Individualization of tiger by using microsatellites

Size: px
Start display at page:

Download "Individualization of tiger by using microsatellites"

Transcription

1 Forensic Science International 151 (2005) Individualization of tiger by using microsatellites Yan Chun Xu a,b, *,BoLi a, Wan Shui Li c, Su Ying Bai a, Yu Jin a, Xiao Ping Li d, Ming Bo Gu d, Song Yan Jing a, Wei Zhang a a State Forestry Administration Detecting Center of Wild Fauna and Flora, Northeast Forestry University, No. 26, Hexing Road, Harbin , PR China b State Conservation Center for Gene Resources of Endangered Wildlife, College of Life Science, Zhejing University, No. 268, Kaixuan Road, Hangzhou , PR China c Institute of Forensic Sciences, Ministry of the Public Security, No. 18, Muxidi Nanli, Xicheng District, Beijing , PR China d Department of Heilongjiang Province, Forensic Laboratory of the Public Security, No. 45, Shizi Street, Harbin , PR China Received 20 March 2003; received in revised form 1 July 2004; accepted 7 July 2004 Available online 25 August 2004 Abstract In investigating criminal cases of poaching and smuggling involving tigers (Panthera tigris), the number of tiger individuals involved is critical for determining the penalty. Morphological methodologies do not often work because tiger parts do not possess the distinctive characteristics of the individual. Microsatellite DNAs have been proved a reliable marker for the individualization of animals. Seven microsatellite loci derived from domestic cat (Felis catus) were selected to individualize tigers, namely F41, F42, F146, Fca304, Fca391, Fca441 and Fca453. A reference population containing 37 unrelated tigers were used to investigate alleles, allelic frequencies, genotypes and genotype frequencies of each locus. Consequently, the data was used to assess the validity of the combination of seven loci for tiger individualization. All loci were polymorphic and easy to amplify. Three out of the seven loci were significantly departure from the Hardy Weinberg Equilibrium (P < 0.05). Cumulative discrimination power (DP) calculated with observed genotype frequencies was Match probability of an individual in the reference population with a random individual in seven loci ranged from to This suggests that combining the seven microsatellite loci provides desirable power to individualize tigers. The combination of seven loci was applied to a case of tiger bone smuggling. Genotypes of all samples were identical in all seven loci, and the P M of the evidence samples in the seven loci hit , provided evidence that the bones belong to a single tiger. # 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Microsatellite; Tiger; Panthera tigris; Individualization 1. Introduction * Corresponding author. Present address: College of Life Sciences, Zhejiang University, No. 268, Kaixuan Road, Hangzhou, Zhejiang, PR China. address: [email protected] (Y.C. Xu). Tiger parts, like bone, penis, eyeball, blood, muscle, heart, etc., are considered precious medicines that have been used for many centuries within traditional Chinese medicine (TCM). The impression of tiger parts in the mind of oriental people has not yet disappeared though many countries have /$ see front matter # 2004 Elsevier Ireland Ltd. All rights reserved. doi: /j.forsciint

2 46 Y.C. Xu et al. / Forensic Science International 151 (2005) announced a cessation in the trade and use of tiger parts. The continuing black-market trade fuelled by these persistent strong beliefs in the benefits of such derived medicines in turn drives a number of individuals to continue to venture upon the speculation of tiger parts [1]. Therefore, species identification and individualization of tigers from seized evidence become an important issue for forensic detection. It is difficult to identify or individualize tigers based on the morphological characteristics except for in the cases where the tiger parts with entire taxonomic characteristics are obtained such as a complete mounted specimen. However, molecular biological strategies are often reliable to deal with samples that lack such complete characteristics. Molecular biological methods for the species identification of tigers have been previously reported [2,3]. Nevertheless, complete individualization of tigers has not yet been instigated. Microsatellites have been proved to be a reliable marker for the individualization of animals [4,5]. But very few microsatellite loci had been isolated from the tiger genome except for the 11 loci deposited in the GenBank. The flanking regions of microsatellite DNAs are very conservative across taxa, so transferring PCR primers to related species becomes possible [6,7]. Thus tiger individualization can be based on the feline microsatellites. Cases where the application of such a technique that would be a great benefit are not hard to find. For instance on 21 October 2002, the officers of Suifenhe Custom, China were informed that somebody would be attempting to smuggle tiger bones into China across the Russian border. The police subsequently arrested four suspects who were in possession of some tiger bones. It was required to find out how many tigers were involved in this case. Therefore, the technique firstly developed and described in this paper was utilized for this case and the results also included here. 2. Materials and methods 2.1. Tigers for the population investigation A population consisting of 37 unrelated tigers were taken as a reference population to investigate the allele number, allelic frequency and genotype frequency for validating these loci prior to the case analysis. The tigers were from the Feline Breeding Base of Guangxi Endangered and Rare Wildlife Refuge, China, which purchased three tiger subspecies from various zoos in China and Italy, France, and USA. Most individuals of the population were unrelated. The reference population used here includes 21 Amur tigers (Panthera tigris altaica), six south China tigers (P. t. amoyensis) and 10 Bengal tigers (P. t. tigris). Venous blood was sampled from each tiger, anticoagulated by adding with 10 ml 0.5 M EDTA (ph 8.0) per microlitre blood and kept at 4 8C for hours before treatment DNA isolation, PCR amplification and genotyping DNA was isolated with routine phenol:chloroform method [8] and quantified with DU-640 Nucleic Acid Protein Analysis System (Beckman Coulter) according to the user s manual. Primer pairs of seven microsatellite loci, namely F41, F42, F146, Fca304, Fca391, Fca441 and Fca453, derived from domestic cat (Felis catus) were selected to amplify tiger microsatellite DNAs [9]. PCR was set up in a 10 ml system containing 1 PCR buffer containing 10 mm Tris HCl (ph 8.3), 50 mm KCl; 2.5 mm MgCl 2, 250 mm each of four dntp (Takara), 4.0 pmol each of forward and reverse primer, 0.5 units of Taq DNA polymerase (Takara) and 50 ng of genomic DNA. The 5 0 end of each forward primer was labeled with FAM. PCR amplification was performed in a Model 9700 Thermocycler (Perkin- Elmer) using the following program: 1 cycle of 3 min at 94 8C, 10 cycles of 94 8C for 15 s, 55 for 15 s, 72 8C for 30 s, 20 cycles of 89 8C for 15 s, 55 8C for 15 s, 72 8C for 30 s, and 1 cycle of 72 8C for 10 min. An 1 ml PCR product of each locus was mixed with 23 ml loading dye containing 95% formamide and 1 ml GeneScan-500 [ROX] internal size standard, then denatured at 95 8C for 5 min and chilled on ice immediately. PCR products were isolated and sized with 5% denaturing polyacrylamide gel (Acr:Bis = 19:1) on an ABI PRISM 377 Automated DNA Sequencer (Applied Biosystems) and genotyped with GeneScan 3.1 and Geno- Typer 3.1 (Applied Biosystems). Microsoft Excel 2000 was used to sort fragments of PCR products by size and the alleles of each locus were deter- Table 1 The characteristics of the sequenced alleles of the seven microsatellite loci Locus Allele Size (bp) Observed sized (bp) Motif F (AAGG) 3 (AAAG) 13 F (TTCT) 3 (CTTT) 4 (CCTT) 3 TTTATTTCCTCTTTCCCTTCCTCCT(CTTT) 12 Fca (AAC) 12 Fca (GT) 17 (GG) 1 (GT) 6 Fca (ATGG) 10 (GATA) 11 (TAGA) 2 TGA(TAGA) 1 Fca (ATGG) 7 (GATA) 12 (TAGA) 2 TGA(TAGA) 1 Fca (ATAG) 9 (GTAG) 1 (ATAG) 2 AG(ATAG) 1 Fca (TAGA) 11

3 Table 2 Alleles and their size (bp) and frequency of the seven microsatellite loci in the reference population (n =37 a ) Locus Alleles and their size and frequency F41 Allele Observed size Actual size Frequency F42 Allele Observed size Actual size Frequency F146 Allele Observed size Actual size Frequency Fca304 Allele Observed size Actual size Frequency Fca391 Allele Observed size Actual size Frequency Fca441 Allele Observed size Actual size Frequency Fca453 Allele Observed size Actual size Frequency a For the locus Fca304, n = 34. Y.C. Xu et al. / Forensic Science International 151 (2005)

4 48 Table 3 Genotypes and their frequencies of the seven microsatellite loci in the reference population (n =37 a ) Locus Genotype and frequency b F41 31/32 16/28 15/28 28/31 26/31 15/16 25/27 25/28 15/21 16/31 16/29 16/16 28/28 16/21 16/26 12/15 25/33 17/25 26/26 16/33 20/ F42 23/24 23/23 22/22 19/22 17/24 17/23 17/22 17/18 16/23 16/17 16/ F146 12/13 12/12 11/11 10/12 10/11 10/ Fca304 25/25 24/25 24/24 22/25 22/ /25 21/ / / / / Fca / / / / / / / / / / / / / / Fca / / / / / / / / / / / / / / Fca453 11/12 11/11 10/11 10/12 9/11 9/ a For the locus Fca304, n = 34. b The upper data with slash are the genotypes and the lower data are their corresponding frequencies. Y.C. Xu et al. / Forensic Science International 151 (2005) 45 51

5 Y.C. Xu et al. / Forensic Science International 151 (2005) mined with the method as reported [10]. One or more alleles in each locus amplified from homozygotes were cloned with pmd18-t vector (TaKara) and sequenced with BigDye 1 Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on ABI PRISM Genetic analyzer (Applied Biosystems). The sequenced alleles were named according to the nomenclature of STRs [11,12]. The repeat number and name of all alleles remaining unsequenced were then deduced in reference to their observed size and the sequenced alleles. The allelic frequency and genotype frequency in each locus was calculated. The coincidence with Hardy Weinberg expectation (HWE) in each locus was tested by x 2 -test [13]. The discrimination power (DP) of each locus and cumulative DP of seven loci and the probability of the match with a random individual (P M ) were calculated with observed genotype frequency of each locus as mentioned [13] Case analysis We found that some limb bones in the evidence samples could be paired up and likely from a single individual. Therefore, we sampled one piece of bone of each pair and some rachis bones, samples totally numbering 8, representing all the bones. Bone samples were cleaned with 75% ethanol and drilled without cross contamination. The drill dusts of bones were collected to extract DNA with the routine phenol:chloroform method as above. DNA was purified with silica [14]. The amplification and genotyping of the evidence DNAs were performed with the same methods as mentioned above. The genotype of each locus of each bone was used to determine the identity. 3. Results 3.1. Alleles of each locus Various numbers of alleles were defined in the seven loci. The characteristics of the alleles in each locus are listed in Table 1. Except for the locus Fca304 that had a 2-base repeat motif and Fca146 that had a 3-base motif, all other five loci had a 4-base motif. All loci generated clear signals. F41 was the most polymorphic locus that had 14 alleles. F146 and Fca453 were the least polymorphic, four alleles being discovered in each. The other four loci were medium in polymorphism, possessing five to seven alleles. The alleles and their frequencies of all the loci are shown in Table Genotype frequency and discrimination power The observed genotype frequency was used to assess the validity of these loci as the genetic markers to individualize tigers (Table 3). The distributions of genotype frequencies of Table 4 Discrimination power (DP) of each microsatellite locus and cumulative DP of the seven loci in tiger individualization Locus DP Cumulative DP F F F Fca Fca Fca Fca these loci were not even. A few genotypes had a significantly higher frequency than others. Locus Fca304, Fca441, Fca391 and Fca453 were in accordance with the Hardy Weinberg equilibrium, while the other three, F41, F42 and F146 showed a departure from the HWE (P < 0.05). The discrimination power of each locus ranged from to and the cumulative DP of seven loci hit (Table 4). Match probability of an individual of the reference population with a random individual in seven loci ranged from to Individualization of evidence samples The amplified fragments of evidence in seven microsatellite loci were assigned to alleles discovered in the reference population by size (Table 5). No new allele was found in the evidence samples. All eight samples were identical in genotype through seven loci. The P M calculated with corresponding genotype frequencies of seven loci hit , which suggested these bone pieces were from one individual. 4. Discussion The tiger is a species consisting of five surviving subspecies, existing as some scattered captive populations and segmented wild populations. The history of the populations differs greatly from each other and the genetic background also seemed very complex. The individualization by using molecular genetic markers requires a database representing the species and detailing the statistical genetic parameters. However, the actual genetic background of the all tiger populations remained unclear up to the present. We sampled three subspecies of tigers in this experiment, basically representing the whole population in China, to create a molecular genetic database to support the statistical interpretation of the genotyping results in criminal cases involving the three subspecies. Nevertheless, the sample size was limited in each subspecies and thus the diversity of the microsatellites was probably underestimated. There are two subspecies, the Sumatran tiger (P. t. sumatrae) and Indochinese tiger (P. t. corbetii) also not yet included in this reference population. The individualization of these two

6 50 Y.C. Xu et al. / Forensic Science International 151 (2005) Table 5 Fragment size and genotype of evidence samples in the seven microsatellite loci a Sample F41 F42 F146 Fca304 FcA391 Fca441 Fca / / / / / / / / / / / / / / / / / / / / / / / /156/ / / / / / / / / / / / / / / / / / / /20 16/16 10/10 20/ / / / / / / / / / / /20 16/16 10/10 20/ / / / / / / / / / / /20 16/16 10/10 20/ / / /11 a The upper data with slash of each sample are the observed allele size (bp), the lower data is the corresponding genotypes. subspecies or an unknown subspecies has therefore a possibility of inaccuracy unless their population genetic data were added to the database. We found that the DP of each locus varied. Two of them (F146 and Fca453) were lower than , due to the small number of alleles. However, the cumulative DP of the seven loci calculated in this reference population exceeded , suggesting that combining the seven loci is able to give a conclusive result sufficient to individualize any tiger from multiple samples. In the case analysis, the genotypes of the eight samples in all loci were identical. The probability that they were from different individuals, e.g. P M, hits , being extremely low, strongly supported the validity of the conclusion that they are from one individual. Acknowledgements We would like to thank the donor of tiger samples, Mr. Wei Sen Zhou and the veterinarian Mr. Jian Bin Zhang, Mr. Hong Wen Guo and staff of the Feline Breeding Base of Guangxi Endangered and Rare Wildlife Refuge, China, who contributed time in cooperation with us during the sampling. We thank Dr. Lan Hu and Dr. Song Chen of the Institute of Forensic Sciences, Ministry of the Public Security, PR China who opened their laboratory to us and gave us a lot of valuable advice. We are also very grateful to those who gave us valuable suggestions for the experiments including Ms. Marilyn A. Menotti-Raymond of the Laboratory of Genomic Diversity, National Cancer Institute USA, Prof. Kai Ya Zhou of the Nanjing Normal University and Prof. Xian Hua Jiang of the Forensic Laboratory of the Department of the Public Security of Liaoning Province. Finally we are very grateful to Mr. Christopher Wood in his help in editing this paper. References [1] K. Nowell, Far from a Cure: The Tiger Trade Revisited, TRAFFIC International, Cambridge, UK, [2] J.H. Wetton, C.S.F. Tsang, C.A. Roney, A.C. Spriggs, An extremely sensitive species-specific ARMS PCR test for the presence of tiger bone DNA, Forensic Sci. Int. (2002) 126. [3] Q.H. Wan, S.G. Fang, Application of species-specific polymerase chain reaction in the forensic identification of tiger species, Forensic Sci. Int. 131 (2003) [4] M. Menotti-Raymond, V.A. David, J.C. Stephens, L.A. Lyons, S.J. O Brien, Genetic individualization of domestic cats using feline STR loci for forensic applications, J. Forensic Sci. 42 (1997) [5] M. Menotti-Raymond, V.A. David, S.J. O Brien, Pet cat hair implicates murder suspect, Nature 386 (1998) 774. [6] S.R. Engel, R.A. Linn, J.E. Taylor, S.K. Davis, Conservation of microsatellite loci across species of Arctiodactyls: implications for population studies, J. Mam. 77 (1999) [7] M.A. Menotti-Raymond, S.J. O Brien, Evolutionary conservation of ten microsatellite loci in four species of Felidae, J. Hered. 86 (1995) [8] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, [9] M. Menotti-Raymond, V.A. David, L.A. Lyons, A.A. Schäffer, J.F. Tomlin, M.K. Hutton, S.J. O Brien, A genetic linkage map of microsatellites in the domestic cat (Felis catus), Genomics 57 (1999) [10] V.A. David, M. Menotti-Raymond, Automated DNA detection with fluorescent-based technologies, IRL Press, Oxford, [11] P.J. Lincoln, DNA recommendations further report of the DNA Commission of the ISFH regarding the use of short tandem repeat systems, Forensic Sci. Int. 87 (3) (1997) [12] W. Bär, B. Brinkmann, B. Budowle, A. Carracedo, P. Gill, P. Lincoln, W. Mayr, B. Olaisen, DNA recommendations. Further report of the DNA Commission of the ISFH regarding the use

7 Y.C. Xu et al. / Forensic Science International 151 (2005) of short tandem repeat systems, Int. J. Legal. Med. 110 (1997) [13] X-F. Zheng, Forensic DNA Analysis, The People s Public Security University Press, [14] P. Hoff-Olsen, B. Mevåg, E. Staalstrøm, B. Hovde, T. Egeland, B. Olaisen, Extraction of DNA from decomposed human tissue, an evaluation of five extraction methods for short tandem repeat typing, Forensic Sci. Int. 105 (1999)

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C. Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Aurora Forensic Sample Clean-up Protocol

Aurora Forensic Sample Clean-up Protocol Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

DNA for Defense Attorneys. Chapter 6

DNA for Defense Attorneys. Chapter 6 DNA for Defense Attorneys Chapter 6 Section 1: With Your Expert s Guidance, Interview the Lab Analyst Case File Curriculum Vitae Laboratory Protocols Understanding the information provided Section 2: Interpretation

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

Forensic Science International: Genetics

Forensic Science International: Genetics Forensic Science International: Genetics 3 (2009) e111 e116 Contents lists available at ScienceDirect Forensic Science International: Genetics journal homepage: www.elsevier.com/locate/fsig Announcement

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Automated High Throughput Purification of BigDye TM Terminator Fluorescent DNA Sequencing Reactions Using Wizard MagneSil TM Paramagnetic Particles

Automated High Throughput Purification of BigDye TM Terminator Fluorescent DNA Sequencing Reactions Using Wizard MagneSil TM Paramagnetic Particles Automated High Throughput Purification of BigDye TM Terminator Fluorescent DNA Sequencing Reactions Using Wizard MagneSil TM Paramagnetic Particles Paul Otto*, Brad Larson and Steve Krueger Abstract We

More information

Introduction to Post PCR Cleanup

Introduction to Post PCR Cleanup Matt Kramer Introduction to Post PCR Cleanup Overview Why post PCR amplification cleanup? Enhancing human identity testing Introduction to QIAGEN MinElute post PCR cleanup technologies MinElute as a tool

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Did You Know? Neha Rao

Did You Know? Neha Rao Did You Know? 1. Tigers now occupy 7 percent of their historical range, and in the past decade, the area occupied by tigers has decreased by as much as 41 percent, according to some estimates (Dinerstein

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

1/12 Dideoxy DNA Sequencing

1/12 Dideoxy DNA Sequencing 1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics Basic Principles of Forensic Molecular Biology and Genetics Population Genetics Significance of a Match What is the significance of: a fiber match? a hair match? a glass match? a DNA match? Meaning of

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

A quick and simple method for the identi cation of meat species and meat products by PCR assay

A quick and simple method for the identi cation of meat species and meat products by PCR assay Meat Science 51 (1999) 143±148 A quick and simple method for the identi cation of meat species and meat products by PCR assay T. Matsunaga a, K. Chikuni b *, R. Tanabe b, S. Muroya b, K. Shibata a, J.

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Crime Scenes and Genes

Crime Scenes and Genes Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

Original article: DXS10079, DXS10074 and DXS10075: new alleles and SNP occurrence

Original article: DXS10079, DXS10074 and DXS10075: new alleles and SNP occurrence EXCLI Journal 2007;6:177-182 ISSN 1611-2156 Received: December 14, 2006, accepted: June 21, 2007, published: June 26, 2007 Original article: DXS10079, DXS10074 and DXS10075: new alleles and SNP occurrence

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis DNA FRAGMENT ANALYSIS by Capillary Electrophoresis USER GUIDE DNA Fragment Analysis by Capillary Electrophoresis Publication Number 4474504 Rev. A Revision Date September 2012 For Research Use Only. Not

More information

A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates

A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Application Note MLST A Fast, Accurate, and Automated Workflow for Multi Locus Sequence Typing of Bacterial Isolates Using Applied Biosystems 3130 and 3730 Series Capillary Electrophoresis Systems and

More information

How To Make A Molecular Encoder And Decoder

How To Make A Molecular Encoder And Decoder Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting information Molecular Encoder - Decoder Based on Assembly of Graphene with Dye-labeled

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

DNA PROFILING IN FORENSIC SCIENCE

DNA PROFILING IN FORENSIC SCIENCE DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

PNA BRAF Mutation Detection Kit

PNA BRAF Mutation Detection Kit - PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

Package forensic. February 19, 2015

Package forensic. February 19, 2015 Type Package Title Statistical Methods in Forensic Genetics Version 0.2 Date 2007-06-10 Package forensic February 19, 2015 Author Miriam Marusiakova (Centre of Biomedical Informatics, Institute of Computer

More information

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu. Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: [email protected] Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Touch DNA and DNA Recovery. H. Miller Coyle

Touch DNA and DNA Recovery. H. Miller Coyle Touch DNA and DNA Recovery 1 2 What is the link between cell biology & forensic science? Cells are the trace substances left behind that can identify an individual. Cells contain DNA. There are two forms

More information

Validation Guide for the DNA IQ Reference Sample Kit for Maxwell 16 Printed in USA. 9/06 Part# GE181

Validation Guide for the DNA IQ Reference Sample Kit for Maxwell 16 Printed in USA. 9/06 Part# GE181 REFERENCE MANUAL Validation Guide for the DNA IQ Reference Sample Kit for Maxwell 16 9/06 Validation Guide for the DNA IQ Reference Sample Kit for Maxwell 16 All technical literature is available on the

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Y Chromosome Markers

Y Chromosome Markers Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except

More information

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion

More information

Genetic conservation of microsatellite sequences in Suidae* *

Genetic conservation of microsatellite sequences in Suidae* * Ann. Anim. Sci., Vol. 9, No. 3 (2009) 243 248 Genetic conservation of microsatellite sequences in Suidae* * A n n a K o z u b s k a - S o b o c i ń s k a 1, B a r b a r a R e j d u c h 1, M a r i a O c

More information

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supplementary Information Real-time monitoring of rolling circle amplification using aggregation-induced

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific

More information

DNA Sequencing Handbook

DNA Sequencing Handbook Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: [email protected] DNA Sequencing

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information