RNA Isolation for Frozen Mouse Livers and Reverse Transcription

Transcription

1 RNA Isolation for Frozen Mouse Livers and Reverse Transcription I. Introduction RNA is typically isolated from tissue or cells based on the procedure originally described by Chomczynski and Sacchi in In this method tissue or cells are disrupted in a solution containing guanidinium thiocyanate, a strong chaotropic denaturant, which lyses cells and inactivates cellular RNases. The sample lysate was then mixed with a sodium acetate, ph 4, water saturated phenol and chloroform:isoamyl alcohol (49:11 v/v) solution. After subsequent cooling and centrifugation, the RNA was removed from the aqueous phase whereas DNA and protein were present in the interphase and phenol phase. The RNA was then precipitated with isopropanol, reprecipitated, washed and finally solubilized in 0.5% SDS. Recent technologies have allowed for RNA isolations based on the silica-based filters, thus avoiding the use of organic solvents required for the extraction step. We will be using Ambion s RNAqueous -4PCR Kit. After mixing the lysate with ethanol the resulting solution is added to the silica filter that selectively binds mrna and larger 18S and 28S ribosomal RNAs; very small RNAs such as trna and 5S ribosomal RNA are not quantitatively bound. The filter is then washed to remove DNA, protein, and other contaminants. The RNA is then eluted in nuclease-free water containing a trace amount of EDTA to chlelate heavy metals. To ensure that there is no trace DNA contamination that may produce a false positive for a reverse transcriptase PCR (RT-PCR), the eluted RNA may be treated with DNase 1. If the RNA has been treated with DNase 1, it, and divalent cations, must be removed for further downstream applications. The concentration of RNA is determined, after diluting the recovered RNA with T.E (10mM Tris, 0.1 mm EDTA, ph 8), using the following equation: [RNA], µg/ml = A 260 x dilution factor x 40 µg/ml Though yields will vary according to type and amount of sample, 1-10 µg per mg tissue are expected. Purity of the RNA is indicated by A 260 /A 280 ratio values in the range of

2 Though freshly dissected tissues give the best yields, tissues treated with a tissue storage/rna stabilization solution, such as Ambion s RNAlater TM can be used with very good results. Additionally, as RNases are much more resilient than DNases, special care must be made to ensure an RNase free work environment. Thus, RNase decontamination solutions such as Ambion s RNaseZap will be used to inactivate RNases on work surfaces and on equipment. As PCR requires a DNA template to amplify DNA with DNA polymerases, RNA cannot be used directly as a template. With the discovery of the enzyme reverse transcriptase in the late 1980s, it is now possible to copy RNA into its complementary DNA sequence (cdna). The process of subjecting RNA to reverse transcription followed by PCR is commonly known as RT-PCR and can be used to generate inserts for cloning into plasmid vectors, to make templates for in vitro transcription, or to assess the mutational status of expressed sequences. There are a couple of ways in which to generate cdna with the reverse transcriptase; one with oligo (dt) 18 primers that correspond to the 3 poly(a) tails of mrna and the other with random decamers which is useful if the mrna template is partially degraded and lacking the poly(a) tails. Appropriate controls are required to detect the presence of genomic DNA in the RNA isolation. II. Materials 1. Frozen mouse liver, ~ 75 mg 2. Ambion Ambion s RNaseZap 3. Ambion RNAqueous -4PCR Kit containing various components 4. Kinematica AG Polytron PT1200CL tissue homogenizer with a 7 mm generator 5. Digital Pipets and tips % EtOH 7. T.E Buffer: (10mM Tris, 0.1 mm EDTA, ph 8) o C, 44 o C, 80 o C and 92 o C water baths

3 9. Tabletop Centrifuge: Eppendorf Model 5415C 10. Microfuge tubes: 2.0 ml and 1.5 ml capped polypropylene tubes 11. Beckman DU-640 spectrophotometer and UV microcuvettes 12. Ambion RETROscript TM First Strand Synthesis Kit for RT-PCR 13. Ambion SuperTaq TM recombinant thermostable DNA polymerase, 5 U/µL 14. Thermal Cycler: Eppendorf Mastercycler gradient 15. Agarose: Cambrex Bio Sciences SeaKem LE agarose 16. 1X TBE Buffer: 90 mm Tris, 90 mm boric acid, 0.2 mm Na 2 EDTA, ph ~ Gel Star nucleic acid gel stain: BioWhittaker Molecular Applications 18. Nanofuge: National Labnet Co. Model C-1200 mini centrifuge 19. DNA MW standard: New England Biolabs bp, 100 bp step ladder 20. Horizontal gel electrophoresis apparatus: Fotodyne X Gel loading buffer: 80% (v/v) glycerol, 100 mm Na 2 EDTA, 1% (w/v) SDS, 0.1% (w.v) bromophenol blue, 0.1% (w/v) xylene cyanol FF III. Methods 1. Wear gloves for the entire procedure. 2. Obtain a frozen mouse liver sample, previously treated with Ambion s RNAlater TM, from your instructor; the sample has been pre-weighed and the mass written on the 2.0 ml microfuge tube. Record the mass. 3. Estimate the tissue volume and add volumes of the Lysis/Binding Solution; consult with your instructor 4. Carefully, homogenize the tissue with the Polytron homogenizer. 5. Centrifuge the lysate at 11,000 rpm for 1 min to clarify the lysate. Carefully transfer the supernatant to a clean sterile 2.0 ml microfuge tube. Estimate the volume and add an equal volume of 64% ethanol. Mix thoroughly by vortex mixing.

4 6. Pipet no more than 700 µl of the lysate/ethanol mixture onto the RNAqueous Filter Cartridge in a collection tube. Centrifuge at 13,000 rpm (do not exceed this limit as filter can become damaged!) until the lysate/ethanol solution has passed through the filter (1 min, possibly more); discard the eluate and reuse the collection tube. Repeat this process with the remainder of the lysate/ethanol mixture with the same filter (do not exceed 700 µl); discard the eluate. If needed repeat with the remainder of the lysate/ethanol solution; discard the eluate and reuse the collection tube. 7. Apply 700 µl of Wash Solution #1 to the filter cartridge and centrifuge at 13,000 rpm until all the wash solution is through the filter (1 min, possibly more); discard the eluate and reuse the collection tube. 8. Add 500 µl of Wash Solution #2/3 to the filter cartridge and centrifuge at 13,000 rpm until all the wash solution is through the filter (1 min, possibly more); discard the eluate and reuse the collection tube. Repeat with an additional aliquot of Wash Solution #2/3. After discarding the second wash solution centrifuge for an additional 1 min to remove the last traces of the wash solution. Put the filter cartridge into a new collection tube. 9. Add 50 µl of 80 o C Elution Solution to the filter and quickly centrifuge at 13,000 rpm. Using the same collection tube add a second 10 µl aliquot of 80 o C Elution Solution to the filter and quickly centrifuge at 13,000 rpm. Save the eluate and discard the filter. 10. To ensure that there is no DNA contamination the isolated RNA will be treated with DNase. Add 6 µl of 10X DNase 1 buffer and 1 µl of 2 U/µL DNase I. Mix gently and place in a 37 o C water bath for 20 min. 11. Resuspend the DNase Inactivation Reagent by vortex mixing. Remove the sample from the water bath and add 7 µl of the re-suspended DNase Inactivation Reagent to it. Flick the tube gently to disperse the DNase Inactivation Reagent. Incubate at room temperature for 2 min, flicking the tube one more time at the 1 min mark. 12. Centrifuge at 11,000 rpm (10,000 x g) for 1 min and carefully transfer the supernatant to a clean sterile 1.5 ml microfuge tube. Label your RNA sample appropriately and keep on ice. 13. Take the A 260, A 280 and A 320 absorbance readings of a 1:40 diluted (2 µl RNA sample plus 78 µl T.E buffer) RNA sample using a Elution Solution diluted in the same manner as the blank. The A 260 reading should be between 0.1 and 1.0. Consult with your instructor if it is not. Subtract the A 320 value from the A 260 and A 280 values. Determine the RNA concentration (µg/µl) for your undiluted sample using the equation in the introduction. Determine the total µg of RNA recovered from you tissue sample. Estimate the volume of your

5 undiluted sample with a pipet, try an initial setting of 60 µl. Calculate the µg RNA/mg tissue. 14. Using your calculated RNA concentration determine the volume required for 1-2 µg of RNA. Show this to your instructor. Depending on its value (it should not exceed 10 µl) you may have to concentrate the RNA following a protocol provided by your instructor. Note- a minimum concentration would be [RNA] = 0.1 µg/µl. 15. If your RNA is of suitable concentration perform a Two-Step RT-PCR with heat denaturation RETROScript protocol for reverse transcription reactions using two samples; one with the Oligo (dt) and the other with Random Decamers. 16. To three separate, sterile 1.5 ml microfuge tubes, one labeled dt, one labeled RD, and the third labeled RT, add the appropriate volume of your RNA sample to give 1 2 µg of RNA. To the sample labeled dt add 2 µl of the 50 µm Oligo (dt) primers solution; to the sample labeled RD add 2 µl of the 50 µm Random Decamers solution. To each of these samples add an appropriate volume of nuclease-free water so that the final volume is 12 µl. To the sample labeled RT add an appropriate volume of nuclease-free water so that the final volume is 20 µl; this will serve as a negative control for the subsequent PCR to show if there were any genomic DNA contamination in your RNA sample. Mix and nanofuge these samples briefly and place in the 80 o C water bath for 3 min to denature the RNA. 17. Remove the three samples and place on ice for 1 min. Nanofuge briefly and place back on ice. To only the samples labeled dt and RD add 8 µl of the Reverse Transcriptase Master Mix prepared by your instructor in the following manner: 2 µl 10X RT Buffer (500 mm Tris-HCl, ph 8.3, 750 mm KCl, 30 mm MgCl 2, 50 mm DTT) 4 µl dntp mixture (2.5 mm each dntp) 1 µl 10 U/µL Placenta RNase Inhibitor 1 µl 100 U/µL MMLV-Reverse Transcriptase Your instructor will prepare two positive RT controls with 1 µg of control mouse liver template RNA; one with the oligo (dt) primers and one with the random decamer (RD) primers. 18. Mix gently, nanofuge briefly, and incubate these samples as well as the RT sample at 44 o C for 1 hour. The reverse transcriptase is inactivated by incubating the samples at 92 o C for 10 min. The samples are placed on ice and can now be stored at -20 o C or subjected to PCR.

6 19. The PCR of any cdna produced by the RT reaction will use the RETROscript kit s Positive Control PCR Primer mixture and should yield a 361 bp segment of a conserved housekeeping gene rig/s15 which encodes a small ribosomal subunit protein. The sequence of the primers are: Forward primer: 5 - TTCCGCAAGTTCACCTACC Reverse primer: 5 - CGGGCCGGCCATGCTTTACG 20. To three separate PCR tubes add 2.5 µl of your dt, RD and RT samples, respectively. To each sample add 22.5 µl of a PCR master mix that has been prepared in the following manner: 2.5 µl 10X PCR buffer (100 mm Tris-HCl, ph 8.3, 500 mm KCl, 15 mm MgCl 2 ) 1.25 µl dntp mixture (2.5 mm each dntp) 1.25 µl Positive Control PCR primer mixture (5 µm each primer) 0.4 µl 5U/µL Ambion SuperTaq 17,1 µl sterile molecular biology grade water 21. The PCR is performed as follows: (Program RIGS15) Denature at 95 o C for Denature at 94 o C for: Anneal at 55 o C for : Extend at 72 o C for: 1 min, followed by 30 cycles of 30 sec 30 sec 30 sec After 30 cycles an additional Extension at 72 o C for 5 min Storage at 4 o C followed by storage at 80 o C. Freeze your various, labeled samples 22. The following week prepare a 2.0% (0.60g agarose/30 ml TBE) agarose gel in the usual way with a 8-tooth comb. 23. Recover your PCR samples, thaw and keep on ice. Remove 10 µl of each to separate 1.5 ml microfuge tubes and add 2 µl of the Ambion High Resolution Gel Loading Solution to each. Vortex briefly and spin down for 10 sec. 24. Load 12 µl of your three samples, 12 µl of a positive control sample (provided by the instructor), and 3 µl of the 100 bp DNA ladder into separate wells. Run at 100 V until the blue tracking dye is ~ 1.5 cm from the end of the gel.

7 25. Photo-document your gel. Measure the distance, in mm, from the well to each band of the standards as well as the distance for the samples. 26. Construct a log bp versus distance standard curve and determine the number of bp for each amplified product. Evaluate your results in context of the expected results and use of the various controls. III. Points for Discussion: What was the mass of the mouse liver tissue? What was the concentration (µg/µl) of your isolated RNA solution? What was the A 260 /A 280 ratio and its meaning? What was the µg RNA/mg tissue and how does it compare with what was expected? What volume was required to give 1-2 µg RNA for the RT reaction? Was the RT successful? What was the size of the PCR products for the positive control, your dt and random decamer samples? Compare these to the expected value. Also compare the intensities of the these bands with one another and discuss the significance. Was there any DNA contamination in your RNA sample? IV. References: Chelly, J., Concordet, J., Kaplan, J., and Hahn, A. (1989) Illegitimate transcription: transcription of any gene in any cell type. Proc. Natl. Acad. Sci. USA, 8, Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytica Biochemistry, 162, Inoue, C., Shiga, K., Takasawa, S., Kitagawa, M., Yamamoto, H., and Okamoto, H. (1987) Evolutionary conservation of the insulinoma gene rig and its possible function. Proc. Natl. Acad. Sci, 84, Kitagawa, M., Takasawa, S. Kikuchi, N., Itoh, T., Teraoka, H., Yamamoto, H., and Okamoto, H. (1991) Rig encodes ribosomal protein S15; The primary structure of mammalian ribosomal protein S15. FEBS, 283, RETROscript TM First Strand Synthesis Kit for RT-PCR instruction manual, Version 0011, Ambion, Austin, TX RNAqueous -4PCR Kit instruction manual, Version 0304, Ambion, Austin, TX