Chapter 3 The Wonders of Gene Technology Sergey B. Zotchev Chapter Outline DNA, RNA and genes Gene expression and protein synthesis Recombinant DNA and gene cloning Biotechnological application of recombinant DNA technology 1
Discovery of DNA DNA (deoxyribonucleic acid) discovered in 1869 Chemical composition of DNA determined in 1882-1897 DNA shown to be a carrier of genetic information in 1928-1944 Double helix structure of DNA suggested in 1953 Grifith experiment: a chemical carries hereditary information 2
Avery experiment: DNA is a carrier of hereditary information DNA organisation in the prokaryotic cells 3
In eukaryotic cells DNA is located in the nucleus and mitochondria/chloroplasts 4
DNA and RNA molecules contain different bases Only in RNA Only in DNA (deoxy) ribose linked to a base is called nucleoside RNA nucleoside units: adenosine guanosine cytidine uridine DNA nucleoside units: deoxyadenosine deoxyguanosine deoxycytidine thymidine Nucleoside joined to one or more phosphate groups is called nucleotide 5
Both DNA and RNA are polymers deoxyribose ribose Nucleotides on DNA and RNA are linked through the phosphodiester bonds Polynucleotide chain (DNA or RNA strand) has a directionality (5 -> 3 ) Nucleic acid strand has individuality determined by the sequence of its bases (nucleotide sequence) Nucleotide sequence is also called the primary structure of this particular nucleic acid 6
DNA is a double-stranded molecule Base pairing between two DNA strands is due to hydrogen bonds formation 7
DNA strands are antiparallel and complimentary 5 3 3 5 Watson and Crick: The Structure of DNA (1953) Nucleotides are linked in a chain through sugar-phosphate interactions DNA molecules are made of two chains of nucleotides wound around each other in a helix Base pairs hold the chains together A pairs with T G pairs with C 8
DNA Replication DNA Replication Based on the complementary nature of the two strands of duplex DNA molecules. When the two parental strands are separated, the separated strands can serve as templates for the synthesis of new strands. New strands are assembled by incorporating nucleotides according to base-pairing rules. In the process of replication, each template strand is paired with a newly synthesized partner strand. DNA replication is catalyzed by enzymes. 9
Major differences between RNA and DNA The sugar moiety of the RNA nucleotides is represented by ribose (deoxyribose in DNA) Uracyl rather than thymine represents one of the pyrimidine bases on RNA On some RNA molecules bases are often modified by methylases, thiolases and deaminases (only methylation shown for DNA) RNA is a single-stranded molecule (DNA - double helix) Base-pairing rule for RNA: A = U G = C 10
RNA molecules can form very elaborate secondary structures a b c d f e DNA serves as a template for RNA synthesis in the process called transcription Nucleotide sequence (individuality) of RNA is specified by the sequence of the DNA strand that was used as a template for RNA synthesis 11
Transcription: copying of genetic information from DNA to RNA RNA 5 - UUUGGACAACGUCCAGCGAUC - 3 5 - TTTGGACAACGTCCAGCGATC - 3 3 - AAACCTGTTGCAGGTCGCTAG - 5 DNA Coding (+) strand Template (-) strand Transcription unit Initiation of transcription Termination of transcription 12
Gene Expression During transcription, an RNA molecule is synthesized from a DNA template. This messenger RNA (mrna) molecule contains the information needed to synthesize a polypeptide. During translation, the triplet codons in the RNA specify the incorporation of particular amino acids into a polypeptide chain. The Central Dogma of Molecular Biology The flow of information is DNA RNA protein. Some viruses can use RNA as a template for the synthesis of DNA in reverse transcription. Many genes do not encode polypeptides; their endproducts are RNA molecules. 13
The genetic code is a coding dictionary that specifies a meaning for each nucleotide sequence Four bases in DNA: A, G, T, C Twenty amino acids Minimal base combination: three 14
Transcription bubble Translation 15
Protein synthesis in prokaryotes and eukaryotes DNA recombination: exchange of genetic material between two DNA molecules Recombination is most efficient between DNA molecules with highly similar nucleotide sequences 16
Plasmids and recombinant DNA technology Restriction endonuclease Using recombinant DNA technology to clone genes 17
Production of insulin in human cells Production of insulin in human cells 18
Cloning genes from eukaryotes How to select recombinant bacteria? 19
Cloning of rat proinsulin gene Somatostatin from the synthetic gene 20
Production of human insulin in E. coli Purification of insulin by affinity chromatography 21
Gene modification in mammalian cells What you need to know for the exam What are DNA and RNA, their functions and differences between them What is the genetic code and how it is realized (DNA- >RNA->protein), organization of a typical gene (promotercoding sequence-terminator); Plasmids and recombinant DNA technology based on restriction endonucleases; How to clone a eukaryotic (e.g. mammalian) gene; How to identify recombinant bacterium carrying desired gene (DNA hybridization); How to purify recombinant protein (enzyme) using affinity chromatography General scheme for engineering of mammalian cells for production of complex proteins 22