Biology [SBI 4U] FINAL EXAMINATION

Biology [SBI 4U] FINAL EXAMINATION Date: November 28, 2012 (Wednesday) Time: 8:30 a.m. 10:30 a.m. Length: 2 hours Lecturer: Ms. Kimberley Gagnon Canadian International Matriculation Programme Student Name: Period: Please read the following instructions carefully before you begin the examination: 1. This exam paper has 15 printed pages, including this cover page. 2. The examination is worth 30 percent of your final mark. 3. The examination consists of four parts: PART A, B, C and D. PARTS CONTENT MARKS A Knowledge and Understanding 30, allow 25 minutes B Communication 24, allow 25 minutes C Thinking and Investigation 40, allow 50 minutes D Application 16, allow 20 minutes TOTAL 110 4. Answer all sections on the exam paper. 5. Read all instructions carefully for each section. 6. Answers must be written in standard English format for an academic audience. Dictionaries (electronic or paper) are not permitted. 7. All answers must be written in black or blue pen only. For office use only: Part A Part B Part C Part D Total

of 11 Part A: Knowledge and Understanding (25 marks, allow 25 minutes) Multiple Choice: Circle the letter of the choice that best completes the statement or answers the question and then write the letter you have circled on the line to the left of the question.

of 11 Part B: Communication (24 marks, allow 25 minutes) Short Answer: Write the most appropriate answer in the space provided. All answers should be in POINT FORM ONLY. 1. a. Name the following isomers. (3 marks) b. One of the above isomers carbon chain is not labelled correctly. Renumber the incorrect carbons in the above diagram. (1 mark) c. Which two monosaccharides will form the disaccharide, maltose. (2 marks) 2. Aerobic cellular respiration consists of four steps. List these steps. (4 marks) 1. 2. 3. 4. 3. Outline the role of these enzymes in DNA replication in eukaryotic cells: helicase, primase, polymerase. ligase. (4 marks)

of 11 4. Distinguish between mrna and trna. (2 marks) 5. Transcribe and then translate the following anti-sense strand of DNA to determine the amino acid sequence. Use the Genetic Code given on page 15. (3 marks) Anti-Sense DNA SEQUENCE - 3 TACCGGCGGTAGGCGCATTTTTCAGCAATT 5 6. What is a frameshift mutation? Give an example to show how it can affect the resulting polypeptide? (3 marks) 7. Suppose that a neuron was unable to use active transport to move sodium and potassium ions across the neuronal membrane. Describe the effect on the resting potential of the neuron. (2 marks)

of 11 Part C: Thinking and Investigation (40 marks, allow 50 minutes) Graphics: For the following questions, use the graphics provided to review terms or skills. Add any missing labels, draw any missing parts, or use the graphics to help you answer a question. 1. Tropic hormones act on other endocrine glands. In these loops, the hormone secreted by the target gland will affect other tissues in the body, such as the bones and muscles. Fill in the blanks on the following diagram. (7 marks) 2. How is the depolarization of the plasma membrane of a neuron produced? Include a fully labeled diagram of the plasma membrane to show how depolarization occurs. (6 marks)

of 11 3. The following diagram shows the structural formula of ATP. Label the three phosphate groups, the highenergy bonds, adenine, ribose, and adenosine monophosphate. (4 marks) 4. Label this diagram of the translation complex. Hint: 1 mark per label. (8 marks) 5. Technology allows humans to increase the carrying capacity of their environment. Explain why. (2 marks)

of 11 6. The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell, suggest two reasons why eukaryotic mrna needs to be modified before translation, and state the three modifications. (7 marks) 7. Use the following information to answer the next question. (3 marks) A population of 500 fish faced a problem of biological magnification resulting in a large number of deaths that reduced the population to 350. But 200 births also took place and 27 fish immigrated into the population while 15 fish migrated out. Calculate the number of deaths which took place in the population. 8. Use the following information to answer the next question. (2 marks) The density of mosquitoes in a sample collected from a pond was found to be 172 mosquitoes/ml. The number of mosquitoes in the sample collected was 893. Calculate the volume of the water sample taken from the pond.

of 11 Part D: Application (16 marks, allow 20 minutes) Answer FOUR (4) of the following questions ONLY. If you attempt more than FOUR questions CIRCLE the questions you want marked otherwise the first FOUR will be marked. For the following questions, write the answer in the space provided. Use complete sentences in your answer. 1. During a physical examination, a doctor conducted a urinalysis on a patient. The doctor found a concentration of more than 2000 mg/dl of protein in the urine. What might the doctor suspect? Explain your reasoning. (4 marks) 2. During an investigation of a crime scene, detectives find a hair sample that has a follicle attached. The sample is taken to a forensic lab for analysis. State the technique, then list, in order, the steps the lab would follow to amplify the sample for further analysis. (4 marks)

of 11 3. a. Why are genetically engineered herbicide-resistant crops a concern, with respect to the environment? (2 marks) b. Why are genetically engineered food organisms a concern, with respect to public health? (2 marks) 4. The macrophage is a large white blood cell responsible for the phagocytosis of pathogens and dead cellular material. These cells help reduce inflammation by removing material that sustains bacteria. When unregulated, these cells can create damage to healthy cells. Explain how this could create a problem in a human body using two specific examples. (4 marks)

of 11 5. One of the few positive feedback systems in humans involves oxytocin. Oxytocin sustains the lactating breast. Continued nursing by the offspring sends a signal to the hypothalamus of the mother to continue releasing oxytocin. As well, oxytocin inhibits the release of LH and FSH from the posterior pituitary. What is the selective advantage of this homeostatic system for humans? (4 marks) 6. A group of male and female rabbits are introduced to an island in which there are no natural predators. The rabbits are able to find food and shelter on the island. Describe the growth of this rabbit population under these circumstances, and explain your reasoning. (4 marks)

Genetic code Page 11 of 11