Molecular Diagnosis of Gastrointestinal Tumors



Similar documents
Microsatellite Instability (MSI) A New Paradigm in Cancer Treatment. Lynch Syndrome OUTLINE. GI Molecular Pathology

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN

Corporate Medical Policy

Nuevas tecnologías basadas en biomarcadores para oncología

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:

Neoplasia gastrica cistica: GIST o leiomiosarcoma? Sebastiano Cacciaguerra U. O. Chirurgia Pediatrica Ospedale Garibaldi Catania

The following information is only meant for people who have been diagnosed with advanced non-small cell

What is New in Oncology. Michael J Messino, MD Cancer Care of WNC An affiliate of Mission hospitals

Genetic Testing for Lynch Syndrome/Colorectal Cancer and Polyposis Syndromes

Molecular analyses of EGFR: mutation and amplification detection

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities

A disease of populations of cells that live, divide, invade and spread without regard to normal limits

Targeted Therapy What the Surgeon Needs to Know

Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D.

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a

Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System

Dal germinale al somatico nella identificazione di tumori ereditari

Common Cancers & Hereditary Syndromes

Come è cambiata la storia naturale della malattia

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma

Frequently Asked Questions About Ovarian Cancer

Validation parameters: An introduction to measures of

Contents. molecular biology techniques. - Mutations in Factor II. - Mutations in MTHFR gene. - Breast cencer genes. - p53 and breast cancer

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials)

Genetic Testing for Familial Adenomatous Polyposis and MYH-Associated Polyposis (Lynch Syndrome)

FARMACI PERSONALIZZATI PER

Overview of testing for Lynch syndrome/hnpcc

targeted therapy a guide for the patient

Sahlgrenska universitetssjukhuset

Prevalenza delle mutazioni TMEM127 nel feocromocitoma sporadico

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America

Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART

Targeted Therapies in Lung Cancer

Pancreatic Cancer: FDA Approved Treatments and Clinical Trials

Successes and Limitations of Targeted Cancer Therapy in Lung Cancer

PNA BRAF Mutation Detection Kit

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE

The Hereditary Colorectal Cancer Website has been sponsored by the Robert Rauschenberg Foundation

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.

Lung Cancer Research: From Prevention to Cure!

HER2 Status: What is the Difference Between Breast and Gastric Cancer?

Accurate and sensitive mutation detection and quantitation using TaqMan Mutation Detection Assays for disease research

Opportunities and Challenges in Translating Novel Discoveries into Useful Clinical Tests

High-quality genomic DNA isolation and sensitive mutation analysis

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Future Oncology: Technology, Products, Market and Service Opportunities

Lung Carcinomas New 2015 WHO Classification. Spasenija Savic Pathology

HER2 Testing in Gastric and Esophageal Adenocarcinoma: Emerging Therapeutic Options and Diagnostic Challenges

Cellular, Molecular, and Biochemical Targets in Breast Cancer

HER2 Testing in Breast Cancer

EGFR mutation testing: what is the best choice?

Molecular Diagnostics in Thyroid Cancer

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved

GENETIC TESTING FOR INHERITED MUTATIONS OR SUSCEPTIBILITY TO CANCER OR OTHER CONDITIONS MED

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer

Genomic Clinical Trials: NCI Initiatives

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

BioBoot Camp Genetics

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Notch 1 -dependent regulation of cell fate in colorectal cancer

Successes and Limitations of Targeted Therapies in Renal Cell Carcinoma

Targeted Therapy in an Era of Genomic Medicine. George W. Sledge MD Stanford University

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer

Hosts. New Methods for Treating Colorectal Cancer

LECTURE 6 Gene Mutation (Chapter )

SECOND PRIMARY BREAST CANCERS FOLLOWING HAEMATOLOGIC MALIGNANCIES A CASE SERIES STUDY FARAH TANVEER PGY 3 DR.MEIR WETZLER DR.

Update on Mesothelioma

New strategies in anticancer therapy

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

treatments) worked by killing cancerous cells using chemo or radiotherapy. While these techniques can

Gene mutation and molecular medicine Chapter 15

GENETIC CONSIDERATIONS IN CANCER TREATMENT AND SURVIVORSHIP

Using genetic biomarkers to pre-identify oncology patients for clinical trials

Cancer: DNA Synthesis, Mitosis, and Meiosis

MRC-Holland MLPA. Description version 12;

LightCycler 480 Real-Time PCR System. High Resolution Melting: Optimization Strategies. Technical Note No. 1

Diagnostics and Personalised Healthcare

Molekylært målrettet medicinsk kræftbehandling for klinikere principper og metoder

COMMISSIONING. for ULTRA-RADICAL SURGERY ADVANCED OVARIAN CANCER

Update in Hematology Oncology Targeted Therapies. Mark Holguin

The EGFR mutation and precision therapy for lung cancer

Cetuximab (Erbitux) MM /10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient

Understanding series. new. directions LungCancerAlliance.org. A guide for the patient

Transcription:

Molecular Diagnosis of Gastrointestinal Tumors Zoltan Szentirmay National Institute of Oncology Center of Surgical and Molecular Tumor Pathology EEA and Norwegian Financial Mechanisms in Hungary, Development of joint Hungarian and Norwegian strategy for cancer treatment by molecular methods. (Prevention, early diagnosis and therapy)

Colorectal cancers

Patients and Methods Totally 634 surgically resected colorectal cancer samples. Database construction. Isolation of DNA form FFPE tumor samples by the assistance of MagNa Pure Compact machine. PCR-based microsatellite instability test according to Dietmaier and Hofstadter (Lab. Invest., 81:1453-1456, 2001). Real-time PCR amplification and melting point analysis of KRAS exon 2 and BRAF exon 15 gene regions. DNA sequence analysis of amplicons.

Five-year Survivig Rate of Gastic and Colorectal Cancer Based on the National Cancer Registry % 100 80 Canada Italy Norway Finland Hungary Kanada Olaszország Norvégia Finnország Magyarország 60 40 20 0 Gastric Gyomorrák cancer Colorectal Vastagbélrák cancer Tusnády G, Gaudi I, Rejtő L, Kásler M és Szentirmay Z: Survival chances of Hungarian cancer patients in the National Cancer Registry. Magyar Onkol., 52:339-349, 2008

Genetic classification of colorectal cancers MMR negative phenotype MMR positive phenotype Sporadic CrC develops via polypcancer sequence Hereditary nonpolyposis CrC (HNPCC) Sporadic CRC develops due to the CpG metilation of hmlh1 (CIMP+) Microsatellite stabilty (MSS) Chromosomal instability Microsatellite instability (MSI-H) Chromosomal stability

Kaplan-Meier probability survive of CrC according to the TNM-based clinical staging 1,0 0,8 Stage 1 p = 0.0000 0,6 Stage 2 0,4 Stage 3 0,2 Stage 4 0,0 Months 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168 180 192

Correlation of TNM-based clinical stage and the genotype of CrC at the time of diagnosis Clinical stage HNPCC MSI-H CIMP+ MSI-H Polyp-Cancer MSS Stage 1 + 2 (%) 69.8 66.7 38.4 Stage 3 + 4 (%) 30.2 33.3 61.6 Total 100 100 100

Kaplan-Meier probability survive of CrC according to the genotype 1,0 0,8 HNPCC 0,6 Sporadic MLH1+, MSI-H 0,4 Sproradic MSS 0,2 0,0 P = 0.0002 hónap 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168 180 192

Localization of genetically different CRCs Colorectal cancer Right halfcolon Localization % Left half-colon & rectum Total % Sporadic CIMP+ MSI-H 100.0-100 HNPCC MSI-H 65.1 34.9 100 Sporadic MSS 21.9 78.1 100 P = 0.000

Significant genetic alterations influencing the therapy response of colorectal cancers 1. KRAS or BRAF mutation inhibits the therapeutic effects of anti-egfr antibodies. 2. The 5-fluorouracil-based chemotherapy has no any effects on microsatellite instable (MSI-H) carcinoma.

EGF Ligand-dependent gene activation EGF EGF Enhanced EGFR signal PTEN KD KD KD KD EGF EGF EGF PI3K mtor PIP3 AKT angiogenesis, cell proliferation, survive Enhanced EGF sensitivity Autocrine receptor stimulation RAS BRAF MEK ERK The receptor function is blocked Anti-EGFR mab ligand 2. exon 12/13 codon or mutation 15. exon V600E (GTG GAG) uncontrolled cell proliferation KD KD KD KD There is no EGFR signal TGFß MSI p21 p27 cyclin D CDK 4/6 unregulated cell cycle

Before anti-egfr treatment After anti-egfr treatment KRAS Disease-process: In spite of the anti-egfr treatment liver metastasis developed. G12V Wt control The patient died within two years. EGFR IH

Frequency distribution of gain-of-function mutations in codon 12 and codon 13 of KRAS gene (184 tumor samples) 25 Types of mutations 20 15 10 5 0

Localization of KRAS and BRAF positive CrCs Genetical state Right halfcolon Incidence % Left half colon & rectum Total % KRAS mut 24.2 75.8 100 BRAF mut 66.7 32.3 100 P = 0.000

Frequency distribution of KRAS and BRAF mutations in hereditary and sporadic CrC CrC types KRAS mut % BRAF mut % HNPCC MSI-H 39.5 - Sporadic CIMP+, MSI-H 8.4 52.8 Sporadic MSS 45.9 4.2

Kaplan-Meier survival function of CrCs according to the KRAS mutation state 1,0 0,8 P = 0.17 0,6 KRAS mutant 0,4 0,2 0,0 KRAS wt Months 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168

Kaplan-Meier survival function of CrCs according to the BRAF mutation state 1,0 p = 0.0000 0,8 0,6 BRAF wt 0,4 BRAF mutant 0,2 0,0 Months 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168 180 192

Gastrointestinal stromal tumor (GIST)

Study Population No. of tumor samples investigated: 72 Sex: Male 38, Female 34 Patients follow up period: between 17 years and 6 mounts Age distribution: % 35 30 25 20 15 10 5 0 16-20 21-30 31-40 41-50 51-60 61-70 71-80 years

Methods Collection of formalin-fixed and paraffin-embedded tumor samples and database construction. CD117 and CD34 immunohistochemistry and pathological assessment of the tumor risk categories. Isolation of DNA form FFPE tumor samples by the assistance of MagNa Pure Compact machine. Real-time PCR amplification and melting point analysis of c-kit exon 9, exon 11, and PDGFRA exon 12 and exon 18 gene regions. High resolution capillary gel electrophoresis analysis of amplicons. High resolution melting analysis of c-kit exon 11 using LightCycler 480 PCR system to analyze genetic variations in PCR amplicons. DNA sequence analysis of amplicons.

High Resolution Melting Deletion (others) Point mut (red) Wt (blue)

C-kit exon 11 Comparison of the Mutation Analysis Methods Real-time PCR amplification and melting point analysis & sequencing High Resolution Melting Wt ********* ********* * * Wt Point mut Deletion Point mut ********* ********* Deletion ********** ********** Asterisks represent tumor samples

Localization of GIST (No = 72) Kaplan-Meier probability survival function Localization Frequency (%) Esophagus 2.8 Stomach Small Intestine Large Intestine Extra-intestinal Metastasis 48.6 26.4 11.1 6.9 4.2 1,0 0,8 0,6 0,4 0,2 0,0 Stomach Large intestine Small intestine p=0.0076 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168 180 192 204 216 month

Pathological Risk Grouping of GIST (No = 72) RISK GROUPS FREQENCY (%) Low risk GIST 40.3 High risk GIST 59.7 1,0 0,8 0,6 0,4 0,2 0,0 Kaplan-Meier probability survival function Low risk High risk p=0.0052 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168 180 192 204 216 month

Summary of Significant Genetik Alterations in GIST KIT PDGFRA Ligand-binding domain GIST, AML Extracellular domain (exon 9) GIST Juxtamembrane domain (exon 11) Imatinib (Gleevec) snsitive mut Juxtamembrane domain (exon 12) Gleevec rezistant mutations Tyrosine kinse II domain (exon 18)

Significant mutations in GIST 72 tumors Gleevec sensitive mutations, c-kit Exon 9 point m. & dupl Exon 11 del Exon 11 point mut Gleevec resistance mutation, PDGFRA Exon 18 point mut & delins Total 5 (6.9 %) 31 (43.1%) 15 (20.8 %) 8 (11.1 %) 59 (81.9%)

C-Kit exon 11 Highly Gleevec sensitive deletion mutations Types of deletion in 14 tumor samples cdna 1650 1730 ACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC A---A ACCCATGTATGAA------------------GAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACA---------TGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAGTGG------------------------GG ACCCATGTATGAAGTACAGTGG---------------------------------------------CCAACACAACTTCC ACCCATGTATGAAGTACAGTGGAAG---------------------------------------GACCCAACACAACTTCC ACCCATGTATGAAGTACAGTGGAAGGTT---------------------------------------------------CC ACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAA---CC c.1735-1737

C-Kit exon 11 Highly Gleevec sensitive point mutations Mutation pattern (14 tumors) c.1669t c.1669t c.1727t 1650 c.1666c c.1676t 1730 ACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC >T >C >C >A >A >A >A >G >C >A >A >G >C >C

C-Kit exon 9 Moderately Gleevec sensitive point mutations and SNPs 9 tumors (5 mutations, 4 SNPs) c.1357t c.1391c 1354 c.1383a c.1414c 1430 GCTTCTGTACTGCCAGTGGATGTGCAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTC >C >G snp >G snp >T snp >T c.1445c c.1486g c.1504-1509 1431 c.1497g 1509 TATAGATTCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAGACTTCTGCCTAT >A snp >A >A >GCCTAT duplication

Detection and Frequency of Gene Alterations in exon 18 of PDGFRA Detection of p.d842v mutation by real-time PCR and melting point analysis GENE ALTERATION FREQUECY % c.2525a>t (p.d842v) Delins c.2472c>t snp c.2442t>c snp c.2526c>t snp c.2538t>c snp 9.7 1.4 11.1 2.8 1.4 1.4 c.2525 A>T mut

Correlation Between the Mutation Status of c-kit exon 9 & 11 and the Metastatic Potential of GIST C-kit Metastasis Absent Present Total % Wild type 76.2 23.8 100 Exon 9 & 11 point mut 60.0 40. 0 100 Exon 11 deletion 25.8 74.2 100 Pearson chi-square P = 0.0010 The c-kit mutations promote the metastatic tendency of GIST

MP487/08, 55-year-old male with a 42x35x31 mm abdominal mass and a 22 mm in diameter nodule in the 5th segment of liver. Core biopsy from the abdominal mass and liver nodule. Primary tumor Liver metastasis KIT (CD117) KIT (CD117)

MP487/08 ckit exon 11: 35 bp deletion Mutant allele Wt allele Heterodimers Prim. Met. mut Heterodimers wt High resolution capillary gel electrophoresis

55 year-old male, at the time of diagnosis 8 moths after Gleevec treatment

Kaplan-Meier Probability Function of Gleevec Sensitive Mutation Bearing GIST Versus other Subtype of GIST 1,0 0,8 0,6 C-kit exon 9 & 11 mutant GIST (51 tumors) C-kit wt and PDGFRA resistance mutant GIST (21 tumors) 0,4 0,2 0,0 0 12 24 36 48 60 72 84 96 108 120 132 144 156 168 180 192 204 216 month