Association analysis of BANK1 gene with psoriasis in Southern Han Chinese

doi: 10.1111/j.1744-313X.2011.01045.x Association analysis of BANK1 gene with psoriasis in Southern Han Chinese X. Zhang*,1, Z. Fei,1, J. Wan, J. Xu, B. Yu & M. Guan*,, ** Summary Psoriasis is a chronic inflammatory skin disease with an immunogenetic background. This study aimed to determine the association between three functional SNPs of BANK1 (rs10516487, rs17266594 and rs3733197) with psoriasis in Southern Han Chinese population by determining their frequency in 242 patients with psoriasis and 317 healthy individuals. The genotype frequencies of the detected polymorphisms were analysed in relation to the susceptibility of psoriasis. Our data show that there is no significant difference in genotype distribution for the three BANK1 SNPs between patients and healthy controls. The AA frequency of rs3733197 is significantly higher in patients with psoriasis onset before the age of 23 than in those with late disease onset (P = 0.0069). In addition, analysis on BANK1 haplotype also suggests a protective role for TGC and CAT haplotype from psoriasis (OR 0.55, 95% CI: 0.34 0.89; P = 0.0144; OR 0.62, 95% CI: 0.42 0.92; P = 0.0175), whereas CGT haplotype is associated with increased risk of the disease (OR 1.38, * Central Laboratory, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, China, Department of Traditional Chinese medicine, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, China, Shenzhen Key Lab for Translational Medicine of Dermatology, Shenzhen-PKU-HKUST Medical Center, Shenzhen, China, Department of Dermatology, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, China, Department of Dermatology, Shenzhen Hospital Peking University, Shenzhen, China, ** Department of Laboratory Medicine, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, China Received 27 April 2011; revised 16 August 2011; accepted 15 September 2011 Correspondence: Ming Guan, Department of Laboratory Medicine, Huashan Hospital, Shanghai Medical College, Fudan University, 12 Central Urumqi Road, Shanghai, China. Tel: 0086 21 52888048; Fax: 0086 21 62481061; E-mail: guanming88@yahoo.com Bo Yu, Department of Dermatology, Shenzhen Hospital Peking University, No. 1120, Lian-Hua Road, Fu-Tian District, Shen-Zhen, Guangdong, China. Tel: 0086 755 83923333; ext 849; E-mail: yubomd@hotmail.com 1 X. Zhang and Z. Fei equally contributed to this study. 95% CI: 1.05 1.81, P = 0.0203). Overall, our result indicates that polymorphism in BANK1 is associated with susceptibility to psoriasis in Southern Han Chinese. Introduction Psoriasis is a common, chronic and inflammatory skin disease, with different kinds of immunological disorders. The typical character is described as discrete erythematous plaques covered by a silvery white scale in characteristic locations (Navarini & Trueb, 2010). Global incidence of psoriasis is 0.6 4.8%, and in China, it is 1.23&, possibly due to differences in genetic and environmental factors. Although the pathogenesis of psoriasis has been attributed to the activation of dendritic cells, T cells and keratinocytes in the psoriatic plaque (Monteleone et al., 2010), the autoantibodies are recently found to be present in psoriasis and psoriasis arthritis (Tagami et al., 1983; Leitch & Haslock, 1997; Singh & Singh, 2010), suggesting an effective role of B cells and probably their secreted signalling molecules in this disease progression. B-cell scaffold protein with ankyrin repeats 1 (BANK 1) is a B-cell-specific scaffold protein and Lyn tyrosine kinase substrate that facilitates the phosphorylation and activation of IP3R by Lyn and subsequent release of Ca 2+ from endoplasmic reticulum (Kozyrev et al., 2008). Nonsynonymous SNP rs10516487 (R61H), branch point-site SNP rs17266594 and a third variant rs3733197 (A383T) in the ankyrin domain of BANK1 are functional disease-associated variants that contribute to the susceptibility of several autoimmunity diseases, including SLE (Kozyrev et al., 2008; Chang et al., 2009), RA (Orozco et al., 2009) and systemic sclerosis (Rueda et al., 2010). Given important roles of B cells in autoimmune diseases and recent discovery of autoantibodies in psoriasis, it would be of interest to investigate the link between BANK1 polymorphisms and psoriasis in the genetic homogeneous population of Han Chinese living in Guangdong Province, aiming to define whether this gene plays a key role in the autoimmune disease. 507

508 X. Zhang et al. Materials and methods Patients The study involved 242 patients with psoriasis and 317 healthy controls. Patients with psoriasis (158 men 84 women, mean age: 34.43 ± 12.88 years) are of Han Chinese ethnics living in Guangdong Province. All patients were diagnosed to have psoriasis by at least two independent dermatologists in the dermatology department in Shenzhen Hospital Peking University. Detailed clinical records were available for all patients, including age, gender, disease onset time and family disease history. Psoriasis area severity index (PASI) was calculated for every patient. Patients were considered to have early-onset psoriasis if the onset of the disease was at any age younger than 40 years and late-onset psoriasis if the disease shows up later than age of 40. The control group comprised 317 healthy individuals selected from blood bank donors to maximize the match for age (185 men 132 women, mean age: 37.16 ± 9.88 years), gender and geographic origin. This study was approved by the Ethics Committee of Shenzhen Hospital Peking University and conducted in accordance with the declaration of Helsinki guidelines for ethics in research. All patients gave written informed consent for genetic studies. Characteristics of the study participants are shown in Table 1. PCR to reach plateau. The reagent contained the following: 0.5 U Taq HS (Takara, Shiga, Japan), 2 ll 10 PCR Buffer (Mg 2+ Free, Takara), 1.5 mm MgCl 2 (Takara), 0.2 mm dntp mixture (Takara), 0.05 lm forward primer, 0.5 lm reverse primer, 0.5 lm unlabelled probe, 0.6 ll 1 SYTO 9 dye (Invitrogen, Carlsbad, CA, USA) and 40 ng DNA were added to the mix solution and then complemented by water to 20 ll. The PCR conditions were as follows: initial denaturation at 95 C for 2 min, 50 cycles at 94 C for 30 s, 58 C (60 C for rs3733197) for 30 s and 72 C for 30 s. PCR products were heated to 95 C followed by rapid cooling to 40 C to facilitate heteroduplex formation. Melting curve analysis was performed by raising temperature from 55 to 89 C at 0.2 C s. Genotypes were identified by the melting temperatures indicated by peaks on the derivate plots. Statistical analysis The statistical analysis was performed on SHEsis online software (http://analysis.bio-x.cn/myanalysis.php). The Hardy Weinberg equilibrium of the BANK 1 polymorphism was examined by chi-square test. The differences in genotype and allele frequencies between patients and controls were also compared, and value of P < 0.05 was considered to be significant. Differences in allele frequency was quantified by odds ratios (OR) and 95% CI. BANK 1 single-nucleotide polymorphisms (SNPs) genotyping Genomic DNA was extracted from fresh peripheral blood. We selected three functional BANK1 SNPs: rs10516487 (C>T), rs3733197 (G>A) and rs17266594 (T>C). Genotyping of BANK1 SNPs was carried out by unlabelled probe high-resolution melting (HRM) assay. Probes are C3-blocked on the 3 -end to prevent extension. Sequences of primer and unlabelled probe are shown in Table 2. Unlabelled probe HRM analysis was carried out through asymmetric PCR. After asymmetric PCR, a large number of superfluous single strand will combined with unlabelled probe. As the temperature drops, it will produce two types of melting curve. The part of curve in low melting temperature (Tm) represents the region of probe and product. The asymmetric PCR requires five to ten more cycles than conventional Power calculation Power was calculated with the Generic Chi-square test module of the Java Applets for Power and Sample Size software (Lenth, 2007) (http://www.divms. uiowa.edu/~rlenth/power/) at the level of significance where a = 0.05, under the prototype data previously identified for SLE (Kozyrev et al., 2008). It was confirmed that the sample size we chose could provide sufficient power (>80%) to identify a genetic association with the three polymorphisms. Results High-resolution melting analysis with unlabelled probe High-resolution melting analysis with unlabelled C3- blocked probe was used for genotyping. The sensitivity and accuracy of HRM were dramatically improved Table 1. Characteristics of study participants Early-onset psoriasis Late-onset psoriasis Mild psoriasis <10 Moderate psoriasis 10 20 Severe psoriasis >20 Controls Total number of subjects 203 39 23 98 121 317 Men, n (%) 126 (62.1) 32 (82.1) 12 (52.2) 62 (63.3) 84 (69.4) 185 (58.4) Women, n (%) 77 (37.9) 7 (17.9) 11 (47.8) 36 (36.7) 37 (30.6) 132 (41.6) Age at enrolment (years), mean (SD) 30.5 (8.9) 55.6 (9.0) 30.8 (8.9) 33.7 (12.7) 35.6 (13.6) 37.2 (9.9) Age at onset of symptoms (years), mean (SD) 23.7 (7.1) 50.1 (8.2) 23.8 (10.8) 28.6 (11.9) 28.2 (12.5)

Association of BANK1 with psoriasis 509 Table 2. Sequences of primer and unlabelled probe SNP Primer name Sequence (5 3 ) rs10516487 Forward ACATTTGTAAGACGTTAAGTTCAGCA Reverse ATGATATATGAAGAAGATGCTGAGGA Probe GAAAAGAGAAATTCTCCAAGCGATA TAACAGGATG rs3733197 Forward GCTTCAATGTTCAGGAGCAA Reverse CAGTCTCTTCTACAATATCAAACAGAA Probe CAGACCCCGCACATATTGCTGAAAGG CATGGTCA rs17266594 Forward AGGACTTTCATAGAGTTTTTCTCTGG Reverse CATTCCTCAGCATCTTCTTCA Probe TAATAATTTAACCTGCTGATAGCATTG CAAATAT Underlined nucleotides were the locations of the SNPs detected in the assay. using unlabelled probes (Fig. 1, left part). Probes were designed to perfectly match with ancestral allele (allele C, G and T for rs10516487, rs3733197 and rs17266594, respectively). The melting temperature of probe product duplexes for the other genotype is lower than that of the matched one. Meanwhile, the heterozygosis will have these two kinds of feature. In this way, we were able to discriminate all the genotypes clearly. As shown in Fig. 1, three genotypes (CC, CT and TT) of SNP rs10516487 were accurately distinguished by the derivative melting curves in the probe region. The association of BANK1 genotype with psoriasis Figure 1. Derivative melting curve of rs10516487 by unlabelled probe melting analysis. Every melting curve has two derivative peaks at least. The one of low melting temperature represents probe product duplex melting transition. The other represents amplicon duplex melting transition. Distribution of the polymorphism was evaluated in patient and control groups. SNP frequencies were in Hardy Weinberg equilibrium (P > 0.05). The strong linkage disequilibrium was observed between rs10516487 and rs17266594 (D = 0.993, r 2 = 0.980). There was no significant difference in genotype distribution for any BANK1 SNPs (rs10516487, rs3733197 and rs17266594) between patients and healthy controls. The allele and genotype frequencies are shown in Table 3. PASI is a widely used method to characterize the severity of the disease (Goedkoop et al., 2004). In our study, PASI was used to divide the patients with psoriasis into two different levels: level 1 = PASI < 20; level 2 = PASI 20. As shown in Table 3, the distribution of genotypes of the three SNPs showed no significant relationship with the PASI score. No significant difference was observed between the two groups stratified by gender. However, it shows significant difference for rs3733197 according to patient onset age. The frequencies of AA genotype for rs3733197 were significantly higher in patients with a disease onset before age 23 than after 23 (P = 0.0069). The association of BANK1 haplotype with psoriasis Although rs10516487 is in strong linkage disequilibrium with rs17266594, the haplotypes of the two SNPs do not have significant associations with psoriasis. Then, we assessed the association of the three SNPs. The TGC and CAT haplotypes were found to have significantly lower frequency in psoriasis group (P = 0.0144, 0.0175), indicating a protective effect. On the other hand, CGT haplotype increased in psoriasis group, suggesting that CGT may represent a risk factor for psoriasis (Table 4). Discussion Genetic factors play an important role in aetiology of psoriasis. Multiple lines of evidences suggested that genetic risk factors predispose humans to this autoimmune disorder (Liu et al., 2007; Reich & Szepietowski, 2007; Roberson & Bowcock, 2010). There is an increasing interest to investigate genes that confer a modest level of risk. This is the first study to report an association between BANK1 variants and psoriasis, which was validated in a genetically homogeneous cohort. In the case control design, we investigated the relationship between human BANK1 functional polymorphisms and psoriasis in southern China. Our results showed that allele and genotype frequencies of the three polymorphisms do not differ between patients and controls. However, our result showed that the CGT (rs10516487, rs3733197 and rs17266594) haplotype is a marker for genetic susceptibility to psoriasis. This finding is also in agreement with a Spain study (Orozco et al., 2009) in which the same haplotype was linked to RA, suggesting an additive effect of BANK1 variants. We also found that the TGC and CAT haplotypes may be protective against psoriasis (P = 0.0144, 0.0175). The frequencies of genotype or allele of the three SNPs were not statistically different in the type 1 psoriasis (early onset, 40 years of age) and type 2

510 X. Zhang et al. Table 3. Association analysis of BANK 1 SNPs in Chinese psoriasis cases and controls PASI Onset age Women Men Psoriasis (%) (n = 242) Controls (%) (n = 317) P value <20 (n = 185) P value 20 (n = 57) P value <23 (n = 56) 23 (n = 186) P value Psoriasis (n = 84) Control (n = 132) P value Psoriasis (n = 158) Control (n = 185) P value rs10516487 TT 4 (0.017) 7 (0.022) 0.7691 3 (0.016) 0.6015 1 (0.017) 0.8742 2 (0.036) 2 (0.011) 0.3843 1 (0.012) 2 (0.015) 0.9804 3 (0.019) 5 (0.027) 0.6845 CT 64 (0.264) 90 (0.284) 46 (0.249) 18 (0.316) 16 (0.286) 48 (0.258) 23 (0.274) 36 (0.273) 41 (0.259) 54 (0.292) CC 174 (0.719) 220 (0.694) 136 (0.735) 38 (0.667) 38 (0.679) 136 (0.731) 60 (0.714) 94 (0.712) 114 (0.722) 126 (0.681) Allele T 72 (0.149) 104 (0.164) 0.4871 52 (0.141) 0.3215 20 (0.175) 0.7631 20 (0.179) 52 (0.140) 0.3119 25 (0.149) 40 (0.152) 0.9389 47 (0.149) 64 (0.173) 0.3902 Allele C 412 (0.851) 530 (0.836) 318 (0.859) 94 (0.825) 92 (0.821) 320 (0.860) 143 (0.851) 224 (0.848) 269 (0.851) 306 (0.827) rs3733197 AA 9 (0.037) 18 (0.057) 0.5570 4 (0.022) 0.1632 5 (0.088) 0.5922 6 (0.107) 3 (0.016) 0.0069 5 (0.060) 5 (0.038) 0.7213 4 (0.025) 13 (0.070) 0.1469 GA 71 (0.293) 93 (0.293) 53 (0.286) 18 (0.316) 15 (0.268) 56 (0.301) 26 (0.310) 39 (0.295) 45 (0.285) 54 (0.292) GG 162 (0.669) 206 (0.650) 128 (0.692) 34 (0.596) 35 (0.625) 127 (0.683) 53 (0.630) 88 (0.667) 109 (0.690) 118 (0.638) Allele A 89 (0.184) 129 (0.203) 0.4128 61 (0.165) 0.1319 28 (0.246) 0.3090 27 (0.241) 62 (0.167) 0.0748 36 (0.214) 49 (0.186) 0.4648 53 (0.168) 80 (0.216) 0.1093 Allele G 395 (0.816) 505 (0.797) 309 (0.835) 86 (0.754) 85 (0.759) 310 (0.833) 132 (0.786) 215 (0.814) 263 (0.832) 290 (0.784) rs17266594 CC 4 (0.017) 7 (0.022) 0.7325 3 (0.016) 0.5606 1 (0.017) 0.8939 2 (0.036) 2 (0.011) 0.3843 1 (0.012) 2 (0.015) 0.9629 3 (0.019) 5 (0.027) 0.6954 TC 64 (0.264) 91 (0.287) 46 (0.249) 18 (0.316) 16 (0.286) 48 (0.258) 22 (0.262) 36 (0.273) 42 (0.266) 55 (0.297) TT 174 (0.719) 219 (0.691) 136 (0.735) 38 (0.667) 38 (0.679) 136 (0.731) 61 (0.726) 94 (0.712) 113 (0.715) 125 (0.676) Allele C 72 (0.149) 105 (0.166) 0.4443 52 (0.141) 0.2913 20 (0.175) 0.7958 20 (0.179) 52 (0.140) 0.3119 24 (0.143) 40 (0.152) 0.8050 48 (0.152) 65 (0.176) 0.4027 Allele T 412 (0.851) 529 (0.834) 318 (0.859) 94 (0.825) 92 (0.821) 320 (0.860) 144 (0.857) 224 (0.848) 268 (0.848) 305 (0.824)

Association of BANK1 with psoriasis 511 Table 4. Haplotypes of BANK1 with three SNPs in the order rs10516487, rs3733197 and rs17266594 Haplotype Frequency P value OR (95% CI) Effect TAC Case 0.094 0.1885 1.33 (0.87 2.04) Neutral Control 0.073 TGC Case 0.052 0.0144 0.55 (0.34 0.89) Protection Control 0.091 CAT Case 0.085 0.0175 0.62 (0.42 0.92) Protection Control 0.131 CGT Case 0.764 0.0203 1.38 (1.05 1.81) Risk Control 0.704 psoriasis (late onset, >40 years of age) cases compared to controls. Nor is there difference between patients of different gender. In principle, people of all ages can develop psoriasis. Previous study on the onset of psoriasis in 2400 patients showed a peak incidence at 22.5 years of age and a second peak of onset around age 55 (Freedbery et al., 2003). In this study, we divided all patients into two groups by the cut-off at 23 years of age. By analysing further the distribution of BANK1 polymorphisms in psoriasis subgroups, we found that rs3733197 (A383T in ankyrin domain) was associated with an increased risk in patients with psoriasis whose disease onset was earlier than 23 years of age (P = 0.0069). The A383 variant appears to be associated with diffuse cutaneous systemic sclerosis and SLE (Kozyrev et al., 2008; Dieude et al., 2009). The minor allele 383T of rs3733197 might create a site for threonine kinases, which may contribute to the early onset of psoriasis. Despite these associations, their functional consequences of these SNPs on B-cell regulation and autoimmunity remain to be investigated. Our result provides further evidence that patients with different onset age of psoriasis differ in their genetic background. In addition, an association between the BANK1 polymorphisms and psoriasis severity was not found. BANK1 association was first identified in Scandinavian patients with SLE (Kozyrev et al., 2008) and further replicated in European Americans (Guo et al., 2009; Suarez-Gestal et al., 2009; Orozco et al., 2011) and Chinese populations (Chang et al., 2009; Guan et al., 2011). Expression of BANK1 in B cells may significantly distort intracellular calcium signalling by releasing Ca 2+ from endoplasmic reticulum stores. Alteration in B-cell activation may then shift the balance of proliferation and differentiation in epidermal keratinocytes. Previous study showed the keratinocytes of psoriatic subjects have an inborn error of calcium metabolism (Karvonen et al., 2000), and the increase in epidermal proliferation is thought to be due to increased release of ATP which in turn activates purinergic receptors and regulates keratinocyte calcium flux (Pillai & Bikle, 1992). Previous studies indicated that T cells play a central role in pathogenesis of psoriasis. However, recent studies also showed the importance of B cells. Johnson et al. (2005) reported the presence of anti-dsdna antibodies in patients with psoriatic arthritis (PsA). In addition, ANA was found in patients with PsA and cutaneous psoriatic forms. Disease severity in patients with psoriasis was correlated with the serum levels of BAFF (Samoud-El Kissi et al., 2008). BAFF was identified as a potent B-cell stimulatory molecule associated with systemic autoimmune diseases including systemic lupus erythematosus and Sjögren s syndrome (Matsushita & Sato, 2005; Moisini & Davidson, 2009). BANK1 may have profound effects on the modulation of B-cell activity and epidermal proliferation and skin barrier formation through Ca 2+ mobilization in psoriasis, although the precise role of BANK1 remains to be elucidated. High-resolution melting-based methods in closedtube formats are attractive because they offer several methodological advantages (rapid turnaround time, no post-pcr processing steps and smaller risk of contamination hazard) over other conventional gene scanning methods. However, HRM also carries its limitations in the low capacity of discriminating the two homozygote profiles when Tm difference is small. Unlabelled probe HRM is superior to conventional HRM in the identification of many small insertions or deletions and some Class 3 and Class 4 SNPs (7 9% of human SNPs) (Wittwer, 2009; Montgomery et al., 2010). By introducing an unlabelled probe covering the SNPs, the different genotypes can be clearly distinguished. Meanwhile, our study is subject to several limitations. First, the sample size of case and control groups is relatively small, although the current number of samples could present enough power to detect the possible association. Second, the selection of SNPs that were analysed in this study is on a hypothetical functional basis, and more extensive studies are needed to illustrate the exact role of BANK1 in psoriasis. Third, in our association analysis, we recruited the case control samples from Southern Han Chinese; the recent studies showed that strong genetic variability of Han Chinese exists between the Northern Han Chinese and the Southern Han Chinese (Chen et al., 2009; Xu et al., 2009). Therefore, other well-designed studies with different ethnic populations are warranted to verify our findings. In conclusion, we show that the rs3733197 genotype is associated with an increased risk of psoriasis at age <23 years in a South China population. Although there is no significant difference in genotype distribution for disease severity and gender between patients with psoriasis and controls, the 3-SNP haplotype analysis found that the major TGC and CAT haplotypes are protective factors for psoriasis. In addition, we found a common CGT haplotype that is significantly

512 X. Zhang et al. associated with psoriasis. Our study proved that BANK1 is a new psoriasis genetic susceptibility factor for psoriasis in southern Chinese Han population. Conflict of interest The authors state no conflict of interest. References Chang, Y.K., Yang, W., Zhao, M., Mok, C.C., Chan, T.M., Wong, R.W. et al. (2009) Association of BANK1 and TNFSF4 with systemic lupus erythematosus in Hong Kong Chinese. Genes and Immunity, 10, 414. Chen, J., Zheng, H., Bei, J.X., Sun, L., Jia, W.H., Li, T. et al. (2009) Genetic structure of the Han Chinese population revealed by genome-wide SNP variation. American Journal of Human Genetics, 85, 775. Dieude, P., Wipff, J., Guedj, M., Ruiz, B., Melcher, I., Hachulla, E. et al. (2009) BANK1 is a genetic risk factor for diffuse cutaneous systemic sclerosis and has additive effects with IRF5 and STAT4. Seminars in Arthritis and Rheumatism, 60, 3447. Freedbery, I.M., Eisen, A.Z., Wolff, K., Auster, K.F., Goldsmith, L.A. & Katz, S.I. (2003) Fitzpatrick s Dermatology in General Medicine, 6th edn. McGraw-Hill Professional, New York. Goedkoop, A.Y., Kraan, M.C., Picavet, D.I., de Rie, M.A., Teunissen, M.B., Bos, J.D. et al. (2004) Deactivation of endothelium and reduction in angiogenesis in psoriatic skin and synovium by low dose infliximab therapy in combination with stable methotrexate therapy: a prospective single-centre study. Arthritis Research & Therapy, 6, R326. Guan, M., Yu, B., Wan, J., Zhang, X., Wu, Z., Zhong, Q. et al. (2011) Identification of BANK1 polymorphisms by unlabelled probe high resolution melting: association with systemic lupus erythematosus susceptibility and autoantibody production in Han Chinese. Rheumatology (Oxford, England), 50, 473. Guo, L., Deshmukh, H., Lu, R., Vidal, G.S., Kelly, J.A., Kaufman, K.M. et al. (2009) Replication of the BANK1 genetic association with systemic lupus erythematosus in a Europeanderived population. Genes and Immunity, 10, 531. Johnson, S.R., Schentag, C.T. & Gladman, D.D. (2005) Autoantibodies in biological agent naive patients with psoriatic arthritis. Annals of the Rheumatic Diseases, 64, 770. Karvonen, S.L., Korkiamaki, T., Yla-Outinen, H., Nissinen, M., Teerikangas, H., Pummi, K. et al. (2000) Psoriasis and altered calcium metabolism: downregulated capacitative calcium influx and defective calcium-mediated cell signaling in cultured psoriatic keratinocytes. The Journal of Investigative Dermatology, 114, 693. Kozyrev, S.V., Abelson, A.K., Wojcik, J., Zaqhlool, A., Linga Reddy, M.V., Sanchez, E. et al. (2008) Functional variants in the B-cell gene BANK1 are associated with systemic lupus erythematosus. Nature Genetics, 40, 211. Leitch, D.N. & Haslock, D.I. (1997) Psoriatic arthritis and minocycline induced autoantibodies. Clinical Rheumatology, 16, 317. Lenth, R.V. (2007) Statistical power calculations. Journal of Animal Science, 85, E24. Liu, Y., Krueger, J.G. & Bowcock, A.M. (2007) Psoriasis: genetic associations and immune system changes. Genes and Immunity, 8, 1. Matsushita, T. & Sato, S. (2005) The role of BAFF in autoimmune diseases. Japanese Journal of Clinical Immunology, 28, 333. Moisini, I. & Davidson, A. (2009) BAFF: a local and systemic target in autoimmune diseases. Clinical and Experimental Immunology, 158, 155. Monteleone, G., Pallone, F., MacDonald, T.T., Chimenti, S. & Costanzo, A. (2010) Psoriasis: from pathogenesis to novel therapeutic approaches. Clinical Science (London, England: 1979), 120, 1. Montgomery, J.L., Sanford, L.N. & Wittwer, C.T. (2010) Highresolution DNA melting analysis in clinical research and diagnostics. Expert Review of Molecular Diagnostics, 10, 219. Navarini, A.A. & Trueb, R.M. (2010) Psoriasis. Therapeutische Umschau, 67, 153. Orozco, G., Abelson, A.K., Gonzalez-Gay, M.A., Balsa, A., Pascual-Salcedo, D., Garcia, A. et al. (2009) Study of functional variants of the BANK1 gene in rheumatoid arthritis. Arthritis and Rheumatism, 60, 372. Orozco, G., Eyre, S., Hinks, A., Bowes, J., Morqan, A.W., Wilson, A.G. et al. (2011) Study of the common genetic background for rheumatoid arthritis and systemic lupus erythematosus. Annals of the Rheumatic Diseases, 70, 463. Pillai, S. & Bikle, D.D. (1992) Adenosine triphosphate stimulates phosphoinositide metabolism, mobilizes intracellular calcium, and inhibits terminal differentiation of human epidermal keratinocytes. The Journal of Clinical Investigation, 90, 42. Reich, A. & Szepietowski, J. (2007) Genetic and immunological aspects of the pathogenesis of psoriasis. Wiadomosci lekarskie, 60, 270. Roberson, E.D. & Bowcock, A.M. (2010) Psoriasis genetics: breaking the barrier. Trends in Genetics, 26, 415. Rueda, B., Gourh, P., Broen, J., Agarwal, S.K., Simeon, C., Ortego-Centeno, N. et al. (2010) BANK1 functional variants are associated with susceptibility to diffuse systemic sclerosis in Caucasians. Annals of the Rheumatic Diseases, 69, 700. Samoud-El Kissi, S., Galai, Y., Sghiri, R., Kenani, N., Ben Alaya- Bouafif, N., Boukadida, J. et al. (2008) BAFF is elevated in serum of patients with psoriasis: association with disease activity. The British Journal of Dermatology, 159, 765. Singh, S. & Singh, U. (2010) Prevalence of autoantibodies in patients of psoriasis. Journal of Clinical Laboratory Analysis, 24, 44. Suarez-Gestal, M., Calaza, M., Endreffy, E., Pullmann, R., Ordi- Ros, J., Sebastiani, G.D. et al. (2009) Replication of recently identified systemic lupus erythematosus genetic associations: a case-control study. Arthritis Research & Therapy, 11, R69. Tagami, H., Iwatsuki, K. & Yamada, M. (1983) Profile of antistratum corneum autoantibodies in psoriatic patients. Archives of Dermatological Research, 275, 71. Wittwer, C.T. (2009) High-resolution DNA melting analysis: advancements and limitations. Human Mutation, 30, 857. Xu, S., Yin, X., Li, S., Jin, W., Lou, H., Yang, L. et al. (2009) Genomic dissection of population substructure of Han Chinese and its implication in association studies. American Journal of Human Genetics, 85, 762.