Molecular diagnostic: from research to application
|
|
|
- Dylan Kelly
- 10 years ago
- Views:
Transcription
1 FEM2 Ambiente S.r.l. spin-off dell' UNIVERSITA' DEGLI STUDI DI MILANO-BICOCCA Molecular diagnostic: from research to application Emanuele Ferri & Andrea Galimberti Le biotecnologie nel mondo della criminologia Seconda Edizione ( )
2 Summary Part I Who we are and what we do Part II DNA barcoding as an instrument to identify living beings Part III DNA barcoding applications Part IV Pyrosequencing Part V Pyrosequencing applications
3 Summary Part I Who we are and what we do Part II DNA barcoding as an instrument to identify living beings Part III DNA barcoding applications Part IV Pyrosequencing Part V Pyrosequencing applications
4 FEM2 Ambiente S.r.l. ZooPlantLab Massimo Labra Assistant professor at UNIMIB Maurizio Casiraghi Assistant professor at UNIMIB Fabizio De Mattia President FEM2-Ambiente Emanuele Ferri CEO FEM2-Ambiente
5 FEM2 Ambiente S.r.l. ZooPlantLab Andrea Galimberti Emanuele Panunzi Michela Barbuto Silvia Sironi
6 DNA barcoding Services Animal organisms identification Vegetal organisms identification Identification of fungi, bacteria, complexes matrices Pathogens screening Characterization of microbial communities By Sanger sequencing of libraries By multiplexing pyrosequencing Molecular sexing and avian pathologies Amphibian pathologies
7 Products
8 Summary Part I Who we are and what we do Part II DNA barcoding as an instrument to identify living beings Part III DNA barcoding applications Part IV Pyrosequencing Part V Pyrosequencing applications
9 Laboratory DNA barcoding
10 Summary Part I Who we are and what we do Part II DNA barcoding as an instrument to identify living beings Part III DNA barcoding applications Part IV Pyrosequencing Part V Pyrosequencing applications
11 DNA barcoding: our cases Food traceability - identification of market fish: Diffusion of processed rather than whole fish; Discrimination systems are welcomed; Our work is in collaboration with the Milan Fish Market, the distribution industries, the Italian food control agency (N.A.S. Carabinieri)
12 DNA barcoding: our cases Commercial cases (1): Common smooth-hound (Mustelus mustelus and Mustelus asterias)
13 DNA barcoding: our cases Commercial cases (1): Triakidae Palombo (Mustelus mustelus and Mustelus asterias) 29 % 71 % Squalidae Carcarinidae Lamnidae
14 DNA barcoding: our cases Commercial cases (2): flatfish Pleuronectes platessa Solea solea 80 % Platichthys flesus
15 DNA barcoding: our cases Commercial cases (3): Perca fluviatilis Italian rice Risotto with European perch ( risotto con pesce persico )
16 DNA mini-barcoding in progress Examination of baby food composed of flounder coxi of Sus scrofa domesticus
17 DNA barcoding: our cases Identification of commercial plant species Economically relevant topic; In some cases lack of high level of quality control; Plants used in alternative medicine, dietary supplements, nutraceutics, cosmetics, food (spices)
18 DNA barcoding: our cases Italian bats project identification of Italian bats: Bats are an intriguing and unknown topic; High level of molecular diversity is found in this group of mammals; Our work is in collaboration with the Italian Bat Association ( Italian bats represent 33 species out of 39 european species
19 DNA barcoding: our cases Identification of commercial and invasive exotic species Economically relevant topic: 3B /year; Trade of endangered species; Works on a single feather; Molecular sex determination as an additive output: service activated
20 DNA barcoding: other cases
21 DNA barcoding: our cases Identification of plant species from pollen Bees are used as pollen collectors; Identification of plants from pollen
22 Summary Part I Who we are and what we do Part II DNA barcoding as an instrument to identify living beings Part III DNA barcoding applications Part IV Pyrosequencing Part V Pyrosequencing applications
23 Metagenomic: our cases Pyrosequencing on: Soils (characterization of soil s meiofauna ) Pollens (as an alternative to classic melissopalinologic analysis) Water (characterization of water meiobenthos ) Bacteria (microbic characterization of complexes matrices)
24 Microbic characterization
25 Microbic characterization How to keep the analysis effective, but reduce the costs?
26 Microbic characterization Biochimical multiplexing FEM2 Ambiente has a library made up by 20 chimeric primer. Combining 10 chimeric primer For with 10 chimeric primer Rev allow the characterization of up to 100 different samples. With 1/8 454 plate is possible to obtain sequences/samples of 100 samples at cost of IVA.
27 Microbic characterization Not standard data management (Ribosomal Database Project) FEM2 Ambiente we are developing an identification pipeline based on NCBI BLAST: PYROBLAST-MULTICLASSIFIER
28 Microbic characterization
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
How To Promote Agricultural Productivity And Sustainability
La E.I.P. «Agricultural Productivity and Sustainability: il coinvolgimento delle imprese chimiche PARCO TECNOLOGICO PADANO Simona Palermo - Project Manager Lodi innovation Cluster Parco Tecnologico Padano
Welcome and introduction i to AU Research Centre Flakkebjerg
Workshop AU Flakkebjerg 22.09.2012 Welcome and introduction i to AU Research Centre Flakkebjerg Head of Research Section Entomology & Plant Pathology præsen TATION Welcome networking on Systemic approaches
GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS
GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS -ii- GUIDELINES ON THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND
Course Descriptions. I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students)
Course Descriptions I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students) This course is offered during the first semester of the second year of the MD Program. It
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
BIORICERCHE 2010. Limited Liability Consortium
BIORICERCHE 2010 Bioricerche 2010 Limited Liability Consortium BIORICERCHE 2010 Establishment 2008, June 3rd Partners: Istituto Tumori Pascale BIOTEST Italia s.r.l. Petrone Group s.r.l. 30% 24 % 10% 20%
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
National Institute for Microbial Forensics & Food and Agricultural Biosecurity
September 15, 2009 National Institute for Microbial Forensics & Food and Agricultural Biosecurity Jacqueline Fletcher, Director Department of Entomology & Plant Pathology Oklahoma State University Plant
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity DNA barcoding has inspired a global initiative dedicated to: Creating a library of new knowledge about species
Kindergarten Science Unit B: Life Science Chapter 4: Plant and Animal Parts Lesson 1: What do plant parts do?
Insert Photo or Graphic for Unit or Lesson Theme Kindergarten Science Unit B: Life Science Chapter 4: Plant and Animal Parts Lesson 1: What do plant parts do? Insert Photo/Graphic parts Insert Photo/Graphic
MASTER OF SCIENCE IN BIOLOGY
MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
Matter and Energy in Ecosystems
Matter and Energy in Ecosystems The interactions that take place among biotic and abiotic factors lead to transfers of energy and matter. Every species has a particular role, or niche, in an ecosystem.
Maurizio Bevilacqua. Università Politecnica delle Marche Ancona, Italy [email protected] www.univpm.it/maurizio.bevilacqua
Maurizio Bevilacqua Università Politecnica delle Marche Ancona, Italy [email protected] www.univpm.it/maurizio.bevilacqua 1 2 Faculty of Engineering Courses in the fields of ICT Engineering Civil
14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources Xiuzhu Dong Biological Resources Center Institute of Microbiology, Chinese Academy of Sciences Challenges Global
Ecological Restoration of an altered area at the Majuy
Ecological Restoration of an altered area at the Majuy Mountain in Cota, Colombia Introduction Human kind's constant pressure has generated alarming transformations to the natural ecosystems, which has
NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT
1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun
Supervised DNA barcodes species classification: analysis, comparisons and results. Tutorial. Citations
Supervised DNA barcodes species classification: analysis, comparisons and results Emanuel Weitschek, Giulia Fiscon, and Giovanni Felici Citations If you use this procedure please cite: Weitschek E, Fiscon
APPENDIX 1 ACCREDITATION APPLICATION. Application for Accreditation of Veterinary Diagnostic Laboratory Services
APPENDIX 1 ACCREDITATION APPLICATION Application for Accreditation of Veterinary Diagnostic Laboratory Services Name and address of laboratory Location of laboratory (if more than one please list each
The Cell Teaching Notes and Answer Keys
The Cell Teaching Notes and Answer Keys Subject area: Science / Biology Topic focus: The Cell: components, types of cells, organelles, levels of organization Learning Aims: describe similarities and differences
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
Metagenomic and metatranscriptomic analysis
Metagenomic and metatranscriptomic analysis Marcelo Falsarella Carazzolle [email protected] Laboratório de Genômica e Expressão (LGE) Unicamp METAGENOMIC Jo Handelsman (1998) University of Wisconsin-EUA)
Microbial Oceanomics using High-Throughput DNA Sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean
Il percorso diagnostico del nodulo tiroideo: il ruolo dell analisi molecolare
Il percorso diagnostico del nodulo tiroideo: il ruolo dell analisi molecolare Maria Chiara Zatelli Sezione di Endocrinologia Direttore: Prof. Ettore degli Uberti Dipartimento di Scienze Mediche Università
INFORMATION FOR UNDERGRADUATE STUDENTS majoring in PATHOBIOLOGY and VETERINARY SCIENCE
INFORMATION FOR UNDERGRADUATE STUDENTS majoring in PATHOBIOLOGY and VETERINARY SCIENCE Welcome to the Department of Pathobiology and Veterinary Science, College of Agriculture and Natural Resources, University
Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento. Università degli Studi di Napoli Federico II BIOGEM.
Società Botanica Italiana Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento Università degli Studi di Napoli Federico II BIOGEM Organize the Summer School Challenges, methods
Influence of the skin mechanical and microbial properties on hair growth
Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont
Training course of microbial resources information management and utilization for developing countries
The Report of Training Course Training course of microbial resources information management and utilization for developing countries At Institute of Microbiology, China Academy of Science (MCAS), Beijing,
IPM Plan for Campus Landscape
Created June 2014 IPM Plan for Campus Landscape Statement of Purpose The purpose of this integrated pest management (IPM) plan is to guide the use of environmentally sensitive pest management strategies
ELENCO PERIODICI ON - LINE IN ACQUISTO ANNO 2012 (vedi sito biblioteca in SERVIZI: http://ejournals.ebsco.com) FORMATO NOTE EDITORE ISSN
1 ACTA OECOLOGICA: INTERNATIONAL JOURNAL OF ECOLOGY ON-LINE ELSEVIER 1146-609X 2 ACTA ZOOLOGICA WILEY-BLACKWELL 0001-7272 3 ANIMAL BEHAVIOUR ON-LINE - anche ELSEVIER 0003-3472 4 ANIMAL CONSERVATION WILEY-BLACKWELL
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases
The International School of Advanced Molecular BioMedicine Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases AciTrezza (Catania), Italy, October 2nd-6th, 2009 Hieronymus Bosch: Garden
Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Handling next generation sequence data
Handling next generation sequence data a pilot to run data analysis on the Dutch Life Sciences Grid Barbera van Schaik Bioinformatics Laboratory - KEBB Academic Medical Center Amsterdam Very short intro
CENTRO DI ECCELLENZA JEAN MONNET DELL UNIVERSITÀ DEGLI STUDI DI MILANO
CENTRO DI ECCELLENZA JEAN MONNET DELL UNIVERSITÀ DEGLI STUDI DI MILANO The people 3 Full Professors 4 Associate Professors 2 Adjunct Professors 2 Post-doc researchers 8 Phd Students The areas of investigation
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
PUBLIC NOTICE FOR THE ADMISSION TO THE RESEARCH DOCTORATE IN MOLECULAR AND EXPERIMENTAL MEDICINE. XXXI Cycle - Academic year 2015/2016
PUBLIC NOTICE FOR THE ADMISSION TO THE RESEARCH DOCTORATE IN MOLECULAR AND EXPERIMENTAL MEDICINE XXXI Cycle - Academic year 2015/2016 Issued with Decree Nr. 063/2015 1 Summary Art. 1 Scope of the notice...
WORKSHOP Sustainable Tourism and Fragile Environment Sustainability and Development in Small Island Communities Maldives
WORKSHOP Sustainable Tourism and Fragile Environment Sustainability and Development in Small Island Communities Maldives May 29 th June 5 th 2015 (the dates are indicative and may be modified due to Flights
FOOD QUALITY AND ANALYTICAL CONTROL. Prof.ssa Patrizia Pinelli Dott. Leonardo Borsacchi
FOOD QUALITY AND ANALYTICAL CONTROL Prof.ssa Patrizia Pinelli Dott. Leonardo Borsacchi Monday Tuesday Wednesday Thursday Friday Saturday 8:00 9:00 10:00 11:00 12:00 (6/011 D6) 13:00 (6/011 D6) 14:00 (6/011
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Ecosystems and Food Webs
Ecosystems and Food Webs How do AIS affect our lakes? Background Information All things on the planet both living and nonliving interact. An Ecosystem is defined as the set of elements, living and nonliving,
Genetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
Biology Department Admission Requirements
GENERAL BIOLOGY BACHELOR OF SCIENCE IN BIOLOGY The General Biology option emphasizes breadth of training in Biology. As the most flexible among the options leading to a Science degree in Biology, students
How To Track Animals Via Their Dna
No place left to hide Tracking animals via their DNA Arjen de Groot Animal Ecology, Alterra Wageningen UR Kennisnetwerk Milieu, 27 september2013 Contents 1. Making the invisible visible 2. Genetic approaches
Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015)
Biological Sciences B.S. Degree Program Requirements (Effective Fall, 2015) Preparatory Subject Matter......56-66 Biological Sciences 2A-2B-2C.....15 Chemistry 2A-2B-2C...15 Chemistry 8A-8B or 118A-118B-118C......6-12
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: [email protected] Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
* For additional information please refer to the Graduate Handbook.
College of Arts and Sciences Master of Science (MS) in Biology Contact Information: Dr. Roberta M. Troy, Interim Head; [email protected]; Ph.: (334) 727 8822; 725 2364 Dr. Marcia Martinez, Graduate
Haploidentical Stem Cell Transplantation
UNIVERSITÀ DEGLI STUDI DI PARMA Preliminary Program 8 th International Symposium on Haploidentical Stem Cell Transplantation Chairman Co-Chairpersons Massimo F. Martelli, Yair Reisner Parma 4-6 September
Next Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
IL NUCLEARE IN ITALIA: SI RIPARTE?
IL NUCLEARE IN ITALIA: SI RIPARTE? 27 maggio, Sala Sagittarius, Centro Congressi, Fieramilano - Rho Silvio Bosetti Energy Lab - Laboratorio dell Energia ENERGYLAB: SUPPORT RESEARCH, CREATE INNOVATION,
DNA Banking International Efforts
DNA Banking International Efforts J. L. Karihaloo Asia-Pacific Consortium on Agricultural Biotechnology, New Delhi DNA Bank DNA Bank is a particular type of genebank that preserves and distributes the
QBOL, DNA barcodes to identify phytobacteria subjected to EU quarantine regulations
QBOL, DNA barcodes to identify phytobacteria subjected to EU quarantine regulations Cottyn B., L. Detemmerman, M. Maes COST873 - Annual Meeting 13-15 September 2010 Introduction Financed by 7th Framework
BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516
BSc (Hons) Biology (Minor: Forensic Science or Marine & Coastal Environmental Science)/MSc Biology SC516 (Subject to Approval) SC516 1. Mission, Aims and Objectives The new BSc (Hons)/ MSc course is a
Università degli Studi del Piemonte Orientale Amedeo Avogadro
Università degli Studi del Piemonte Orientale Amedeo Avogadro Alessandria, Novara, Vercelli April 2011 Welcome to the University of Eastern Piedmont! The University Past and Present The very first University
PhD studies in Italy
PhD Program in Agriculture, Forestry and Food Science Università degli Studi della Basilicata PhD studies in Italy PhD programs are offered by most Italian universities as the third level of academic education
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
OMICs TECHNOLOGY PLATFORM (GENOMICS, PROTEOMICS AND METABOLOMICS). Coordinators: Prof. Marcello Maggiolini, Prof. Maria Beatrice Bitonti
OMICs TECHNOLOGY PLATFORM (GENOMICS, PROTEOMICS AND METABOLOMICS). Coordinators: Prof. Marcello Maggiolini, Prof. Maria Beatrice Bitonti 0 The OMICA Technology Platform (Genomics, Proteomics and Metabolomics)
Major/Specialization. B.Sc. Degree
B.Sc. Degree Extension and Extension and Forestry and Forest Reclamation of Arid & Mountainous Regions Agronomy & with two specializations Landscape Design Aquatic Ecology Fish Processing Forestry and
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
Faculty of Pharmacy Piazza Costanti tel. 0737 402455 402456 fax 0737 402457 e-mail: [email protected]
Faculty of Pharmacy Piazza Costanti tel. 0737 402455 402456 fax 0737 402457 e-mail: [email protected] Five-Year Degree (laurea magistrale) in Pharmaceutical Chemistry and Technology Class 13/M Pharmacy
The University of Vermont: Degrees Awarded by Degree Program, 2007-8
Degree Programs: Bachelor's Degrees Degree College or School # 2007-08 Degrees AIS: Asian Studies BA College of Arts and Sciences 10 AIS: European Studies BA College of Arts and Sciences 3 AIS: Latin America
- A9/1 - Format for the listing of end points to be included in the Tier III overall summary and assessments
- A9/1 - - A9/1 - APPENDIX 9 FORMAT FOR THE LISTING OF END POINTS TO BE INCLUDED IN THE REASONED STATEMENT OF THE OVERALL CONCLUSIONS DRAWN BY THE REGULATORY AUTHORITY (LEVEL 2)8 General remark: Testing
THE MICROBIAL ID BREAKTHROUGH: How DNA Sequencing Services Help Prevent Catastrophic Cleanroom Shutdowns
A WHITE PAPER THE MICROBIAL ID BREAKTHROUGH: How DNA Sequencing Services Help Prevent Catastrophic Cleanroom Shutdowns By Dennis Champagne Director, Laboratory Services, Microtest, Inc. A WHITE PAPER THE
Wetland Vocabulary Organizer
Wetland Vocabulary Organizer Vocabulary Word Definition Wetland Picture Species Nutrients Sediment Groundwater Habitat Vocabulary Word Wetland Wetland Vocabulary Organizer Key Definition is an area that,
The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
IV Molecular Cytopathology Focus on Next Generation Sequencing in Cytopathology
Napoli 4 dicembre 2015 Università Degli Studi di Napoli Federico II Dipartimento di Sanità Pubblica Meeting Director: Giancarlo Troncone Centro Congressi Federico II Via Partenope 36 80121 Napoli IV Molecular
Stem Cell Biology and Regenerative Medicine
Stem Cell Biology and Regenerative Medicine Series Editor Kursad Turksen, Ph.D. [email protected] For further volumes: http://www.springer.com/series/7896 Tiziana A.L. Brevini Editor Stem Cells
The Financial Benefits of the MicroSEQ Microbial Identification System
White paper Financial Benefits of the MicroSEQ Microbial Identification System The Financial Benefits of the MicroSEQ Microbial Identification System Up to 160% ROI over 3 years, Break-even as soon as
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology The Master Degree in Medical Laboratory Sciences / Clinical Microbiology, Immunology or
Targeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
Master s Degree Programme in Forest Sciences and Business (MScFB) 2014-2015
Faculty of Agriculture and Forestry 1(11) Master s Degree Programme in Forest Sciences and Business (MScFB) 2014-2015 Degree requirements in Forest Ecology and Management, 120 cr Degree requirements in
Next Generation Sequencing in Public Health Laboratories. 2014 Survey Results
Next Generation Sequencing in Public Health Laboratories 2014 Survey Results MAY 2015 This project was 100% funded with federal funds from a federal program of $215,972. This publication was supported
How To Create A Blended Learning Course In Sociology
Virtual Campus in Blended Learning: From the First Blended Learning Degree in Sociology to E-Urbs Giovanni Torrisi (Università di Urbino Carlo Bo ) Facoltà di Sociologia Università degli studi di Urbino
B: Diagnostics for high priority grains pests Dr Angela Freeman Senior Research Scientist Microbiology (DEPI)
Project 2014: A: New tools for field grains surveillance Dr Jenny Davidson Senior Pulse Pathologist (SARDI) and B: Diagnostics for high priority grains pests Dr Angela Freeman Senior Research Scientist
Biology Department Competitive Admission Requirements
GENERAL BIOLOGY BACHELOR OF SCIENCE IN BIOLOGY The General Biology option emphasizes breadth of training in Biology. As the most flexible among the options leading to a Science degree in Biology, students
Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action
Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era
Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests?
Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests? Martin Wiedmann Milk Quality Improvement Program November 3, 2011 Fluid milk shelf life What defines shelf life
WELCOME TO MT. SAN ANTONIO COLLEGE REGISTERED VETERINARY TECHNOLOGY PROGRAM
WELCOME TO MT. SAN ANTONIO COLLEGE REGISTERED VETERINARY TECHNOLOGY PROGRAM Accredited by the American Veterinary Medical Association (AVMA), the Registered Veterinary Technology Program at Mt. San Antonio
Gabriele Giovanni MESSINA
Gabriele Giovanni MESSINA Curriculum Vitae NAME and FAMILY NAME Gabriele MESSINA NATIONALITY Italian PALCE AND DATE OF BIRTH Ragusa (RG),19 th of march 1973 PROFESSIONAL POSITION Research Professor of
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
Use this diagram of a food web to answer questions 1 through 5.
North arolina Testing Program EO iology Sample Items Goal 4 Use this diagram of a food web to answer questions 1 through 5. coyotes 3. If these organisms were arranged in a food pyramid, which organism
Course Structure 2015/2016
Master of Science in Business Administration UNIVERSITA DEGLI STUDI DI ROMA TOR VERGATA Course Structure 2015/2016 Management SSD CFU Service Management SECS P/08 6 Control and Auditing SSD CFU Marketing
Micromyx. Micromyx. A Microbiology Services Company. Lab Services Research - Consulting -
A Microbiology Services Company Lab Services Research - Consulting - Regulatory Company description is a microbiology services company specializing in antiinfective discovery and development for the pharmaceutical,
Università Politecnica delle Marche
6 th Edition of the: UNIVPM - UNIDO E-Biosafety Master Summer ON CAMPUS SCUOLA DI DOTTORATO DELLA FACOLTA DI AGRARIA Ancona, June 17 21, 2013 Programme June 16, 2013 Arrival to Ancona Monday 17, June 2013-ROOM
