Chapter 3 The Wonders of Gene Technology

Similar documents
Nucleotides and Nucleic Acids

Translation Study Guide

Transcription and Translation of DNA

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Replication Study Guide

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure enzymes control cell chemistry ( metabolism )

Chapter 11: Molecular Structure of DNA and RNA

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

STRUCTURES OF NUCLEIC ACIDS

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

Structure and Function of DNA

PRACTICE TEST QUESTIONS

DNA. Discovery of the DNA double helix

DNA, RNA, Protein synthesis, and Mutations. Chapters

Proteins and Nucleic Acids

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

RNA & Protein Synthesis

Genetics Module B, Anchor 3

Name: Date: Period: DNA Unit: DNA Webquest

13.2 Ribosomes & Protein Synthesis

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

DNA and RNA are long linear polymers, called nucleic acids, that carry. DNA, RNA, and the Flow of Genetic Information CHAPTER 4

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

Basic Concepts of DNA, Proteins, Genes and Genomes

Page 1. Name:

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

Academic Nucleic Acids and Protein Synthesis Test

CCR Biology - Chapter 8 Practice Test - Summer 2012

To be able to describe polypeptide synthesis including transcription and splicing

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

Sample Questions for Exam 3

The Steps. 1. Transcription. 2. Transferal. 3. Translation

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Protein Synthesis How Genes Become Constituent Molecules

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

Genetics Test Biology I

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

1.5 page 3 DNA Replication S. Preston 1

Chapter 5: The Structure and Function of Large Biological Molecules

The Molecules of Cells

NO CALCULATORS OR CELL PHONES ALLOWED

Lab # 12: DNA and RNA

Chapter 6 DNA Replication

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

From DNA to Protein

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

RNA and Protein Synthesis

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

DNA: Structure and Replication

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

NAME. EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12. V. / 10(grads) TOTAL /100 or 110

DNA Replication in Prokaryotes

Recombinant DNA and Biotechnology

Control of Gene Expression

Biology Final Exam Study Guide: Semester 2

Cellular Respiration Worksheet What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Bio 102 Practice Problems Chromosomes and DNA Replication

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Forensic DNA Testing Terminology

European Medicines Agency

I. Chapter 5 Summary. II. Nucleotides & Nucleic Acids. III. Lipids

Biotechnology: DNA Technology & Genomics

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

Problem Set 3 KEY

12.1 The Role of DNA in Heredity

How To Understand The Chemistry Of Organic Molecules

Chapter 14 Lecture Notes: Nucleic Acids

Chapter 5. The Structure and Function of Macromolecule s

DNA Paper Model Activity Level: Grade 6-8

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport.

Biological molecules:

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, b.patel@griffith.edu.

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)

GENE REGULATION. Teacher Packet

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

13.4 Gene Regulation and Expression

BCH401G Lecture 39 Andres

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Chapter 17: From Gene to Protein

TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS

MOLECULAR BASIS OF INHERITANCE

Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Biochemistry of Cells

BIOMOLECULES. reflect

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET

The DNA Discovery Kit The Guided Discovery Approach & Teacher Notes

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Transcription:

Chapter 3 The Wonders of Gene Technology Sergey B. Zotchev Chapter Outline DNA, RNA and genes Gene expression and protein synthesis Recombinant DNA and gene cloning Biotechnological application of recombinant DNA technology 1

Discovery of DNA DNA (deoxyribonucleic acid) discovered in 1869 Chemical composition of DNA determined in 1882-1897 DNA shown to be a carrier of genetic information in 1928-1944 Double helix structure of DNA suggested in 1953 Grifith experiment: a chemical carries hereditary information 2

Avery experiment: DNA is a carrier of hereditary information DNA organisation in the prokaryotic cells 3

In eukaryotic cells DNA is located in the nucleus and mitochondria/chloroplasts 4

DNA and RNA molecules contain different bases Only in RNA Only in DNA (deoxy) ribose linked to a base is called nucleoside RNA nucleoside units: adenosine guanosine cytidine uridine DNA nucleoside units: deoxyadenosine deoxyguanosine deoxycytidine thymidine Nucleoside joined to one or more phosphate groups is called nucleotide 5

Both DNA and RNA are polymers deoxyribose ribose Nucleotides on DNA and RNA are linked through the phosphodiester bonds Polynucleotide chain (DNA or RNA strand) has a directionality (5 -> 3 ) Nucleic acid strand has individuality determined by the sequence of its bases (nucleotide sequence) Nucleotide sequence is also called the primary structure of this particular nucleic acid 6

DNA is a double-stranded molecule Base pairing between two DNA strands is due to hydrogen bonds formation 7

DNA strands are antiparallel and complimentary 5 3 3 5 Watson and Crick: The Structure of DNA (1953) Nucleotides are linked in a chain through sugar-phosphate interactions DNA molecules are made of two chains of nucleotides wound around each other in a helix Base pairs hold the chains together A pairs with T G pairs with C 8

DNA Replication DNA Replication Based on the complementary nature of the two strands of duplex DNA molecules. When the two parental strands are separated, the separated strands can serve as templates for the synthesis of new strands. New strands are assembled by incorporating nucleotides according to base-pairing rules. In the process of replication, each template strand is paired with a newly synthesized partner strand. DNA replication is catalyzed by enzymes. 9

Major differences between RNA and DNA The sugar moiety of the RNA nucleotides is represented by ribose (deoxyribose in DNA) Uracyl rather than thymine represents one of the pyrimidine bases on RNA On some RNA molecules bases are often modified by methylases, thiolases and deaminases (only methylation shown for DNA) RNA is a single-stranded molecule (DNA - double helix) Base-pairing rule for RNA: A = U G = C 10

RNA molecules can form very elaborate secondary structures a b c d f e DNA serves as a template for RNA synthesis in the process called transcription Nucleotide sequence (individuality) of RNA is specified by the sequence of the DNA strand that was used as a template for RNA synthesis 11

Transcription: copying of genetic information from DNA to RNA RNA 5 - UUUGGACAACGUCCAGCGAUC - 3 5 - TTTGGACAACGTCCAGCGATC - 3 3 - AAACCTGTTGCAGGTCGCTAG - 5 DNA Coding (+) strand Template (-) strand Transcription unit Initiation of transcription Termination of transcription 12

Gene Expression During transcription, an RNA molecule is synthesized from a DNA template. This messenger RNA (mrna) molecule contains the information needed to synthesize a polypeptide. During translation, the triplet codons in the RNA specify the incorporation of particular amino acids into a polypeptide chain. The Central Dogma of Molecular Biology The flow of information is DNA RNA protein. Some viruses can use RNA as a template for the synthesis of DNA in reverse transcription. Many genes do not encode polypeptides; their endproducts are RNA molecules. 13

The genetic code is a coding dictionary that specifies a meaning for each nucleotide sequence Four bases in DNA: A, G, T, C Twenty amino acids Minimal base combination: three 14

Transcription bubble Translation 15

Protein synthesis in prokaryotes and eukaryotes DNA recombination: exchange of genetic material between two DNA molecules Recombination is most efficient between DNA molecules with highly similar nucleotide sequences 16

Plasmids and recombinant DNA technology Restriction endonuclease Using recombinant DNA technology to clone genes 17

Production of insulin in human cells Production of insulin in human cells 18

Cloning genes from eukaryotes How to select recombinant bacteria? 19

Cloning of rat proinsulin gene Somatostatin from the synthetic gene 20

Production of human insulin in E. coli Purification of insulin by affinity chromatography 21

Gene modification in mammalian cells What you need to know for the exam What are DNA and RNA, their functions and differences between them What is the genetic code and how it is realized (DNA- >RNA->protein), organization of a typical gene (promotercoding sequence-terminator); Plasmids and recombinant DNA technology based on restriction endonucleases; How to clone a eukaryotic (e.g. mammalian) gene; How to identify recombinant bacterium carrying desired gene (DNA hybridization); How to purify recombinant protein (enzyme) using affinity chromatography General scheme for engineering of mammalian cells for production of complex proteins 22