism of study or if similar sequences exist in the database. For example, you may find similar sequences in databases of curated gene sequences such as Entrez Gene, at: http://www.ncbi.nih.gov/entrez/query.fcgi?db=gene If other similar sequences exist, determine the degree of similarity. Multiple target sites in the genome interfere with the function of the assays. 4. Using your target sequence as the query, perform a Basic Local Alignment Search Tool (BLAST ) database search to find regions of your sequence that are similar to sequences in the database. See Verify sequence uniqueness with a BLAST database search on page 58 for instructions. 5. If you find regions of your sequence that are similar to sequences in the database, mask those regions of your sequence with Ns. 14 Custom TaqMan Assays Design and Ordering Guide

Section 1 Custom TaqMan SNP Genotyping Assays Design Custom TaqMan SNP Genotyping Assays 1 Select target sites Guidelines for selecting potential target sites For SNP assays, each target site identifies a SNP, an MNP, or an insertion/deletion (indel). For the remainder of this section, SNP is used to refer to any of these three types of target site. Select: At least one target site. Note: No more than one assay is synthesized for each sequence, regardless of the number of target sites you enter. Entering more sites increases the assay design possibilities. Target sites that are more than 40 bases away from the 5 and 3 ends. Target sites that are more than two bases away from any Ns. If this is your target site, AGTGAACGCGATA[G/A]GCANCTCCTGCCC verify that no Ns are within two bases. Target sites that are more than two bases away from any other SNPs. At least one specific SNP for assay design (and mask all the remaining nontarget SNPs with Ns). Review sequences for repeats and polymorphisms Assays that are designed in regions of a sequence that contain repeats and/or polymorphisms are likely to produce nonspecific amplification and probe binding. To reduce the likelihood of nonspecific amplification and probe binding, mask repeats and polymorphisms. 1. Run the sequence through a program such as RepeatMasker to detect common repetitive elements. See Mask sequence repeats on page 69. 2. In the masked sequence that is generated by the program, determine if any of your target SNPs are: In a masked repeat Within 2 bases of a masked repeat If either condition exists, select another SNP because a primer or a probe cannot be designed within 2 bases of an N. 3. Run a BLAST database search using the masked sequence from step 2 against the dbsnp, a database of SNPs from various species. See Detect and mask nontarget sequence polymorphisms on page 73. 4. If you find nontarget SNPs, mask the nontarget SNPs with Ns. Select another SNP if any of your target SNPs is within 2 bases of a masked SNP. Custom TaqMan Assays Design and Ordering Guide 15

1 Custom TaqMan Assays Order Custom TaqMan SNP Genotyping Assays Order Custom TaqMan SNP Genotyping Assays Access the Custom TaqMan Assay Design Tool 1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store: a. At the top of the Applied Biosystems home page, click Store Log In. b. In the Store Log In page, log into the website as instructed. If you are a(n): Existing customer, enter your user name and password, then click Login. New customer, click Register Now, then complete the registration process as instructed. Note: You must log into the Applied Biosystems store before you can complete an order. 2. Go directly to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR Navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. 3. To enter, find, or import the target sequence and SNPs for Applied Biosystems to design and manufacture Custom TaqMan SNP Genotyping Assays, click Order Custom Genotyping Assays. Note: You can also use the Custom TaqMan Assay Design Tool to order custom primer/probe pairs or to order Pre-designed TaqMan Assays. See Appendix A, Order Other TaqMan Assays on page 47 for more information. 16 Custom TaqMan Assays Design and Ordering Guide

Section 1 Custom TaqMan SNP Genotyping Assays Order Custom TaqMan SNP Genotyping Assays 1 Enter sequences In the Enter Sequences tab, you can enter sequence information three different ways: Enter the sequence information (page 18). Find target sequences in the Applied Biosystems database (page 19). Import sequence information from File Builder or a FASTA-formatted file (page 20). Field Name Requirement Has 4 to 16 characters. Uses only alphanumeric, underscore, hyphen, and period characters. Has no spaces or tabs. Does not begin with a hyphen. Custom TaqMan Assays Design and Ordering Guide 17

1 Custom TaqMan Assays Order Custom TaqMan SNP Genotyping Assays Field Sequence SNP, SNP#, SNP Name Requirement Enter the sequence in the 5 to 3 direction. Enter from 100 to 5000 bases. Use only A, C, G, T, and N, except where SNP or indel target sites are marked. Convert the IUPAC codes R, Y, M, K, S, W, H, B, V, and D to N, except for marked SNP target sites where you translate the ambiguity code to the appropriate bases. Enclose each target site with square brackets [ ]. Within the brackets that enclose: SNP targets: Enter the base for the first allele followed by a forward slash (/), and then the base for the second allele. For example, convert R to [A/G]. MNP targets: Enter from one to six bases for the first allele followed by a forward slash (/), and then one to six bases for the second allele. Insertion/deletion (indel) targets: Enter from one to six bases for the insertion followed by a forward slash(/), then an asterisk (*) for the deletion. Mask with Ns any SNPs, MNPs, or indels that are not of interest. Note: The probe for the first allele is labeled with a VIC dye; the probe for the second allele is labeled with a 6-FAM dye. Each SNP target site of interest: Is marked with square brackets. Has the bases for 2 alleles of the SNP, separated by a forward slash. Each MNP target site of interest: Is marked with square brackets. Has 1 to 6 bases to the left of the forward slash and 1 to 6 bases to the right of the forward slash. (The number of bases on each side of the slash does not have to be the same.) Each Indel target site of interest: Is marked with square brackets. Has 1 to 6 bases to the left of a forward slash and an asterisk to the right of the forward slash. Enter the sequence information You can enter or copy and paste the sequence information directly in the Enter Sequences tab. 1. In the Name field, enter the name for the sequence. 2. In the Sequence field, enter the entire sequence of interest in the 5 to 3 direction. Remove any spaces, tabs, and line breaks. 3. Click Check Format to validate the format of the sequence(s). If an error message is displayed, correct the format of the sequence information, then click Check Format again. Repeat until the format is validated. Note: For each IUPAC code that represents an ambiguous base, you are asked to provide your conversion option. 4. Enter a SNP Name for each SNP in the entered sequence. Note: The combination of target name and sequence name must be unique. 5. (Optional) To enter another sequence: a. Click + Enter More Sequences. 18 Custom TaqMan Assays Design and Ordering Guide

Section 1 Custom TaqMan SNP Genotyping Assays Order Custom TaqMan SNP Genotyping Assays 1 b. Repeat step 1 through step 4 in an empty row. 6. Select the species and the scale. See Part numbers on page 9 for the number of reactions for each scale. Note: See Considerations for selecting SNP Genotyping Assays for human sequences on page 9 to determine whether to select human or nonhuman assays. 7. Click Submit For Assay Design. Note: The button is inactive until the format of the sequence information is free of errors. Find target sequences in the Applied Biosystems database You can search the Applied Biosystems database for target sequences to submit for custom assay designs. 1. In the Enter Sequences tab, click Search for Sequences. 2. Enter the chromosome location or search the database for the gene of interest. To enter the chromosome location: a. Select the Species, Chromosome (number), Chrom Start (chromosome start), and Chrom Stop (chromosome stop). b. Click Submit. To search the database for the transcript sequences: a. Select the Field to Search (Keyword, Gene Name, Gene Symbol, Accession Number, Entrez Gene ID, rs Number, or Cytoband), Species, Criteria (Contains, Matches, Begins With, or Ends With), and the Search Term. b. Click Submit to view a list of genes that meet your search criteria, sorted according to the gene symbol. c. In the Search Results, click Select for the gene of interest. 3. In the Genome Map, select the sequence: a. View the genome map to find the SNP(s) of interest. To zoom in: Click-drag the genome map left or right to center the desired location, then click until the desired view is achieved. To zoom out: Click until the desired view is restored. b. To redefine the range for the genome map, enter the chromosome number and the chromosome start and stop locations, then click Show Targets. c. Click a SNP to add the sequence to the Possible Targets list. 4. Add the sequence(s) to the Target List. Enter a name for each sequence that you want to submit, then click Add All to add all the possible sequences, or click Add for each sequence for which you want a custom assay design. 5. In the Target List, click Add to Design when you are done adding sequences to add the sequence information for the selected sites to the Edit Sequences tab. Custom TaqMan Assays Design and Ordering Guide 19

1 Custom TaqMan Assays Order Custom TaqMan SNP Genotyping Assays 6. In the Enter or Search for Sequence Information, click Check Format to validate the format of the sequence(s). If an error message is displayed, correct the format of the sequence information, then click Check Format again. Repeat until the format is validated. Note: For each IUPAC code that represents an ambiguous base, you are asked to provide your conversion option. 7. Enter a SNP Name for each SNP in the entered sequence. Note: The combination of SNP name and sequence name must be unique. 8. Click Submit For Assay Design. Note: The button is inactive until the format of the sequence information is free of errors. Import sequence information from File Builder or a FASTA-formatted file You can import files that you created or validated using File Builder software or that contain sequences in FASTA format. 1. In the Enter/Edit Sequence Information page, click Open/Import File. 2. For the File Type, select: File Builder if your file was created/validated using File Builder Software. FASTA if your file is in FASTA format. 3. Click Browse to find the file to import. 4. Select the text file (*.txt) that contains your sequences in File Builder or FASTA format, then click Open. 5. Click Import File. The sequence information from the file is added to the Enter/Edit Sequence Information page. Note: For FASTA-formatted files, the Custom TaqMan Assay Design Tool imports only the first 16 characters of the assay name into the Assay Name field. If your file contains multiple sequences with headers that are similar in the first 16 characters, edit the Assay Name field to distinguish between the sequences. Select assays After you submit your sequences After you submit your sequences for assay design, you can either wait for the Custom TaqMan Assay Design Tool to complete your design (step 3 below), or you can close your browser and return to your order at a later time (step 2 below). After receiving your sequence, Applied Biosystems sends you an e-mail to confirm that your sequences were submitted. The email contains a link to your design job in the Custom TaqMan Assay Design Tool that you can use to view the status of your job. When the Custom TaqMan Assay Design Tool completes your design job, Applied Biosystems sends another e-mail to notify you that you can view the candidate designs. You can use the link in the notification e-mail to view the design report in the Custom TaqMan Assay Design Tool. 20 Custom TaqMan Assays Design and Ordering Guide

Section 1 Custom TaqMan SNP Genotyping Assays Order Custom TaqMan SNP Genotyping Assays 1 Select assays to order 1. If you closed the Custom TaqMan Assay Design Tool after submitting your sequence(s), follow the link in the notification e-mail to the Custom TaqMan Assay Design Tool. 2. In the Design Details section of the Select Assays tab, select the row that corresponds to the submission. For each design job, the Design Details table displays the: Batch ID The ID assigned to the submission by Applied Biosystems. Submitted The date that you submitted the sequence information. Status The status of the design: Completed or Pending. Details The assays in each batch that passed, failed, or were not designed. 3. Review the Design Results in the Select Assays tab. For each assay, the Design Results table displays: ID/Name A unique 7-character identifier assigned to each custom assay that contains the name entered during assay submission. You can use an Assay ID to reorder a Custom TaqMan Assay. Type The type of assay: Custom TaqMan SNP Genotyping Assay or Custom TaqMan Gene Expression Assay. Design Status The status of the design: Passed, Failed, or Pending. Size The size or scale of the assay to order. For available sizes/scales, see page 9. Quantity The number of assays to order. 4. For each assay that you want to order: a. In the Size column, select the assay size or scale in the dropdown list. b. In the Quantity column, enter the quantity to order. 5. Click Add All to add all assays to the order, or click Add next to each assay that you want to order. Selected assays are added to the Shopping List. 6. When you are done adding assays to your order, click Order Now to proceed to the checkout. Review and order Review the order 1. In the Review & Order tab, confirm the assays to order: To delete an assay, enter 0 in the Quantity field. To change the size, select a different part number and size from the Size dropdown list. For available sizes/scales, see page 9. To change the quantity, enter a different number in the Quantity field. To add more items to your Shopping List, click the Home, Search, or Select Assays tab in the Custom TaqMan Assay Design Tool. Custom TaqMan Assays Design and Ordering Guide 21

1 Custom TaqMan Assays Order Custom TaqMan SNP Genotyping Assays 2. Select the option to determine how you will receive the assays. Click Singles View to receive the assays in individual tubes. Click Plate View to receive the assays in the wells of a 96-well plate. Note: Human and non-human assays cannot be plated on the same plate. Note: You can append assays to previously created plate configurations. Place the order In the Review & Order tab, you can place your order three different ways: Place the order online through the Applied Biosystems secure store (page 22). Email the order to Applied Biosystems (page 22). Print and fax or mail the order to Applied Biosystems (page 23). Order through the Applied Biosystems website 1. Click Add to Basket to add the items from your Shopping List to the basket in the Applied Biosystems Store. 2. In the Store Log In page, enter your User Name and Password. 3. Select the shopping basket, then click Add to Basket. 4. Review the shopping basket in the Applied Biosystems Store, then click Continue. 5. In the Shipping & Billing page, enter the Shipping Address, Billing Address, Contact Information, Payment Information, Shipping Method, Special Instructions, and Options. When you finish, click Continue. 6. Review the summary, click Place Order or Add To Configurator depending on the reaction format that you selected, then follow the instructions to complete the order. Email the order to Applied Biosystems IMPORTANT! Personal e-mail software is not required to e-mail the order form to Applied Biosystems. The order form is transmitted via an encrypted secure socket layer (SSL) that ensures maximum security of the order data. 1. Click Email to AB or any e-mail address to display the e-mail order form. 2. Complete the form as instructed, then click E-Mail Order Form. 3. (Optional) Click Print Order Form to print a hardcopy of the order for your records. 4. When you are finished, click Close Order Form to return to the Applied Biosystems website. 22 Custom TaqMan Assays Design and Ordering Guide

Section 1 Custom TaqMan SNP Genotyping Assays Order Custom TaqMan SNP Genotyping Assays 1 Print and fax or mail the order to Applied Biosystems 1. Click Print for fax/mail order or hardcopy record to display a printer-friendly order form. 2. Click Print Window to send the order form to your printer, then follow the instructions to configure the printed hardcopy. 3. When the form has printed successfully, click Close Window to return to the Applied Biosystems website. Custom TaqMan Assays Design and Ordering Guide 23

1 Custom TaqMan Assays Order Custom TaqMan SNP Genotyping Assays 24 Custom TaqMan Assays Design and Ordering Guide

SECTION 2 2 Section 2 Custom TaqMan Gene Expression Assays This section covers: Design Custom TaqMan Gene Expression Assays........................ 26 Order Custom TaqMan Gene Expression Assays......................... 27 Access the Custom TaqMan Assay Design Tool.......................... 27 Configure the bioinformatics settings.................................... 28 Enter sequences....................................................... 30 Select assays.......................................................... 34 Review and order..................................................... 38 Custom TaqMan Assays Design and Ordering Guide 25

2 Custom TaqMan Assays Design Custom TaqMan Gene Expression Assays Design Custom TaqMan Gene Expression Assays The Custom TaqMan Assay Design Tool can search for predesigned TaqMan assays or assist you in designing custom TaqMan assays for quantitative gene expression analysis. The following table describes the TaqMan assay products that you can order using the tool. Product TaqMan Gene Expression Assays Custom Plus TaqMan RNA Assays Custom TaqMan Gene Expression Assays Description Predesigned and optimized TaqMan assays developed by Applied Biosystems. The Applied Biosystems website offers more than 1,000,000 predesigned TaqMan Gene Expression Assays for a variety of species. All assays are designed using the Applied Biosystems validated bioinformatics pipeline, eliminating the need for primer design or PCR optimization. To search for and order predesigned TaqMan Gene Expression Assays, go to Search for Pre-designed TaqMan Gene Expression Assays on page 56. Custom TaqMan assays that are designed to input sequences using the Custom TaqMan Assay Design Tool bioinformatics analysis feature. The bioinformatics analysis feature automates most aspects of the assay design process. The tool uses data from public molecular biology resources (Entrez and GeneBank) to assist you in designing optimal TaqMan assays. To use the Custom TaqMan Assay Design Tool bioinformatics analysis feature to design Custom Plus assays, go to Order Custom TaqMan Gene Expression Assays on page 27. IMPORTANT! Applied Biosystems does not provide the sequences for Custom Plus TaqMan RNA Assays designed using the bioinformatic analysis feature of the assay design pipeline. Custom TaqMan assays manufactured to input sequences without the use of the Custom TaqMan Assay Design Tool bioinformatics analysis feature. If you have already performed a bioinformatics analysis of your input sequences: 1. Review the information in Appendix B to validate the quality of your input target sequence(s). 2. Go to Order Custom TaqMan Gene Expression Assays on page 27 to order Custom TaqMan Gene Expression Assays. 26 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 Order Custom TaqMan Gene Expression Assays Access the Custom TaqMan Assay Design Tool 1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store: a. At the top of the Applied Biosystems home page, click Store Log In. b. In the Store Log In page, log into the website as instructed. If you are a(n): Existing customer, enter your user name and password, then click Login. New customer, click Register Now, then complete the registration process as instructed. Note: You must log into the Applied Biosystems store before you can complete an order. 2. Go directly to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR Navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan Gene Expression Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. 3. To enter, find, or import the target sequence for Applied Biosystems to design and manufacture Custom TaqMan Gene Expression Assays, click Order Custom Gene Expression Assays. Note: You can also use the Custom TaqMan Assay Design Tool to order custom primer/probe pairs or to order Pre-designed TaqMan Assays. See Appendix A, Order Other TaqMan Assays on page 47 for more information. Custom TaqMan Assays Design and Ordering Guide 27

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays Configure the bioinformatics settings 1. Select the species associated with the sequence(s) that you are submitting. Note: If you are designing a Custom TaqMan Gene Expression Assay for use with a transgenic organism, select the species associated with the transgene sequence(s). 2. Select an option to indicate whether you want to use the bioinformatics analysis feature of the assay design tool. Option No bioinformatic analysis on my sequences Yes, please perform bioinformatic analysis on my sequences The Custom TaqMan Assay Design Tool Designs an assay to the given input sequence without bioinformatic sequence analysis. Note: If you choose to perform your own bioinformatic analysis, review the information in Appendix B to validate the quality of your input target sequence(s) and for more information on bioinformatics analysis tools. Designs the best possible assays to your input sequences using the full bioinformatic power of the assay design pipeline. By selecting this option, the assay design pipeline: 1. Aligns the input sequence(s) to the genome of the selected species and its known transcripts. 2. Masks the input sequence(s) for SNPs and lowcomplexity sequence. 3. Designs assays for the input sequence(s) based on the options you have chosen, and performs in silico quality control to ensure the best possible assay design. IMPORTANT! Applied Biosystems does not provide the sequences for assays designed using the bioinformatic analysis feature of the assay design pipeline. 3. If you choose to perform a bioinformatics analysis: a. Select the option to determine the specificity of your assay design(s). Option The assays detect only my input sequences (most specific/ transcript-level analysis) The assays may detect other transcript variants at the same locus (gene-level analysis) The assay design tool Limits the bioinformatics analysis to include assays that amplify only the sequence(s) that you provide. Provides recommended assay designs that can amplify other variants of the sequence(s) that you provide at the same locus. 28 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 b. (Optional) Select the species that candidate assays must not detect (such as for transgenic experiments). Note: Selecting an organism from the list causes the assay design pipeline to exclude assays that detect sequences that are present in the genome of the selected organism. Custom TaqMan Assays Design and Ordering Guide 29

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays Enter sequences In the Enter Sequences tab, you can enter sequence information three different ways after you indicate your target species and bioinformatics analysis preference: Enter the sequence information (page 31). Find target sequences in the Applied Biosystems database (page 31). Import sequence information from File Builder or a FASTA-formatted file (page 33). Field Name Sequence Target Position & Name Requirement Has 4 to 16 characters. Uses only alphanumeric, underscore, hyphen, and period characters. Has no spaces or tabs. Does not begin with a hyphen. Enter the sequence in the 5 to 3 direction. Enter from 61 to 5000 bases. Use only A, C, G, T, and N. Convert the IUPAC codes R, Y, M, K, S, W, H, B, V, and D to N. Convert U to T. Remove any spaces, tabs, or line breaks. The target position indicates the base position of the target site from the 5 end. The target position indicates where to design the TaqMan probe. The target site name contains no more than four alphanumeric characters. 30 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 Enter the sequence information You can enter or copy and paste the sequence information directly in the Enter Sequences tab. 1. In the Name field, enter the name for the sequence. 2. In the Sequence field, enter the entire sequence of interest in the 5 to 3 direction. Remove any spaces, tabs, and line breaks. 3. Click Check Format to validate the format of the sequence(s). If an error message is displayed, correct the format of the sequence information, then click Check Format again. Repeat until the format is validated. Note: The only characters that are allowed in a sequence for gene expression assays are: A, C, G, T, and N. The Custom TaqMan Assay Design Tool converts all other characters to Ns. 4. In the Target Site Position & Name column, select: Manual to enter the target position and target name. In the Pos field, enter the number of bases between the target site and the 5 end, then in the Name field, enter the target name. Click + Enter More Targets to enter more target sites. Automatic to have the TaqMan Assays design pipeline select a target from multiple unspecified sites. Note: If you select Automatic and you chose to perform a bioinformatic analysis on your input sequences (step 2 on page 28), then the design pipeline will design assays for all predicted exon junctions. 5. (Optional) To enter another sequence: a. Click + Enter More Sequences. b. Repeat step 1 through step 4 in an empty row. 6. Click Continue. Note: The button is inactive until the format of the sequence information is free of errors. After you submit your sequence(s) for design, the Custom TaqMan Assay Design Tool automatically searches for predesigned assays that match your input sequence(s). If found, the tool displays all compatible predesigned TaqMan assays before presenting you with the custom assay designs. Find target sequences in the Applied Biosystems database You can search the Applied Biosystems database for target sequences to submit for custom assay designs. 1. In the Enter Sequences tab, click Search for Sequences by Keyword or Location. 2. Search the database for the gene of interest. To enter the chromosome location: a. Select the Species, Chromosome (number), Chrom Start (chromosome start), and Chrom Stop (chromosome stop). b. Click Submit. Custom TaqMan Assays Design and Ordering Guide 31

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays To search the database for the gene: a. Select the Field to Search (Keyword, Gene Name, Gene Symbol, Accession Number, Entrez Gene ID, or RNAdb ID, or RNAdb Gene Symbol), Species, Criteria (Contains, Matches, Begins With, or Ends With), and the Search Term. b. Click Submit to view a list of genes that meet your search criteria, sorted according to the gene symbol. c. In the Search Results, click Select for the gene of interest. 3. In the Genome Map, select the sequence: a. If available, view the genome map to find the transcript(s) of interest. The genome map is available only for human, mouse, and rat. To zoom in: Click-drag the genome map left or right to center the desired location, then click until the desired view is achieved. To zoom out: Click until the desired view is restored. b. To redefine the range for the genome map, enter the chromosome start and stop locations, then click Submit. c. To view both GenBank and RefSeq mrna transcripts within the displayed range of the genome map, select Show GenBank mrnas. d. Select two exons (blue boxes), then click the bracket that joins the exons to add the sequence to the Possible Sequences list. If the transcript contains only one exon, select the exon, then click the bracket that appears above the exon to add the sequence to the Possible Sequences list. To select the entire transcript, click the transcript between exons, then click the bracket joining all of the exons to add the transcript to your possible targets. 4. Add the sequence(s) to the Target List. Enter a name for each sequence that you want to submit, then click Add All to add all the possible sequences, or click Add for each sequence for which you want a custom assay design. 5. In the Target List, click Add to Design when you are done adding sequences to add the sequence information for the selected sites to the Edit Sequences tab. 6. In the Enter or Search for Sequence Information, enter a name for any unnamed sequences, then click Check Format to validate the format of the sequence(s). If an error message is displayed, correct the format of the sequence information, then click Check Format again. Repeat until the format is validated. 7. In the Target Site Position & Name column, select: Manual to enter the target position and target name. In the first field, enter the number of bases between the target site and the 5 end, then in the second field, enter the target name. Click + Enter More Targets to enter more target sites. Note: If you searched for sequences and selected two or more exons, the target position(s) and name(s) are automatically populated with the exon junction information. Automatic to have the TaqMan Assays Design Pipeline select a target from multiple unspecified sites. 32 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 8. Click Continue. Note: The button is inactive until the format of the sequence information is free of errors. After you submit your sequence(s) for design, the Custom TaqMan Assay Design Tool automatically searches for predesigned assays that match your input sequence(s). If found, the tool displays all compatible predesigned TaqMan assays before presenting you with the custom assay designs. Import sequence information from File Builder or a FASTA-formatted file You can import files that you created or validated using File Builder software or that contain sequences in FASTA format. 1. In the Enter/Edit Sequence Information page, click Open/Import File. 2. For the File Type, select: File Builder if your file was created/validated using File Builder Software. FASTA if your file is in FASTA format. 3. Click Browse to find the file to import. 4. Select the text file (*.txt) that contains your sequences in File Builder or FASTA format, then click Open. 5. Click Import File. The sequence information from the file is added to the Enter/Edit Sequence Information page. Note: For FASTA-formatted files, the Custom TaqMan Assay Design Tool imports only the first 16 characters of the assay name into the Assay Name field. If your file contains multiple sequences with headers that are similar in the first 16 characters, edit the Assay Name field to distinguish between the sequences. After you submit your sequence(s) for design, the Custom TaqMan Assay Design Tool automatically searches for predesigned assays that match your input sequence(s). If found, the tool displays all compatible predesigned TaqMan assays before presenting you with the custom assay designs. Custom TaqMan Assays Design and Ordering Guide 33

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays Select assays After you submit your sequences After you submit your sequences for assay design, you can either wait for the Custom TaqMan Assay Design Tool to complete your design (step 2 below), or you can close your browser and return to your order at a later time (step 1 below). After receiving your sequence, Applied Biosystems sends you an e-mail to confirm that your sequences were submitted. The email contains a link to your design job in the Custom TaqMan Assay Design Tool that you can use to view the status of your job. When the Custom TaqMan Assay Design Tool completes your design job, Applied Biosystems sends another e-mail to notify you that you can view the candidate designs. You can use the link in the notification e-mail to view the design report in the Custom TaqMan Assay Design Tool. Select assays to order Before viewing the custom assay design results, review the alignment maps for your input sequences that have compatible pre-designed TaqMan assays. After receiving your sequences, the assay design tool searches for predesigned TaqMan Gene Expression or TaqMan Non-Coding Assays that match your input sequence(s) 100%. If you choose not to use predesigned assays, you can proceed directly to the Custom Assay Design screen to review your assay designs. Note: If you closed the browser after submitting your input sequences, you can view matching predesigned assays by following the link in either of the notification e-mails that you receive from Applied Biosystems. 1. If you closed your browser after submitting your sequence(s): a. Follow the link in your notification e-mail to the Custom TaqMan Assay Design Tool, then click Back to Predesigns in the Select Assays web page. b. Choose from the following. If you want to: Review predesigned TaqMan assays that match your submitted sequences, go to step 2. Skip the predesigned assay review and instead view the custom TaqMan assay designs for your input sequences, go to step 3 on page 36. 34 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 2. View and select the predesigned TaqMan assays: a. In the Select Assays tab, review the input sequences that have matching compatible predesigned TaqMan Gene Expression Assays. For each input sequence, the Design Details table displays the following: Sequence Name The unique identifier that you gave to the sequence. The sequence name is referred to as the Assay Name after you order the assay. Note: Click Important Information to display any notices or warnings associated with the input sequence. Assay IDs The unique identifiers of the predesigned TaqMan Gene Expression Assays. The following columns are displayed only if you use the custom assay design tool to perform bioinformatics analysis: Genome Match A measure of how closely the input sequence matches the chosen genome, where the number is the percentage of nucleotides in the input sequence that match the chosen genome. The assay design tool displays only matches greater than 90%. Genome Position The chromosomal position to which the assay sequence is aligned within the associated genome in the following format: <chromosome number>:<chromosome start>-<chromosome stop> The design tool displays the genome position if the input sequence aligns with less than a 90% match to the genome, the design tool does not display the genome position. Locus The unique loci to which the sequence aligns in the genome. Note: The assay design tool displays only the top three unique loci that have 90% alignment to the input sequence. The following columns are displayed if you chose to perform your own bioinformatics analysis: Availability The availability of the related predesigned TaqMan Gene Expression Assay: Inventoried or Made-To-Order. Assay Type The coding status of the related predesigned TaqMan Gene Expression Assay: Coding or Non-coding. Amplicon Length The number of bases that compose the amplicon of the associated custom TaqMan assay. Custom TaqMan Assays Design and Ordering Guide 35

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays b. For each input sequence, click Alignment Map to display the compatible predesigned TaqMan Gene Expression Assays in context with the input sequence and the associated genome. Note: Alignment maps are not available for all species; the option is displayed only if data is available. c. Click Add All to add all assays to the order, or click Add next to each assay that you want to order. Selected assays are added to the Shopping List. d. When you are done adding assays to your order: Click Order Now and go to Review and order on page 38 to complete your order without reviewing the custom assay designs. Click Proceed to Custom Assays and go to step 3 to view the list of candidate custom assays designed to your input sequence(s). 3. In the Design Details section of the Select Assays tab, select the row that corresponds to the submission. For each design job, the Design Details table displays the: Batch ID The ID assigned to the submission by Applied Biosystems. Type The type of assay(s) designed: GTP (Custom TaqMan SNP Genotyping Assay), GX (Custom TaqMan Gene Expression Assay), and GXP (Custom Plus TaqMan RNA Assay). Submitted The date that you submitted the sequence information. Status The status of the design: Completed or Pending. Details The assays in each batch that passed, failed, or were not designed. 36 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 4. Review the Design Results in the Select Assays tab. For each sequence, the Design Results table displays: Assay Name The unique identifier that you gave to the sequence. Note: Click Alignment Map to view the alignment map for the input sequence and the associated custom assay designs. (An alignment map is available only if you used the assay design tool to perform a bioinformatics analysis of the input sequence.) Note: Click Target Sequence to view the nucleic acid sequence of the associated sequence. Assay ID A 7-character alphanumeric identifier assigned by Applied Biosystems to each Custom TaqMan Assay. Status The status of the associated TaqMan assay: PASS or FAIL. The following columns are also displayed if you used the assay design tool to perform a bioinformatics analysis of the input sequences: Locus The unique loci to which your input sequence aligns in the genome. The display tool shows only the top three unique loci matches. Genome Position The chromosomal position to which the input sequence aligns within the associated genome in the following format: <chromosome number>:<chromosome start> -<chromosome stop> Amplicon Size The number of bases that compose the amplicon of the associated Custom TaqMan assay. 5. For each assay that you want to order: a. In the Size column, select the assay size or scale in the dropdown list. b. In the Quantity column, enter the quantity to order. 6. Click Add All to add all assays to the order, or click Add next to each assay that you want to order. Selected assays are added to the Shopping List. 7. When you are done adding assays to your order: Click Order Now and go to Review and order on page 38 to proceed to the checkout. Click Continue and go to step 8 to review related products and controls for use with your assays. 8. Review the Related Products and add control assays or kits as needed: a. Click the [ + ] next to any reagent kits that you want to order. b. For each assay that you want to order, select the assay that matches the probe dyes, the primer concentrations, and the number of reactions that you want. c. Click Add next to each assay that you want to order. Selected assays are added to the Shopping List. Custom TaqMan Assays Design and Ordering Guide 37

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays d. Click Order Now. Review and order Review the order Place the order In the Review & Order tab, confirm the assays to order: To delete an assay, enter 0 in the Quantity field. To change the size, select a different part number and size from the Size dropdown list. For available sizes/scales, see page 9. To change the quantity, enter a different number in the Quantity field. In the Review & Order tab, you can place your order three different ways: Place the order online through the Applied Biosystems secure store (page 38). Email the order to Applied Biosystems (page 39). Print and fax or mail the order to Applied Biosystems (page 39). Order through the Applied Biosystems website 1. Click Add to Basket to add the items from your Shopping List to the basket in the Applied Biosystems Store. 2. In the Store Log In page, enter your User Name and Password. 3. Select the shopping basket, then click Add to Basket. 4. Review the shopping basket in the Applied Biosystems Store, then click Continue. 5. In the Shipping & Billing page, enter the Shipping Address, Billing Address, Contact Information, Payment Information, Shipping Method, Special Instructions, and Options. When you finish, click Continue. 6. Review the summary, click Place Order, then follow the instructions to complete the order. 38 Custom TaqMan Assays Design and Ordering Guide

Section 2 Custom TaqMan Gene Expression Assays Order Custom TaqMan Gene Expression Assays 2 Email the order to Applied Biosystems IMPORTANT! Personal e-mail software is not required to e-mail the order form to Applied Biosystems. The order form is transmitted via an encrypted secure socket layer (SSL) that ensures maximum security of the order data. 1. Click Email to AB or any e-mail address to display the e-mail order form. 2. Complete the form as instructed, then click E-Mail Order Form. 3. (Optional) Click Print Order Form to print a hardcopy of the order for your records. 4. When you are finished, click Close Order Form to return to the Applied Biosystems website. Print and fax or mail the order to Applied Biosystems 1. Click Print for fax/mail order or hardcopy record to display a printer-friendly order form. 2. Click Print Window to send the order form to your printer, then follow the instructions to configure the printed hardcopy. 3. When the form has printed successfully, click Close Window to return to the Applied Biosystems website. Custom TaqMan Assays Design and Ordering Guide 39

2 Custom TaqMan Assays Order Custom TaqMan Gene Expression Assays 40 Custom TaqMan Assays Design and Ordering Guide

SECTION 3 3 Section 3 Reorder Custom TaqMan Assays This section covers: Reorder online........................................................ 42 Reorder legacy assays................................................. 44 Custom TaqMan Assays Design and Ordering Guide 41

3 Custom TaqMan Assays Reorder online Reorder online You can reorder assays through the Applied Biosystems website in two ways: using the Quick Order service or the Custom TaqMan Assay Design Tool. Reorder using Quick Order 1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store: a. At the top of the Applied Biosystems home page, click Store Log In. b. In the Store Log In page, enter your user name and password, then click Login. Note: You must log into the Applied Biosystems store before you can complete the order. 2. In the Applied Biosystems webpage, click Quick Order. 3. Enter or copy/paste the order data for the assays of interest: Manual entry Enter one or more part number-id combinations, then enter a value in the Quantity field. Copy/paste entry Copy and paste the part numbers-id combination data into the Part Numbers/IDs* field. 4. Select a basket, then click Add to Basket to process the order. Note: If you do not select a basket, your default basket (My Basket) will be used. To create another basket, click Manage Shopping Baskets. 5. Complete the order as directed. Reorder using the standard ordering service 1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store: a. At the top of the Applied Biosystems home page, click Store Log In. b. In the Store Log In page, enter your user name and password, then click Login. Note: You must log into the Applied Biosystems store before you can complete the order. 2. Go directly to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR 42 Custom TaqMan Assays Design and Ordering Guide

Section 3 Reorder Custom TaqMan Assays Reorder online 3 Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays or TaqMan Gene Expression Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays or Custom TaqMan Gene Expression Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. 3. Click Reorder Existing Custom Assays. 4. In the Search tab, search for existing custom assays: a. From the Fields to be Searched dropdown list, select: Assay ID, Legacy Assay-ID, Assay Name, Date Range, Sales Order # Note: Legacy assays are Custom TaqMan Assays that were designed before the release of the Custom TaqMan Assay Design Tool. LegacyAssay IDs are IDs assigned to custom assays, ordered before February 2009, that consist of the sequence and target names, separated by a hyphen. b. Select the criteria: Matches or Contains. c. Enter the Term to search. d. (Required for legacy IDs) Enter the Sales Order #. e. Click Search. 5. For each assay that you want to order: a. Select the assay size in the dropdown list in the Size column. b. Enter the number of tubes to order in the Quantity column. 6. Click Add All to add all assays to the order, or click Add next to each assay to order. Selected assays are added to the Shopping List. Custom TaqMan Assays Design and Ordering Guide 43

3 Custom TaqMan Assays Reorder legacy assays Reorder legacy assays Legacy assays are Custom TaqMan Assays that were designed before the release of the Custom TaqMan Assay Design Tool. LegacyAssay IDs were generated differently from Assay IDs. Use the procedures in this section to reorder legacy assays by e-mail or by regular or express mail. IMPORTANT! To reorder legacy Custom TaqMan Assays, you need information from the Assay Information File (AIF) that was shipped to you with the previous assay. Reorder online To reorder legacy assays online using Quick Order, see Reorder online on page 42. Reorder by e-mail 1. Address the message: For orders to North America: orders@appliedbiosystems.com For orders to Europe: assays.europe@appliedbiosystems.com For other regions, contact your local Applied Biosystems office or visit www.appliedbiosystems.com/support/contact 2. In the subject line, enter Reorder for Custom TaqMan Assay. 3. In the message body enter the: Sales order number The number in the Assay Information File (AIF) that was shipped to you with your previous Custom TaqMan Assays order. Assay ID The ID from the AIF. Part number The number that indicates the type of assay and the scale that you want to order. Quantity The number of tubes to order. Purchase order number or Credit card information The name as it appears on the card, the card number, and the expiration date. Contact information The name, e-mail address, telephone number, and address of the person to contact if problems occur. Shipping information The name, address (including room number, building, department, and the ATTN line information), and telephone number of the person to receive shipment. Invoice information The name, e-mail address, physical address, and telephone number of the purchasing agent or person to receive invoice details. 4. Send the message. 44 Custom TaqMan Assays Design and Ordering Guide

Section 3 Reorder Custom TaqMan Assays Reorder legacy assays 3 Reorder by regular or express mail 1. Prepare an order document containing the: Sales order number The number in the Assay Information File (AIF) that was shipped to you with your previous Custom TaqMan Assays order. Assay ID The ID from the AIF. Part number The number that indicates the type of assay and the scale that you want to order. Quantity The number of tubes to order. Purchase order number or Credit card information The name as it appears on the card, the card number, and the expiration date. Contact information The name, e-mail address, telephone number, and address of the person to contact if problems occur. Shipping information The name, address (including room number, building, and department), and telephone number of the person to receive shipment. Invoice information The name, e-mail address, physical address, and telephone number of purchasing agent or person to receive invoice details. IMPORTANT! To prevent delays, include all information in the order document. 2. Print a copy of the order document. 3. Send the printed copy of your order document to the appropriate address (see page 82). Custom TaqMan Assays Design and Ordering Guide 45

3 Custom TaqMan Assays Reorder legacy assays 46 Custom TaqMan Assays Design and Ordering Guide

APPENDIX A A Order Other TaqMan Assays This appendix covers: Section A.1 Order Other TaqMan SNP Genotyping Assays.............. 49 Enter custom primer/probe pairs........................................ 49 Search for Pre-designed TaqMan SNP Genotyping Assays................. 52 Section A.2 Order Other TaqMan Gene Expression Assays.............. 53 Enter custom primer/probe pairs........................................ 53 Search for Pre-designed TaqMan Gene Expression Assays................. 56 Custom TaqMan Assays Design and Ordering Guide 47

A Appendix A Order Other TaqMan Assays 48 Custom TaqMan Assays Design and Ordering Guide

SECTION A.1 A.1 Section A.1 Order Other TaqMan SNP Genotyping Assays Enter custom primer/probe pairs Submit the sequences for the forward primer, reverse primer, and TaqMan MGB probes, then Applied Biosystems synthesizes the oligos and formulates a custom assay using your oligonucleotide sequences. Format requirements Field Assay Name Forward Primer Reverse Primer Probe 1 Probe 2 Requirement Enter 4 to 16 characters. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Note: The probe for the first allele is labeled with VIC dye. Enter the sequence in the 5 to 3 orientation. Enter between 9 and 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Note: The probe for the second allele is labeled with 6-FAM dye. Custom TaqMan Assays Design and Ordering Guide 49

A Appendix A Order Other TaqMan Assays Enter custom primer/probe pairs Access the Custom TaqMan Assay Design Tool 1. Go directly to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. 2. In the Custom TaqMan SNP Genotyping Assays section, click Enter Custom Primer/Probe Pairs. You will enter the sequences for the forward primer, reverse primer, and TaqMan MGB probes, then Applied Biosystems will synthesize the oligos and formulate a custom assay mix using your custom primer and probe sequences. Enter the sequences 1. Enter 4 to 16 characters for the Assay Name. 2. Enter 9 to 45 nucleotides (A, C, G, or T) for the Forward Primer sequence. 3. Enter 9 to 45 nucleotides (A, C, G, or T) for the Reverse Primer sequence. 4. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe 1 sequence. 5. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe 2 sequence. 6. (Optional) To enter more than one custom primer/probe pair, click + Add New Sequence, then repeat step 1 through step 5. 50 Custom TaqMan Assays Design and Ordering Guide

Section A.1 Order Other TaqMan SNP Genotyping Assays Enter custom primer/probe pairs A Import sequence information from a file 1. Click Open/Import File. The uploaded file must be a tab-delimited text file (.txt) that includes all of the following information, including the column headers: Assay name (first column) Enter a name for the assay (followed by a Tab character). FAM probes sequence (second column) Enter the sequence of the FAM/ MGB probe in the 5 to 3 direction (followed by a Tab character). Forward primer sequence (third column) Enter the forward primer sequence in the 5 to 3 direction (followed by a Tab character). Reverse primer sequence (fourth column) Enter the reverse primer sequence in the 5 to 3 direction. Note: To include multiple sequences in the file, enter the assay information in the following lines of the file in the same format. Do not repeat the heading information. The following is an example of properly formatted file: Assay namefam probes sequenceforward primer sequencereverse primer sequence mysequenceacgactgatcgatcgggtaccggtatacgtagttgattacgataccacgtacaca Note: For more information on how to format the file, click Import File Format Requirements. 2. Click Browse, select the file, then click Open. 3. Click Import File. Check the format and submit your sequences After you finish entering custom primer/probe pairs, check the format of the sequences. 1. Click Check Format, then correct the sequence information as needed. 2. Click Submit. A confirmation message is displayed with an AB Workspace Batch ID. 3. Click Continue to proceed to the Select Assays page. (Optional) Save the sequence information in a file After you check the format, you can save the sequence information in a *.txt file. 1. Click Save File. 2. In the Save File dialog box, select a location for the file, enter a file name, then click Save. Custom TaqMan Assays Design and Ordering Guide 51

A Appendix A Order Other TaqMan Assays Search for Pre-designed TaqMan SNP Genotyping Assays Search for Pre-designed TaqMan SNP Genotyping Assays Search the Applied Biosystems database for pre-designed Inventoried or Made-to- Order TaqMan Assays. To perform an Assay Search with complete search capabilities, place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. Access the Custom TaqMan Assay Design Tool 1. Go to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays. c. Below How to Order, click Custom TaqMan Assay Design Tool. 2. To search the database for pre-designed Applied Biosystems Inventoried or Made-to-Order TaqMan SNP Genotyping Assays, click Search for Pre-designed TaqMan SNP Genotyping Assays. 52 Custom TaqMan Assays Design and Ordering Guide

SECTION A.2 A.2 Section A.2 Order Other TaqMan Gene Expression Assays Enter custom primer/probe pairs Submit the sequences for the forward primer, reverse primer, and TaqMan MGB probe, then Applied Biosystems synthesizes the oligos and formulates a custom assay using your oligonucleotide sequences. Format requirements Field Assay Name Forward Primer Reverse Primer Probe Requirement Enter 4 to 16 characters. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Convert U to T. Remove any spaces, tabs, or line breaks. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Convert U to T. Remove any spaces, tabs, or line breaks. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Convert U to T. Remove any spaces, tabs, or line breaks. Note: The probe sequence must be for a TaqMan MGB probe. Custom TaqMan Assays Design and Ordering Guide 53

A Appendix A Order Other TaqMan Assays Enter custom primer/probe pairs Access the Custom TaqMan Assay Design Tool 1. Go directly to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan Gene Expression Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. 2. In the Custom TaqMan Gene Expression Assays section, click Enter Custom Primer/Probe Pairs. You will enter the sequences for the forward primer, reverse primer, and TaqMan MGB probe labeled with FAM dye, then Applied Biosystems will synthesize the oligos and formulate a custom assay mix using your custom primer and probe sequences. Enter the sequences 1. Enter 4 to 16 characters for the Assay Name. 2. Enter 9 to 45 nucleotides (A, C, G, or T) for the Forward Primer sequence. 3. Enter 9 to 45 nucleotides (A, C, G, or T) for the Reverse Primer sequence. 4. Select and enter the information for the TaqMan MGB probe: a. Select the Dye (6-FAM). b. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe sequence. 5. (Optional) To enter more than one custom primer/probe pair, click + Add New Sequence, then repeat step 1 through step 4. 54 Custom TaqMan Assays Design and Ordering Guide

Section A.2 Order Other TaqMan Gene Expression Assays Enter custom primer/probe pairs A Import sequence information from a file 1. Click Open/Import File. The uploaded file must be a tab-delimited text file (.txt) that includes all of the following information, including the column headers: Assay name (first column) Enter a name for the assay (followed by a Tab character). FAM probes sequence (second column) Enter the sequence of the FAM/ MGB probe in the 5 to 3 direction (followed by a Tab character). Forward primer sequence (third column) Enter the forward primer sequence in the 5 to 3 direction (followed by a Tab character). Reverse primer sequence (fourth column) Enter the reverse primer sequence in the 5 to 3 direction. Note: To include multiple sequences in the file, enter the assay information in the following lines of the file in the same format. Do not repeat the heading information. The following is an example of properly formatted file: Assay namefam probes sequenceforward primer sequencereverse primer sequence mysequenceacgactgatcgatcgggtaccggtatacgtagttgattacgataccacgtacaca Note: For more information on how to format the file, click Import File Format Requirements. 2. Click Browse, select the file, then click Open. 3. Click Import File. Check the format and submit your sequences After you finish entering custom primer/probe pairs, check the format of the sequences. 1. Click Check Format, then correct the sequence information as needed. 2. Click Submit. A confirmation message is displayed with an AB Workspace Batch ID. 3. Click Continue to proceed to the Select Assays page. (Optional) Save the sequence information in a file After you check the format, you can save the sequence information in a *.txt file. 1. Click Save File. 2. In the Save File dialog box, select a location for the file, enter a file name, then click Save. Custom TaqMan Assays Design and Ordering Guide 55

A Appendix A Order Other TaqMan Assays Search for Pre-designed TaqMan Gene Expression Assays Search for Pre-designed TaqMan Gene Expression Assays Search the Applied Biosystems database for pre-designed Inventoried or Made-to- Order TaqMan Assays. Access the Custom TaqMan Assay Design Tool 1. Go to the Custom TaqMan Assay Design Tool web site: www.appliedbiosystems.com/cadt OR Go to www.appliedbiosystems.com, navigate to the Custom TaqMan Assay Design Tool, place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. 2. Click Search For Pre-designed TaqMan Gene Expression Assays. 56 Custom TaqMan Assays Design and Ordering Guide

APPENDIX B B Bioinformatics Tools for Evaluating Target Sequences This appendix gives detailed instructions for bioinformatics tools available for evaluating target sequences, as described earlier in this protocol. The following steps are covered: Verifying sequence uniqueness with a BLAST database search Finding exon information using the Entrez Gene database Finding exon information using the manually curated Vertebrate Genome Annotation database Masking sequence repeats Detecting and Masking nontarget sequence polymorphisms found in dbsnp Note: See Bioinformatic Evaluation of a Sequence for Custom TaqMan Gene Expression Assays (PN 4371002) or Bioinformatic Evaluation of a Sequence for Custom TaqMan SNP Genotyping Assays (PN 4371003) for a complete discussion of the bioinformatics analysis and techniques required for Custom TaqMan Assay design. Custom TaqMan Assays Design and Ordering Guide 57

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Verify sequence uniqueness with a BLAST database search Objectives for a BLAST database search Whether you have sequenced your target or obtained the sequence from a sequence database, you need to determine: If unique primers and probes can be generated for the sequence. Homologs in gene families can present a problem, as can orthologous sequences when you work in a transgenic system. If there are polymorphisms in the sequence of interest. To verify uniqueness, you search for regions of sequence similarity between the target sequences and databases of known sequences. To make your assay as specific as possible, you can mask regions of similarity before submitting your sequence for design, so they are not considered in the assay design. You can use BLAST, a sequence comparison algorithm and database searching program to search the NCBI nucleic acid and protein public databases. Run a BLAST database search 1. Go to www.ncbi.nlm.nih.gov/blast and follow the instructions on the BLAST home page. Instructions on how to use the software are posted on the website. 2. Select nucleotide BLAST (blastn) to access the BLAST database search page. 3. In the Enter Query Sequence field on the BLAST database search page, enter the sequence in any of three formats: FASTA format >, followed by one description line, with the sequence on the following line Text-only sequence No numbers or nonsequence text Sequence identifiers Accession number, accession.version number, gi numbers or others For more information about these formats, go to: www.ncbi.nlm.nih.gov/blast/ html/search.html 4. Choose the appropriate database to search. For Gene Expression assays, if you search with a cdna sequence, search the default Human genomic + transcript database for human assays.for other species, click Others and specify the appropriate database. For SNP assays, search the default Human genomic + transcript database for human assays.for other species, click Others and specify the appropriate database. 58 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search B 5. In the Algorithm parameters section, you can: Filter species-specific repeats from a dropdown menu. Filter and mask low-complexity regions. Enter the query sequence Select a database Filter low-complexity regions and species-specific repeats Select masking 6. Click to submit your search. 7. Click Formatting Options. Wait for the results to be displayed. Custom TaqMan Assays Design and Ordering Guide 59

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Evaluating BLAST database results There are three parts to BLAST database search results: Graphical overview List of matching sequences Sequence alignments Graphical overview The graphical overview is a graphical representation of the database sequences that align to your query sequence, with the query sequence represented by the thick red numbered line at the top of the graph. Figure 1 Graphical representation of BLAST database search results 60 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search B List of matching sequences Matching sequences are listed from best to worst score. The top match is the best hit (which may be the sequence with which you queried the database). The link to the left of the sequence name opens the GenBank record for the sequence. This record contains the complete sequence, species information, journal references, feature descriptions, and other information. The Score indicates the degree of similarity between your sequence and the sequence to which it is being aligned. The higher the score is, the more similar the sequences are. Figure 2 List of matching sequences in the results of a BLAST database search (shortened for display purposes) Each sequence alignment also has an E (Expect) value. The E value represents the number of hits you can expect to find by chance when searching a database of a particular size. The lower the E value, the more significant the match. Look for matches with E values of less than ~0.1; matches with larger E values can be ignored. You can go to the sequence alignment by clicking the Score link. Custom TaqMan Assays Design and Ordering Guide 61

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Sequence alignments This section shows the alignments between your query sequence (Query) and each sequence (Sbjct) in the list of hits. You can use these alignments to help assess the degree of similarity. The Score and Expect values are displayed underneath the sequence identifiers. The number of bases aligned, percent identity, and the strand that was aligned to your query sequence and the database hit are shown. Figure 3 Individual sequence alignment from the results of a BLAST database search 62 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon-exon boundaries (gene expression assays only) B Find exon-exon boundaries (gene expression assays only) For gene expression assays, you may use the exon-exon boundaries as the target position(s) in your submission file. Using the exon-exon boundaries as the target position excludes the detection of genomic DNA by the assay. For instructions on searching for exon-exon boundaries in the: Entrez Gene database, see the next section, Find exon information using the Entrez Gene database. Genome Annotation database, see Find exon information using the Vertebrate Genome Annotation Database on page 66. Find exon information using the Entrez Gene database Entrez Gene is a searchable database of genes, from RefSeq genomes, defined by sequence and/or located in the NCBI Map Viewer. 1. Go to www.ncbi.nlm.nih.gov/entrez. 2. In the list of available databases, click Gene. 3. In the Entrez Gene page, enter a gene name, symbol, or keyword, then click Go. Custom TaqMan Assays Design and Ordering Guide 63

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon-exon boundaries (gene expression assays only) 4. In the results list, click the gene name. 5. In the display list, select Gene Table. 64 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon-exon boundaries (gene expression assays only) B 6. Scroll to view the exon information, which includes the exon start and stop bases for the gene sequence. 7. From the exon-exon boundaries, select target positions. After you select one or more target positions, identify and mask any repeats ( Mask sequence repeats on page 69) and polymorphisms ( Detect and mask nontarget sequence polymorphisms on page 73). Custom TaqMan Assays Design and Ordering Guide 65

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon information using the Vertebrate Genome Annotation Database Find exon information using the Vertebrate Genome Annotation Database Search the Vertebrate Genome Annotation Database The Vertebrate Genome Annotation (Vega) is part of the Ensembl project. The Vega database is a collection of manually curated gene sequences. It includes information about exon locations. 1. Go to vega.sanger.ac.uk 2. Select human, mouse, dog, or zebra fish as the species of interest. 3. At the top-right corner of the web page, in the field next to the Find dropdown list, enter a gene identifier, such as gene name, gene ID, or accession number, then click. 4. When the results are returned, click the link for the gene of interest. Information about the gene is displayed in a table in the Curated Locus Report. 66 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon information using the Vertebrate Genome Annotation Database B 5. In the Curated Locus Report, click Transcript info for the sequence of interest. In the Vega Transcript Report, the cdna sequence is displayed with the exons shown in alternating blue and black text. Custom TaqMan Assays Design and Ordering Guide 67

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon information using the Vertebrate Genome Annotation Database 6. From Show the following features, select one or more target positions (for gene expression assays), then click. 7. After you select targets, identify and mask any repeats and polymorphisms in your sequence (see the next section Mask sequence repeats ) and Detect and mask nontarget sequence polymorphisms on page 73). 68 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats B Mask sequence repeats RepeatMasker is a program that screens DNA sequences for interspersed repeats and low-complexity. The output is a detailed annotation of the repeats in the query sequence as well as a modified version of the query sequence in which all the annotated repeats have been masked. Sequence format requirements You can enter one sequence at a time or multiple sequences (in a batch). The format for the sequence should be: Note: FASTA format >, followed by one description line, with the sequence on the following line. RepeatMasker does not allow SNPs marked with brackets. If your sequence has SNPs, you must remove the brackets and convert the bases to the corresponding IUPAC ambiguity code before submitting the sequence to search. Procedure 1. Go to www.repeatmasker.org, then under Services, click RepeatMasking. Custom TaqMan Assays Design and Ordering Guide 69

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats 2. In the web page that appears, enter your sequence into the form on the web page by: Copying and pasting your sequence. or Uploading it from a file. 3. Select the appropriate source of your DNA from the DNA source list. Note: The default genome library is Human. Because interspersed repeats are species-specific, be sure to select the appropriate repeat library to search. 4. To display the results of the search in your web browser, select html for Return Format and Return Method. 5. Click Submit Sequence. Evaluate RepeatMasker results The RepeatMasker results are displayed as: A summary of the types of repeats found A table annotating the masked sequences The masked sequence Note: The results shown below are from the Web service RepeatMasker. 70 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats B Examples of summary of the types of repeats found Example of a table annotating the masked sequences Custom TaqMan Assays Design and Ordering Guide 71

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats The masked sequence The search returns the submitted sequence with all low-complexity sequences replaced with Ns, so that the returned sequence is the same length as the original. Figure 4 Masked sequence from the RepeatMasker Masked File You can copy the masked sequence directly from the results and use it for other searches or paste the masked sequence into the Custom TaqMan Assay Design Tool or into File Builder software. 72 Custom TaqMan Assays Design and Ordering Guide

Appendix B Bioinformatics Tools for Evaluating Target Sequences Detect and mask nontarget sequence polymorphisms B Detect and mask nontarget sequence polymorphisms The dbsnp database is one of many repositories for both single-base nucleotide substitutions and short-deletion and insertion polymorphisms in human DNA. You can detect nontarget SNPs in your sequence by running a BLAST search against the dbsnp database. To search for sequence polymorphisms in dbsnp: 1. Go to: www.ncbi.nlm.nih.gov/snp/snp_blastbyorg.cgi 2. In the Program dropdown list, select blastn. 3. For Use Megablast, select Yes. 4. Choose the appropriate species. 5. In the query field, enter the masked sequence from RepeatMasker, in FASTA format. 6. Click Submit Query. 7. In the page that opens, specify the options for formatting your results. 8. Click View Report, then wait for the results to appear. Custom TaqMan Assays Design and Ordering Guide 73

B Appendix B Bioinformatics Tools for Evaluating Target Sequences Detect and mask nontarget sequence polymorphisms Evaluating dbsnp BLAST database results The output is similar to BLAST database results described in Evaluating BLAST database results on page 60: a graphical display of matches to the query sequence, a list of sequences producing significant alignments to your query, and the actual sequence alignments. The alignments from dbsnp are slightly different from those in the previous BLAST database search. In the dbsnp results, the matching bases in the sequence from the database are not shown. Only the mismatching bases or gaps are shown, in red text. Figure 5 Sequence alignment output from a BLAST database search of the dbsnp database Look for mismatches in the alignments to identify documented SNPs. Mask these SNPs in your target sequence by changing the bases to N so that no primer or probe is designed using the SNPs. If the mismatching bases in the sequence from the database ( Sbjct ) are A, C, G, T or N, the mismatch is simply a sequence mismatch, not a documented SNP. 74 Custom TaqMan Assays Design and Ordering Guide

APPENDIX C C Using File Builder Software Overview About File Builder Software After qualifying your sequence of interest, you can format the sequence information in a submission file. When the submission file is formatted correctly, the Custom TaqMan Assays Design Pipeline can use the file to design the applicable primers and probes. File Builder software has a wizard that guides you through the process of creating a submission file, minimizing your effort and ensuring that the file is correctly formatted. Workflow Using File Builder Software in the design and ordering process involves these procedures: 1. Create the submission file (page 76). 2. Validate the format (page 77). 3. Send the file to Applied Biosystems: Import the file into the Custom Assay Design Tool (page 80). Send the file using File Builder software (page 80). Email the file (page 81). or Send a copy of the file by regular or express mail (page 82). Custom TaqMan Assays Design and Ordering Guide 75

C Appendix C Using File Builder Software Create the submission file Create the submission file Obtain File Builder software Applied Biosystems supplies free software that helps you prepare and format your submission file and submit your order. To obtain File Builder software for Macintosh or Windows operating systems: 1. Go to www.appliedbiosystems.com/filebuilder. 2. In the Software column, click the icon for the type of computer you are using, either PC or MAC. 3. After you save the software to your computer, double-click the File Builder icon and follow the instructions to install the program. Create the submission file 1. Start the File Builder software. 2. In the File Builder main menu, click Build New File using the Wizard, then follow the Wizard to create, validate, and save your submission file. 76 Custom TaqMan Assays Design and Ordering Guide

Appendix C Using File Builder Software Validate the format C Validate the format Validate the format If you created your submission file manually without using the File Builder Software, verify that your file is correctly formatted before you send it. 1. Start the File Builder software. 2. In the File Builder main menu, select Open/Validate an Existing File. Submission file contents Each submission file that you create must have: A header line One or more sequence record lines Submission file examples Example for SNP genotyping submission files Sequence records In the examples below, the header line and sequence records are labeled and the sequences are shortened for display purposes. Header line SNP target site >John Smith 999 786 5432 part number 4332072 smith@yoursnp.com seq_00001 AGT...GAA[A/G]CGGATAAGTGCACTC[G/T]CTG...ACC 1=s33g,2=s33t seq_00001 AGT...GAACGAGATAGGAAGCAAC[TC/CT]GAAT...CCC 1=sn1f seq_00002 GAG...TGGAGCAACA[TAGC/*]GCTTTCCGCAATT...TAC 1=34d Sequence name Indel site Sequence MNP site Target Example for gene expression submission files Sequence records Header line >John Smith 999 786 5432 part number 4332079 smith@yourgx.com seq_000004 AGT...GAACGAGATAGGCAGCTCCTGCCCCATCC...AAG 13=m13,20=txyz seq_000005 TTA...CGGCCCTGAGGGGGACGAATCGAGTATCATTT...TCT 15=tryk seq_000005 TTA...CGGCCCTGAGGGGGACGAATCGAGTATCATTT...TCT ANY=ANY Sequence name Sequence Target Custom TaqMan Assays Design and Ordering Guide 77

C Appendix C Using File Builder Software Validate the format Submission file format requirements The table below shows the format requirements for each element of a submission file. IMPORTANT! If the submission file is not formatted properly, the Custom TaqMan Assays Design Pipeline cannot process your order. Table 1 Submission file format requirements File Element Header line Each sequence record Each sequence name Each sequence Format requirements Contains: A header line A sequence record for each assay Sequences for only one part number (only SNP assays or gene expression assays and only one scale) Is the first line of the file. Starts with a greater-than symbol (>). Has a name, a telephone number, one part number, and an email address. Has no more than 255 characters. Has no letters with diacritics, such as umlauts or accents. Ends with a carriage return. Exists as a single line. Has a sequence name, a sequence, and at least one target. Has only two spaces: one after the sequence name and one after the sequence. Has no spaces within the record name, sequence, or target. Ends with a carriage return. Has no more than 10 characters. Uses only alphanumeric, underscore, hyphen, and period characters. Has no spaces or tabs. Does not begin with a hyphen. Is presented in the 5 to 3 orientation. Has 61 to 5000 characters for gene expression sequences and 100 to 5000 characters for SNP assay sequences (at least 40 bases on either side of the SNP). Has no line numbering, spaces, tabs, or line breaks. Consists of only the characters A, C, G, T, or N, except where SNP or indel target sites are marked. 78 Custom TaqMan Assays Design and Ordering Guide

Appendix C Using File Builder Software Validate the format C Element Each sequence (SNP genotyping assays) Each target (gene expression assays) Each SNP (SNP genotyping assays) Submission file Format requirements SNP target site of interest: Is marked with square brackets. Has the bases for two alleles of the SNP, separated by a forward slash. MNP target site of interest: Is marked with square brackets. Has 1 to 6 bases to the left of the forward slash and 1 to 6 bases to the right of the forward slash. (The number of bases on each side of the slash does not have to be the same.) Indel target site of interest: Is marked with square brackets. Has 1 to 6 bases to the left of a forward slash and an asterisk to the right of the forward slash. Targets listed in 5' to 3' order if multiple targets are present. Has: A target position, equals sign, and target site name A target position that indicates the base position of the target site from the 5 end A target site name with no more than four alphanumeric characters Commas to separate multiple targets No spaces or tabs No Ns within five bases of the target position Targets listed in 5' to 3' order if multiple targets are present IMPORTANT! At least one target is included in each sequence record. For sequences without specific target sites, you can use any for the target position and target name and the Custom TaqMan Assays Design Pipeline will design the assay. Has: A SNP number, equals sign, and name A target position that indicates the order of the SNP target site from the 5 end A SNP name with no more than four alphanumeric characters Commas to separate multiple sites Its sequence presented in 5 to 3 order No spaces or tabs No Ns within two bases of the SNP No other SNPs within two bases Is saved as a text-only document. Has the extension.txt. Has a file name with no more than 12 alphanumeric characters. Custom TaqMan Assays Design and Ordering Guide 79

C Appendix C Using File Builder Software Send the sequence information to Applied Biosystems Send the sequence information to Applied Biosystems Ways to submit the file After you create your submission file and verify that it is formatted properly, send the submission file to Applied Biosystems: Import the file into the Custom TaqMan Assay Design Tool. Send the file using File Builder software. Email the file to Applied Biosystems. or Send a copy of the file via regular or express mail. Note: For volume discounts and predefined purchasing agreements, speak with your Applied Biosystems sales representative before submitting your order. Import the file into the Custom Assay Design Tool You can import the sequence information from the submission file into the Custom TaqMan Assay Design Tool. Using the tool, you can submit the imported sequence information for custom designs. To use the Custom TaqMan Assay Design Tool: See page 20 for Custom TaqMan SNP Genotyping Assays. See page 33 for Custom TaqMan Gene Expression Assays. Send the file using File Builder software You can use File Builder software to submit the file and place an order over the internet. You must have an account at the Applied Biosystems Store to place an order. For your convenience, the File Builder Software contains a link to the Applied Biosystems web site where you can create an account. 1. After you save your file in File Builder software, click Add Current File to Shopping Basket. 2. In the Applied Biosystems Store dialog box, enter your User ID and Password, then click OK to start the file upload and place the order in your shopping basket: 80 Custom TaqMan Assays Design and Ordering Guide