Dermcidin: a novel human antibiotic peptide secreted by sweat glands

Size: px
Start display at page:

Download "Dermcidin: a novel human antibiotic peptide secreted by sweat glands"

Transcription

1 Dermiin: novel humn ntiioti peptie serete y swet glns Birgit Shittek 1, Riner Hipfel 1, Birgit Suer 1, Jürgen Buer 1, Huert Klher 2, Stefn Stevnovi 3, Mrkus Shirle 4, Kristin Shroeer 5, Nikolus Blin 5, Frieegun Meier 1, Gernot Rssner 1 n Clus Gre 1 Pulishe online: 5 Novemer 2001, DOI: /ni732 Antimiroil pepties re n importnt omponent of the innte response in mny speies. Here we esrie the isoltion of the gene Dermiin, whih enoes n ntimiroil peptie tht hs ro spetrum of tivity n no homology to other known ntimiroil pepties.this protein ws speifilly n onstitutively expresse in the swet glns, serete into the swet n trnsporte to the epierml surfe. In swet, proteolytilly proesse 47 mino i peptie ws generte tht showe ntimiroil tivity in response to vriety of pthogeni miroorgnisms.the tivity of the peptie ws mintine over ro ph rnge n in high slt onentrtions tht resemle the onitions in humn swet.this inite tht swet plys role in the regultion of humn skin flor through the presene of n ntimiroil peptie.this peptie my help limit infetion y potentil pthogens in the first few hours following teril oloniztion. The epitheli of multiellulr orgnisms represent mjor rrier to the environment n provie the first line of efense ginst inving miroorgnisms. In the epitheli, ntimiroil pepties prtiipte in the efense system of mny orgnisms, inluing plnts, insets, mphiins n mmmls. They ontrol miroil growth in the first hours fter epithelil injury n uring woun heling n re espeilly prevlent uring some inflmmtory skin isorers. In mmmlin skin, two lsses of ntimiroil pepties hve een ientifie: theliiins 1 n β-efensins 2. They re expresse in humn kertinytes fter inution y inflmmtory stimuli n funtion primrily in the response to injury. The theliiins re omponents of woun flui 1 n re expresse y humn skin kertinoytes t sites of inflmmtion in isorers suh s psorisis, nikel ontt ermtitis n systemi lupus erythemtosus 3. Defensins re smll (3 5 kd) tioni pepties tht n e groupe into the α-n β-efensins. The α-efensins humn neutrophil pepties 1 4 re expresse in humn leukoytes n humn efensins 5 n 6 re expresse in Pneth ells in the smll intestine 4,5. Humn β-efensins 1 3 re foun in vrious epithelil ells 4. In mmmlin skin, humn β-efensins 2 n 3 re expresse fter inution in kertinoytes in response to infetion n inflmmtion 2,6. Humn β-efensins 1 n 2 show miroiil tivity preominntly ginst Grm-negtive teri suh s Esherihi oli n yests, wheres humn β-efensin 3 is lso effetive ginst Grm-positive teri suh s Stphyloous ureus, mjor use of skin infetions, prtiulrly in topi ermtitis. We esrie here the isoltion of new ntimiroil protein tht hs no homology to known ntimiroil pepties. This protein ws speifilly n onstitutively expresse in swet glns, serete into the swet n trnsporte in swet to the epierml surfe. This inite tht humn swet ontins t lest one ntimiroil protein, whih my ply role in the regultion of humn skin flor. Results Isoltion n mpping of DCD Sreening of sutrte DNA lirry of primry melnom n enign melnoyti nevus tissues with DNA rrys ientifie lone whih we lter esignte Dermiin (DCD) tht h no homology to ny pulishe gene sequene 7. Sequening of overlpping polymerse hin retion (PCR) prouts ientifie full-length DCD DNA of 458 p with n open-reing frme of 330 p tht enoe 110 mino i () resiues (see We Fig. 1 on the supplementry informtion pge of Nture Immunology online). The gene onsists of five exons n four introns n is expresse s single trnsript 7. Two short overlpping pepties generte from the 5 en of the gene re esrie s humn hexi-ssoite protein 8,9 n survivl-promoting peptie for neuronl ells 10,11. We etermine the hromosoml loliztion of DCD y nlyzing olletion of humn-roent somti hyri ells tht ontine efine humn hromosomes or their frgments on roent kgroun. First, monohromosoml hyri ell pnel ws investigte with humn DCD-speifi primers in PCR experiments. For etile suhromosoml mpping, the sme tehnique ws use with rition hyri mpping pnel. With these pprohes, we were le to ssign DCD to hromosome 12q13 etween the mrkers D12S1896 n D12S1632 (lo sore 14.11). 1 Deprtment of Dermtology, Eerhr-Krls-University Tüingen, Germny. 2 Meil n Nturl Sienes Reserh Center, Eerhr-Krls-University Tüingen, Germny. 3 Institute for Cell Biology, Deprtment of Immunology, University of Tüingen,Tüingen, Germny. 4 Institute for Cell Biology, Deprtment of Moleulr Biology, University of Tüingen,Tüingen, Germny. 5 Institute of Anthropology n Humn Genetis, Eerhr-Krls-University Tüingen, Germny. Corresponene shoul e resse to B. S. ([email protected]). eemer 2001 volume 2 no 12 nture immunology 1133

2 A RTICLES Figure 1. DCD expression ws restrite to ells in the skin. RT-PCR nlysis of vrious tissues with humn MTC pnels n DCD-speifi primers.as shown, eh smple ws nlyze twie with 40 PCR yles. For eh smple, GAPDH oul e suessfully mplifie (t not shown). () Tissue pnel I () tissue pnel II () tumor pnel n () fetl pnel. wek n mrkely reue stining ws seen (t not shown). Finlly, we use immunoeletronmirosopy to ultrstruturlly lolize DCD insie the erine swet glns of norml xillry skin; we foun tht DCD ws expresse in the rk muous ells of the seretory oil (Fig. 2e). DCD loliztion ws exmine further n ws foun to our within the golgi omplex n in the seretory grnules (Fig. 2f), whih suggeste DCD is serete protein. DCD is proteolytilly proesse Expression pttern of DCD To etermine the overll expression profile of DCD, ot lot in whih RNA from 50 ifferent tissues t ifferent evelopmentl stges were spotte onto nylon memrne ws one with the use of lele DCD DNA s hyriizing proe. No etetle signl ws foun in ny of the 50 smples, whih inite tht DCD h restritive expression pttern (t not shown). To etermine whether DCD ws expresse only t low mounts in humn tissues or ell lines, we nlyze DCD expression with reverse trnsrie PCR (RT-PCR). DCD ws highly expresse in humn skin, melnoyti nevus tissue n utneous melnom tissue (Fig. 1). However, expression ws not etete in ny of the 16 humn tissues nlyze (spleen, thymus, prostte, testis, ovry, smll intestine, olon, peripherl loo lymphoytes, hert, rin, plent, lung, liver, skeletl musle, kiney n pnres) n ws not expresse in severl fetl n tumor tissues. In ition, in pnel tht ontine vrious prts of the humn igestive system n severl ifferent tumor ell lines, no mplifition prout ws etete y RT-PCR fter 40 yles (t not shown). These t inite tht DCD expression ws restrite to ells in the skin. To efine the ell types tht expresse DCD we use in situ hyriiztion, immunohistohemistry, immunofluoresene n immunoeletronmirosopy. In situ hyriiztion showe tht the gene ws expresse in erine swet glns within the ermis of humn skin (Fig. 2). With the use of sense proe for DCD s negtive ontrol no signls were etete (Fig. 2). We use n ntiserum rise in rits to rry out immunohistology on skin setions (Fig. 2). Agin, we sw strong stining on the erine swet glns, ut no expression on other skin ell types. Confol lser snning mirosopy showe strong immunofluoresene stining in the seretory oils of erine swet glns (Fig. 2). In the seretory grnules of porine swet glns only Figure 2. DCD ws expresse in humn erine swet glns. (,) In situ hyriiztion with igoxigenin-lele sense proe tht ws trnsrie in vitro (negtive ontrol) or n ntisense proe for DCD showe tht DCD ws lolize to the erine swet glns. () The immunohistohemistry of DCD ws ssesse with rit nti-dcd serum n seonry rit ntioy.as speifiity ontrol, the setions were inute with preimmune rit serum + the seonry ntioy or the seonry ntioy lone. () Immunofluoresene of trnsete seretory oil of n erine swet gln showe DCD+ (re) serous ells surroune y tin+ myoepithelil ells (lue). Nulei stine with YOPRO (green). Originl mgnifition: 800. (e,f) Immunoeletronmirosopy ws use to exmine n erine swet gln. (e) Seretory tuule of n erine swet gln showe rk muous ells (MC) with seretory grnules, serous ells (SC) n myoepithelil ell (ME). Originl mgnifition: (f) Higher mgnifition of e. Groupe gol prtiles, whih revele DCD loliztion, were foun in the seretory grnules (SG) n in the golgi omplex (GC) of muous swet gln ells. Originl mgnifition: 12, nture immunology volume 2 no 12 To etermine whether DCD or DCD-erive pepties were serete into humn swet, we isolte severl protein frtions erive from humn swet fter high performne liqui hromtogrphy (HPLC) frtiontion (Fig. 3). To etermine the peptie sequene in swet frtions, we use Emn mirosequening n nnoeletrospry mss spetrometry. The mss spetrum of swet frtion 4 showe n unnt signl tht orrespone to neutrl mss of 4, Dltons. Emn nlysis ws use to ientify 1 46 of this peptie, n tnem mss spetrometry ws use to etermine tht the COOH-terminl sequene ws V(I/L)DSV-COOH. Tken together these t showe tht this peptie represente proesse form of the DCD protein tht enompsse 47 of its COOH-terminl prt (Fig. 3,). We terme this peptie DCD1; it h lulte neutrl mss of 4, Dltons. We nlyze swet smples from four iniviuls n, from the t we otine, estimte tht the DCD-1 peptie ws present in swet t onentrtion of 1 10 µg/ml. It remins to e etermine whether proessing of full-length DCD, whih hs lulte moleulr weight of e f eemer

3 Figure 3. DCD ws serete into humn swet. () RP-HPLC nlysis of humn swet.antimiroil ssys were one with pek frtions 1 4. () Nnoeletrospry mss spetrometry of frtion 4 showe quruply hrge signl t m/z= , whih orrespone to neutrl mss of Dltons (lulte neutrl mss Dltons). () Amino i sequene of full-length DCD.The signl peptie is in itlis; the peptie elute from frtion 4 of humn swet is unerline.this peptie, esignte DCD-1, enompsse of full-length DCD. 9.3 kd without the signl peptie tkes ple in the swet gln ells or fter it hs een serete into swet. Antimiroil tivity of DCD-1 peptie Antimiroil pepties, suh s the efensins, re proue s intive preursor proteins tht re proteolytilly proesse to give rise to tive pepties from the COOH-terminl region of the protein 12. Although the mino i sequene of DCD h no homology with other known ntimiroil pepties, the size of DCD n its proesse pepties resemle the struturl hrteristis of the efensin fmily of ntimiroil proteins. Therefore, with purifie pepties generte from the DCD mino i sequene n the HPLC-purifie swet frtions 1 4, we nlyze the pthogens E. oli, Enteroous felis, S. ureus n Cni lins with ntimiroil ssys. The tivity of two syntheti DCD-erive pepties (Y-P30 n DCD- 1L) n ontrol peptie (DPI) were teste. The 30- peptie Y-P30 is erive from the NH 2-terminl en of DCD ( 20 49) 10 ; DCD-1L omprise 48 from the COOH-terminl en of the DCD protein; n DPI ws 30- ontrol peptie without homology to DCD (Fig. 4). All pepties were teste t onentrtions of µg/ml. Y-P30 n DPI h no toxi effet on the miroorgnisms (men ell eth ws 5.6% with Y-P30 n 3.7% with DPI). However, DCD-1L, whih ws erive from the 3 en of DCD n enompsse the DCD-1 peptie sequene plus the lst leuine in the DCD sequene (Fig. 4), showe ose- n time-epenent ntimiroil tivity ginst the teri (Fig. 4). It ws highly effetive ginst E. oli, E. felis n S. ureus n, t 10 µg/ml, kille 100% of the orgnisms fter only 4 h of inution. DCD- 1L ws lso highly fungiil, s shown y its toxi effet on C. lins (Fig. 4). The miniml inhiitory onentrtion (MIC) of the DCD-1L peptie, efine s the lowest onentrtion of peptie tht prevente visile miroil growth fter 4 h of inution, ws 1 µg/ml for E. oli, E. felis n S. ureus n 10 µg/ml for C. lins. Inresing the inution time to 18 h le to greter miroiil effet (t not shown). A shorter version of the DCD-1L peptie tht enompsse 31 of the DCD COOH-terminl en h no toxi effet on the miroorgnisms (t not shown). Swet is ii, with ph of 4 6.8, n minly onsists of wter, soium (20 60 mm), hlorie (20 80 mm), potssium (10 mm) n mgnesium (1 mm). The ntimiroil ssys were one in soium phosphte uffer t ph 7.4, s is use for efensins 13. To strengthen support for the ntimiroil funtion of DCD n to show tht the peptie ws lso tive in swet, we i the ntimiroil ssys in severl uffers tht h ph n ioni omposition similr to tht of humn swet. We teste phosphte uffers in whih the ph vrie etween or the soium hlorie vrie etween mm; we lso use uffer with ph of 5.5 or 6.5 tht h similr omposition to humn swet (referre to s swet uffer). Figure 4. DCD h ntimiroil tivity n ws slt- n phinsensitive. () Amino i sequenes of Y-P30, DCD-1L n DPI (the ontrol peptie). () To ssess DCD-1L tivity, DCD01L ws inute with E. oli, E. felis, S. ureus n C. lins for 4 h in 10 mm phosphte uffer (ph 7.4) t onentrtions of 1 µg/ml (open rs), 10 µg/ml (hekere rs), 50 µg/ml (otte rs) n 100 µg/ml (fille rs).the numer of teril or yest olonies were ounte n perentge ell eth lulte. ( f) To ssess DCD ntimiroil tivity in ifferent uffers over ro ph rnge n slt onentrtions, DCD-1L (10 µg/ml) ws inute for 4 h with vrious uffers + () E. oli () E. felis (e) S. ureus n (f) C. lins. Buffer 1, soium phosphte uffer ph 5.5; 2, soium phosphte uffer ph 6.5; 3, soium phosphte uffer ph 7.4; 4, soium phosphte uffer ph mm NCl; 5, soium phosphte uffer ph mm NCl; 6, soium phosphte uffer ph mm NCl; 7, swet uffer ph 5.5; 8, swet uffer ph 6.5. (g) To ssess the ntimiroil e f g tivity of n HPLC-erive swet frtion (frtion 4 in Fig. 3, protein onentrtion, 10 µg/ml), smples were inute for 4 h with ifferent miroorgnisms.the inution uffers were 10 mm phosphte uffer ph 7.4 (white rs), swet uffer ph 5.5 (hekere rs) n swet uffer ph 6.5 (fille rs). eemer 2001 volume 2 no 12 nture immunology 1135

4 We foun tht the ntimiroil tivity profile of the DCD-1L peptie ws similr in ph 5.5 phosphte uffer or with soium hlorie onentrtions of nm n in swet uffer ompre to ph 7.4 phosphte uffer (Fig. 4 f). Wheres the tivity of DCD-1L in response to E. oli roppe when teste in swet uffer or when the soium hlorie onentrtion inrese to 100 mm (Fig. 4), the ntimiroil tivity of DCD-1L ginst E. felis n S. ureus i not hnge in the ifferent inution uffers. DCD-1L h no ntiioti tivity ginst S. ureus in phosphte uffer t ph 5.5, lthough in swet uffer of the sme ph its tivity ws retine (Fig. 4 f). In ph 5.5 or 6.5 phosphte uffer, in ph 5.5 swet uffer or with soium hlorie onentrtions t mm, DCD-1L showe more tivity ginst C. lins thn it i in ph 7.4 phosphte uffer (Fig. 4f). Next, we teste the ntimiroil tivity of four protein frtions erive from humn swet fter HPLC frtiontion (Fig. 3). Wheres frtions 1 3 h no toxi effet on the miroorgnisms, frtion 4 kille ll miroorgnisms in ose-epenent mnner (Fig. 4g). With mss spetrometry n peptie sequening, we ientifie the DCD-1 peptie in frtion 4 (Fig. 3,). When swet uffers were use s inution uffers, the tivity ginst the ifferent miroorgnisms hrly hnge. The ntimiroil tivity of this peptie frtion ginst E. oli i not rop when swet uffer, ompre to phosphte uffer, ws use for inution. This ontrste with the results otine with DCD-1L, whih my hve een ue to ifferenes in the peptie sequenes euse the lst leuines in DCD-1 n DCD-1L iffere. Thus, these t inite tht humn swet ontine proteolytilly proesse DCD peptie tht h ntiioti tivity ginst severl miroorgnisms. Disussion We hve esrie here the isoltion of gene enoing n ntimiroil peptie with ro spetrum of tivity n without ny homology to known ntimiroil pepties. This protein ws speifilly n onstitutively expresse in swet glns, serete into the swet n trnsporte to the epierml surfe. In swet proteolytilly proesse DCD peptie ws present tht hs ntimiroil tivity ginst vriety of pthogeni miroorgnisms. This tivity ws mintine over ro ph rnge n in high slt onentrtions, whih resemle the onitions in humn swet. Humn swet glns re ivie into erine, porine n poerine; poerine glns shre the properties of the erine n porine glns. The erine swet gln is ompose of epithelil n myoepithelil ells tht re orgnize into the seretory oil, erml ut n epierml ut or rosyringium. The seretory oil of the erine swet gln is involve in the proution of preursor swet, whih is isotoni or slightly hypertoni n is essentilly n ultrfiltrte of plsm. The swet then psses through the oile ut, stright ut n rosyringium to the epierml surfe. During pssge through the intrerml ut the swet is moifie y seletive resorption of soium, whih minly ours within the oile ut 14. The seretory unit onsists of three ell types: ler (serous) n rk (muous) ells, whih re involve in seretion, n myoepithelil ells, whih funtion s smooth musle ells 14. The ler ells serete preursor swet vi the tive trnsport of soium into the lumen of the seretory oil, wheres the rk ells proue muins, suh s glyoproteins, tht n e foun long the erine gln lumin. The tuuli of erine glns re involve in resorption of soium n hlorie, whih results in hypotoniity of the serete swet. Swet minly onsists of wter, soium, hlorie, potssium, ure n ltte. A vriety of other sustnes my e foun in swet, inluing phrmologilly tive sustnes, inhiitors, ntigens, ntioies n rugs 14. The mjority of pepties in swet re of smll moleulr weight. The onentrtion of high moleulr weight proteins (>10 kd) is positively orrelte with the swet rte; this is ue to ifferent egree of proteolyti egrtion uring the outflow of swet, seretion of proteins from ifferent intrellulr storge sites or iffering protein synthesis 14. Immunogloulin A 15, interleukin 1 (IL-1) n IL-8 16,17, IL-6 n tumor nerosis ftor-α 18, trnsforming growth ftor β reeptor 19, epierml growth ftor 14 n proltin-inuile protein 19 hve ll een ientifie in humn swet. We etermine tht 1 10 µg/ml of the peptie DCD-1 ws present in swet, onentrtion tht prove toxi to most miroorgnisms we teste. The ntiserum we use for immunohistologil nlysis ws irete ginst peptie lote in n ntigeni region t the enter of the DCD protein ( 42 65). Thus, most likely, we h ientifie either nonproesse, full-length protein or DCD-erive peptie tht enompsse the ntigeni region. The ntiiotilly tive DCD-1 peptie lke the ntigeni eterminnt use for immuniztion n oul not e etete y the ntiserum. Therefore, it remins to e etermine whether the full-length DCD protein h lrey een proesse in the erine swet gln ells or in the swet. Beuse humn swet ontins vrious proteses 21,22 it is likely tht the DCD protein ws proesse there. The onentrtion of proteolytilly proesse peptie proly iffers etween iniviuls n is epenent on the onentrtion of proteolyti enzymes in the swet s well s the rte t whih n iniviul swets. We hve shown here tht the pepties DCD-1, whih enompsses the COOH-terminl prt of DCD ( ), n DCD-1L, whih hs n itionl leuine t the COOH en, were toxi to vrious miroorgnisms in meium tht h similr ph n ioni omposition to humn swet. In ontrst to the tivity profile of DCD-1, memers of the efensin fmily re only tive in the presene of low slt onentrtions; they re intive t high slt onentrtions 23,24. As moeling stuies suggest, like mny ntimiroil pepties inluing inset eropins, frog mginins n some mmmlin theliiins DCD is likely to opt n mphipthi α-helix 25. However, unlike most ntimiroil pepties whih re enrihe in rginine or lysine resiues n re therefore tioni 26 ntimiroil DCD-1 hs net negtive hrge of 5. Therefore, the moe of tion of this peptie in response to miroorgnisms is proly ifferent to tht of the tioni efensins, whih n in to nioni omponents of the trget memrne n kill the miroorgnisms y pore formtion n permeiliztion of the ell memrne 24. It remins to e etermine whether DCD is toxi to miroorgnisms tht re resistnt to estlishe ntiioti therpies. In onlusion, DCD-1, 47- peptie, ws proteolytilly proesse from DCD n serete y muous ells of the swet gln oil into the swet. Uner ph n slt onitions tht were hrteristi of humn swet, it ws ntimiroilly tive ginst E. oli, E. felis, S. ureus n C. lins. DCD showe no homology to known ntimiroil pepties n ws hrterize y restritive expression pttern tht ws limite to swet glns. This peptie proly plys key role in the innte immune responses of the skin. Methos Gene mpping. Humn-roent somti ell hyri (Coriell Cell Repositories, Cmen, NJ) n rition hyri mpping pnels (Stnfor Humn Genome Center, Stnfor, CA) were use to etermine the hromosoml loliztion of DCD. RNA expression nlysis of DCD. To etet DCD expression, RT-PCR ws one with RNA from vrious tissues n ell lines. Isoltion of RNA from enign melnoyti nevi, primry utneous melnom n skin tissues ws one with moifie proeure s esrie 27. In ition, DNA from the multiple tissue DNA (MTC) pnels humn I n II, humn fetl, humn igestive system n humn tumor (Clonteh, Heielerg, Germny) were nlyze y PCR. The PCR mplifition mixture ontine 5 µl of the templte, 1 Tq PCR retion uffer, 0.5 µl of Tq-polymerse (Amershm Phrmi, Freiurg, Germny), 0.4 mm NTP 1136 nture immunology volume 2 no 12 eemer

5 n 0.4 µm of eh primer. The primers we use were 5 AGCATGAGGTTCAT- GACTCTC 3 n 5 CACGCTTTCTAGATCTTCGAC 3. The PCR prout ws 290 p. As ontrol, GAPDH ws mplifie with the primers: 5 AATGCCTCCTGCACCACC 3 n 5 ATGCCAGTGAGCTTCCCG 3. The PCR onitions were 30 yles for GAPDH or yles for DCD t 96 C for 1 min, 54 C for 1 min n 72 C for 80 s. Eh PCR ws one t lest twie n inlue two negtive ontrols n t lest one positive ontrol. A 100- p mrker ws use s referene mrker in grose gel eletrophoresis (MBI Ferments, St. Leon-Rot, Germny). In situ hyriiztion, immunohistohemistry, immunofluoresene n immunogol eletron mirosopy. In situ hyriiztion ws one on 5-µm prffin tissue setions tht were fixe in formlin with single-strne ntisense or ontrol sense igoxigenin-lele proes. The proes were synthesize y in vitro trnsription of DCD DNA in pbluesript SK with the DIG RNA leling kit (Rohe, Mnnheim, Germny) n T3 n T7 RNA polymerse. Severl melnoyti nevi, iopsies of norml skin n two primry melnom were exmine. For the ientifition of DCD protein with immunohistology or immunofluoresene, 2- or 5-µm vertil prffin setions of norml skin were ehyrte, loke with norml horse serum n inute for 1 h with 1:3000 ilution of polylonl rit ntiserum to DCD. The ntiserum ws otine fter repete immuniztion with the peptie KENAGEDPGLARQAPKPRKQRSSL, whih ws ouple to keyhole limpet hemoynin. The setions were inute with iotinylte nti rit IgG (Vetor, Burlingme, CA), followe y inution with the Vetstin ABC-AP system (Vetor), evelope with neufuhsin n ounterstine with hemtoxylin. For immunofluoresene nlysis, the setions were stine with polylonl ntiserum to DCD n inute for 1 h with 1:500 ilution of Cy5-onkey nti rit serum (Dinov, Hmurg, Germny). The myoepithelil ells of the seretory oil of erine swet glns were then lele with monolonl nti-tin (Enzo Dignostis, Loxo, Dossenheim, Germny), stine with Cy3-onkey nti mouse serum (Dinov) n ll nulei were stine with YOPRO (Moleulr Proes, Leien, Netherlns). The setions were nlyze with onfol lser snning mirosope (Lei TCS SP, Lei Mirosystems, Bensheim, Germny) n mgnifie 250 times. For ultrstruturl loliztion of DCD, norml xill skin ws trete s esrie 28. The setions were ounterstine with urnyl ette n le itrte n exmine with ZEISS EM 109 eletron mirosope (Zeiss, Jen, Germny). Peptie synthesis, HPLC nlysis, mss spetrometry n protein sequening. Pepties were synthesize y the soli phse metho with the Fmo/But-strtegy on MilliGen 9050 ontinuous flow synthesizer (Millipore, Befor, MA). The leve, prouts were purifie y grient reverse phse (RP-HPLC) to purity of 95 %. Peptie ientity ws onfirme y eletrospry mss spetrometry on Finnign MAT 700 instrument (Finnign Corp., Sn Jose, CA). Isoltion of proteins from humn swet ws one s follows. Humn swet (25 ml) ws lyophilize overnight to yiel olorless, hygrosopi soli prout. The resiue ws issolve in 500 µl of 10 % eti i in wter n sonite for 1 min. Nonsoluilize mteril ws remove y entrifugtion t 10,000g for 5 min. The superntnt (100 µl) ws sujete RP-HPLC on Nuleosil C18 olumn (125 4 mm) with 5-µm prtiles n 120-Å pore size) with flow rte of 1 ml/min. Solvent A ws 0.055% queous trifluoroeti i; solvent B ws 80% etonitrile in 0.05% queous trifluoroeti i. A liner grient of 0% B to 60 % B over 40 min ws use. The resulting elution peks were ollete n onentrte with spee v to volume of 15 µl. Smples of 1 µl of eh frtion were use for MALDI-TOF nlysis (G2025A, Hewlett-Pkr, Wlronn, Germny), 2,5,-ihyroxyetophenone ws use s mtrix. The pek tht elute t min ws highly homogeneous n ontine the DCD-1 peptie (whih h moleulr mss of kd). This frtion ws nlyze y utomte Emn egrtion with n Applie Biosystems 494 protein sequener. (Applie Biosystems-MDS Siex, Conor, Cn). Nnoeletrospry mss spetrometry ws one on n QSTAR Pulsr i QqoTof mss spetrometer (Applie Biosystems-MDS Siex) with meium Protn NnoES spry pillries. For tnem mss spetrometry experiments, the resolution of the first qurupole ws set to trnsmit the isotopi envelope of the ion of interest. Nitrogen ws use s the ollision gs. For Emn mirosequening, liquots of the HPLC frtions were pplie onto TFA-trete glss filter iss tht were ote with 0.75 mg of polyrene, rie n sequene in protein sequener Proise 494A (Applie Biosystems, Weiterstt, Germny) following the mnufturer s protools. Antimiroil ssy. The ntimiroil tivity of DCD-1L, Y-P30, DPI n four swet frtions ws nlyze with olony-forming unit ssy s esrie 13 ; E. oli, S. ureus, E. felis n C. lins were ssesse. E. oli were grown in LB meium, E. felis n S. ureus in Columi meium (Difo, BD Heielerg, Germny) n C. lins in seinhyrolyste meium (Merk, Drmstt, Germny). The teril n yest onentrtions were etermine photometrilly. Bteril strins were ulture to n A600 of n the yest strin to n A450 of Before nlysis, we etermine the onentrtion of the orgnisms in ulture y plting ifferent teril n yest ilutions. At A600, 1.0 orrespone to /ml for E. oli, /ml for S. ureus n /ml for E. felis. At A450, 1 orrespone to /ml for C. lins. Cells were wshe twie with 10 mm soium phosphte uffer (ph 7.4) n ilute to onentrtion of ells/ml (for E. oli, E. felis n C. lins) or ells/ml (for S. ureus) in phosphte uffer. Cells were inute t 37 C for 4 h with vrious onentrtions of pepties or swet frtions (protein onentrtion, 10 µg/ml) in 200 µl of soium phosphte uffer. The ells were ilute 1:50 500, n 50 µl n 100 µl of the solutions were plte in uplite on gr pltes. At lest four pltes from eh experiment were evlute n the men numer of olonies etermine. The teriil tivity of the teste regents were expresse s: [1 (ell survivl fter peptie inution)/(ell survivl fter ontrol peptie inution)] 100, whih represente the perentge of ells tht were kille. To exmine the tivity profile of DCD-1L n the ntiioti swet frtion tht ontine DCD-1, we inute the miroorgnisms for 4 h with 10 µg/ml of DCD-1L or swet frtion uner the following onitions. Phosphte uffer (10 mm) + either 25, 100 or 150 mm soium hlorie; phosphte uffer (10 mm) t ph 5.5, 6.5 or 7.4; swet uffer (40 mm NCl, 10 mm KCl, 1 mm CCl2, 1 mm MgCl2 n 1mM N-ihyrogenphosphte) t ph 5.5 or 6.5. Then ntimiroil tivity ws ssesse s outline ove. Gennk ession numer. The Gennk ession numer for the DCD DNA sequene we ientifie is AF Another group hs lso eposite DCD sequene, the ession numer for this t is AY Aknowlegements We thnk T. Iftner n ollegues for DNA sequening; M. Shwrz n ollegues for the use of rioisotopes n Phosphorimger; B. Fehrenher n H. Bishof for eletron mirosopy;a. Norheim for mss spetrometry; E. Mzey for tehnil ssistne; n P. Gött,T. Pul, M. Strk n F. Lng for isussions. Supporte y the Fortüne-progrm of the Eerhr-Krls-University Tüingen ( ), the Bunesministerium für Bilung un Forshung (IZKF, Fö01KS9602) n the Deutshe Forshungsgemeinshft (SFB510). Reeive 8 June 2001; epte 11 Otoer Gllo, R. L. et l. Synens, ell surfe heprn sulfte proteoglyns, re inue y proline-rih ntimiroil peptie from wouns. Pro. Ntl A. Si. USA 91, (1994). 2. Hrer, J., Brtels, J., Christophers, E. & Shroer, J. M.A peptie ntiioti from humn skin. Nture 387, 861 (1997). 3. Frohm, M. et l. The expression of the gene oing for the ntiteril peptie LL-37 is inue in humn kertinoytes uring inflmmtory isorers. J. Biol. Chem. 272, (1997). 4. Hnok, R. E. & Lehrer, R. Ctioni pepties: new soure of ntiiotis. Trens Biotehnol. 16, (1998). 5. Jones, D. E. & Bevins, C. L. Defensin-6 mrna in humn Pneth ells: implitions for ntimiroil pepties in host efense of the humn owel. FEBS Lett. 315, (1993). 6. Hrer, J., Brtels, J., Christophers, E. & Shroer, J. M. Isoltion n hrteriztion of Humn β- Defensin-3, novel humn inuile peptie ntiioti. J. Biol. Chem. 276, (2000). 7. Hipfel, R., Shittek, B., Boinguer,Y. & Gre, C. Speifilly regulte genes in mlignnt melnom tissues ientifie y sutrtive hyriiztion. Br. J. Cner 82, (2000). 8. Toorov, P. et l. Chrteriztion of ner heti ftor. Nture 379, (1996). 9. Toorov, P.T., Deon, M. & Tisle, M. J. Struturl nlysis of tumor-proue sulfte glyoprotein ple of inititing musle protein egrtion. J. Biol. Chem. 272, (1997). 10. Cunninghm,T. J. et l. Ientifition of survivl-promoting peptie in meium onitione y oxitively stresse ell lines of nervous system origin. J. Neurosi. 18, (1998). 11. Cunninghm,T. J., Jing, H.,Wng,Y. & Hoge, L. Clretiulin ining n other iologil tivities of survivl peptie Y-P30 inluing effets of systemi tretment of rts. Exp. Neurol. 163, (2000). 12. Bls, R. Epithelil ntimiroil pepties in host efense ginst infetion. Respir. Res. 1, (2000). 13. Vlore, E.V. et l. Humn β-efensin-1: n ntimiroil peptie of urogenitl tissues. J. Clin. Invest. 101, (1998). 14. Sto, K., Kng,W. H., Sg, K. & Sto, K.T. Biology of swet glns n their isorers. I. Norml swet gln funtion. J.Am.A. Dermtol. 20, (1989). 15. Ok,T., Konishi, H., Ito, M., Ngur, H. & Asi, J. Ientifition of seretory immunogloulin A in humn swet n swet glns. J. Invest. Dermtol. 90, (1988). 16. Jones,A. P.,We, L. M.,Anerson,A. O., Leonr, E. J. & Rot,A. Norml humn swet ontins interleukin-8. J. Leuko. Biol. 57, (1995). 17. Diierjen, L. et l. Biologilly tive interleukin 1 in humn erine swet: site-epenent vritions in lph/et rtios n stress-inue inrese exretion. Cytokine 2, (1990). 18. Ahme,A.A., Norlin, K., Shultzerg, M. & Lien, S. Interleukin-1α- n β-, interleukin-6- n tumour nerosis ftor-β-like immunoretivities in hroni grnulomtous skin onitions. At Derm.Venereol. 74, (1994). 19. Wollin, U. et l. Erine swet glns: expression of trnsforming growth ftor-β n one morphogeneti protein type I reeptors n their intrellulr signlling Sm proteins. At Derm.Venereol. 79, (1999). 20. Myl,Y. et l. The proltin-inuile protein (PIP/GCDFP-15) gene: loning, struture n regultion. Mol. Cell. Enorinol. 80, (1991). 21. Frki, J. E. Humn skin proteses. Seprtion n hrteriztion of two i proteses resemling thepsin B1 n thepsin D n of n inhiitor of thepsin B1. Arh. Dermtol. Res. 255, (1976). 22. Frki, J. E., Jnsen, C.T. & Hopsu-Hvu,V. K. Humn swet kllikrein. Biohemil emonstrtion n hromtogrphi seprtion from severl other esteropeptises in the swet. At Derm.Venereol. 50, (1970). 23. Golmn, M. J. et l. Humn β-efensin-1 is slt-sensitive ntiioti in lung tht is intivte in ysti firosis. Cell 88, (1997). 24. Gllo, R. L. & Huttner, K. M.Antimiroil pepties: n emerging onept in utneous iology. J. Invest. Dermtol. 111, (1998). 25. Tossi,A., Snri, L. & Gingspero,A.Amphipthi α-helil ntimiroil pepties. Biopolymers 55, 4 30 (2000). 26. Hnok, R. E. & Lehrer, R. Ctioni pepties: new soure of ntiiotis.trens Biotehnol. 16, (1998). 27. Hipfel, R., Gre, C. & Shittek, B. RNA isoltion from humn skin tissues for olorimetri ifferentil isply. J. Biohem. Biophys. Meth. 37, (1998). 28. Shumurg-Lever, G. Ultrstruturl loliztion of letin-ining sites in norml skin. J. Invest. Dermtol. 94, (1990). eemer 2001 volume 2 no 12 nture immunology 1137

Evaluation of chemical and biological consequences of soil sterilization methods

Evaluation of chemical and biological consequences of soil sterilization methods Cspin J. Env. Si. 27, Vol. 5 No.2 pp. 87~91 Copyright y The University of Guiln, Printe in I.R. Irn [Reserh] CJES Cspin Journl of Environmentl Sienes Evlution of hemil n iologil onsequenes of soil steriliztion

More information

GENERAL OPERATING PRINCIPLES

GENERAL OPERATING PRINCIPLES KEYSECUREPC USER MANUAL N.B.: PRIOR TO READING THIS MANUAL, YOU ARE ADVISED TO READ THE FOLLOWING MANUAL: GENERAL OPERATING PRINCIPLES Der Customer, KeySeurePC is n innovtive prout tht uses ptente tehnology:

More information

Word Wisdom Correlations to the Common Core State Standards, Grade 6

Word Wisdom Correlations to the Common Core State Standards, Grade 6 Reing Stnrs for Informtionl Text Key Ies n Detils 1 Cite textul eviene to support nlysis of wht the text sys expliitly s well s inferenes rwn from the text. 6, 7, 12, 13, 18, 19, 28, 29, 34, 35, 40, 41,

More information

CHAPTER 31 CAPACITOR

CHAPTER 31 CAPACITOR . Given tht Numer of eletron HPTER PITOR Net hrge Q.6 9.6 7 The net potentil ifferene L..6 pitne v 7.6 8 F.. r 5 m. m 8.854 5.4 6.95 5 F... Let the rius of the is R re R D mm m 8.85 r r 8.85 4. 5 m.5 m

More information

Dcx reexpression reduces subcortical band heterotopia and seizure threshold in an animal model of neuronal migration disorder

Dcx reexpression reduces subcortical band heterotopia and seizure threshold in an animal model of neuronal migration disorder Dx reexpression reues suortil n heterotopi n seizure threshol in n niml moel of neuronl migrtion isorer Jen-Bernr Mnent, Yu Wng, YoonJeung Chng, Murugn Prmsivm & Joseph J LoTuro 29 Nture Ameri, In. All

More information

British Journal of Nutrition

British Journal of Nutrition (2013), 110, 981 987 q The Authors 2013 doi:10.1017/s0007114512006174 Post-exerise whey protein hydrolyste supplementtion indues greter inrese in musle protein synthesis thn its onstituent mino id ontent

More information

Maximum area of polygon

Maximum area of polygon Mimum re of polygon Suppose I give you n stiks. They might e of ifferent lengths, or the sme length, or some the sme s others, et. Now there re lots of polygons you n form with those stiks. Your jo is

More information

MATH PLACEMENT REVIEW GUIDE

MATH PLACEMENT REVIEW GUIDE MATH PLACEMENT REVIEW GUIDE This guie is intene s fous for your review efore tking the plement test. The questions presente here my not e on the plement test. Although si skills lultor is provie for your

More information

2. Use of Internet attacks in terrorist activities is termed as a. Internet-attack b. National attack c. Cyberterrorism d.

2. Use of Internet attacks in terrorist activities is termed as a. Internet-attack b. National attack c. Cyberterrorism d. Moule2.txt 1. Choose the right ourse of tion one you feel your mil ount is ompromise?. Delete the ount b. Logout n never open gin. Do nothing, sine no importnt messge is there. Chnge psswor immeitely n

More information

OxCORT v4 Quick Guide Revision Class Reports

OxCORT v4 Quick Guide Revision Class Reports OxCORT v4 Quik Guie Revision Clss Reports This quik guie is suitble for the following roles: Tutor This quik guie reltes to the following menu options: Crete Revision Clss Reports pg 1 Crete Revision Clss

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Lyer-speifi exittory iruits differentilly ontrol reurrent network dynmis in the neoortex Rirdo Beltrmo, Giuli D Urso, Mro Dl Mshio, Psqulin Frisello, Seren Bovetti, Yonne Clovis,

More information

The activating effect of IFN-c on monocytes/macrophages is regulated by the LIF trophoblast IL-10 axis via Stat1 inhibition and Stat3 activation

The activating effect of IFN-c on monocytes/macrophages is regulated by the LIF trophoblast IL-10 axis via Stat1 inhibition and Stat3 activation Cellulr & Moleulr Immunology (214), 1 16 ß 214 CSI n USTC. All rights reserve 1672-7681/14 $32. www.nture.om/mi RESEARCH ARTICLE The tivting effet of IFN- on monoytes/mrophges is regulte y the LIF tropholst

More information

MODAL VARIATIONS WITHIN GRANITIC OUTCROPS D. O. EruBnsoN, Department of Geology, Uni'ttersity of C alif ornia, Dattis, C ali'f orni,a'

MODAL VARIATIONS WITHIN GRANITIC OUTCROPS D. O. EruBnsoN, Department of Geology, Uni'ttersity of C alif ornia, Dattis, C ali'f orni,a' THE AMERICAN MINERALOGIST, VOL. 49, SEPTEMBER-OCTOBER' 1964 MODAL VARIATIONS WITHIN GRANITIC OUTCROPS D. O. EruBnsoN, Deprtment of Geology, Uni'ttersity of C lif orni, Dttis, C li'f orni,' Aestnr The soure

More information

Biophysical mechanism of T-cell receptor triggering in a reconstituted system

Biophysical mechanism of T-cell receptor triggering in a reconstituted system ARTICLE oi:1.138/nture1122 Biophysil mehnism of T-ell reeptor triggering in reonstitute system John R. Jmes 1 & Ronl D. Vle 1 A T-ell-meite immune response is initite y the T-ell reeptor () interting with

More information

A new form of long-term depression in the perirhinal cortex

A new form of long-term depression in the perirhinal cortex rtiles A new form of long-term epression in the perirhinl ortex K. Cho 1, N. Kemp 1, J. Noel 1,2, J. P. Aggleton 3, M. W. Brown 1 n Z. I. Bshir 1 1 MRC Centre for Synpti Plstiity, Dept. of Antomy, University

More information

DiaGen: A Generator for Diagram Editors Based on a Hypergraph Model

DiaGen: A Generator for Diagram Editors Based on a Hypergraph Model DiGen: A Genertor for Digrm Eitors Bse on Hypergrph Moel G. Viehstet M. Mins Lehrstuhl für Progrmmiersprhen Universität Erlngen-Nürnerg Mrtensstr. 3, 91058 Erlngen, Germny Emil: fviehste,[email protected]

More information

1 Fractions from an advanced point of view

1 Fractions from an advanced point of view 1 Frtions from n vne point of view We re going to stuy frtions from the viewpoint of moern lger, or strt lger. Our gol is to evelop eeper unerstning of wht n men. One onsequene of our eeper unerstning

More information

Visualization of characteristics of the contact network between spheres in 3D assembly

Visualization of characteristics of the contact network between spheres in 3D assembly Int. Agrophys., 2013, 27, 275-281 oi: 10.2478/v10247-012-0095-6 INTERNATIONAL Agrophysis www.interntionl-grophysis.org Visuliztion of hrteristis of the ontt network etween spheres in 3D ssemly R. Koy³k*

More information

Citation for the original published paper (version of record): Creative Commons CC BY 3.0: http://creativecommons.org/licenses/by/3.

Citation for the original published paper (version of record): Creative Commons CC BY 3.0: http://creativecommons.org/licenses/by/3. http://www.iv-portl.org This is the pulishe version of pper pulishe in Physiologil Reports. Cittion for the originl pulishe pper (version of reor): Jensen, L., Gejl, K., Ørtenl, N., Nielsen, J., Beh, R.

More information

The art of Paperarchitecture (PA). MANUAL

The art of Paperarchitecture (PA). MANUAL The rt of Pperrhiteture (PA). MANUAL Introution Pperrhiteture (PA) is the rt of reting three-imensionl (3D) ojets out of plin piee of pper or ror. At first, esign is rwn (mnully or printe (using grphil

More information

Fluent Merging: A General Technique to Improve Reachability Heuristics and Factored Planning

Fluent Merging: A General Technique to Improve Reachability Heuristics and Factored Planning Fluent Merging: A Generl Tehnique to Improve Rehility Heuristis n Ftore Plnning Menkes vn en Briel Deprtment of Inustril Engineering Arizon Stte University Tempe AZ, 85287-8809 [email protected] Suro Kmhmpti

More information

OUTLINE SYSTEM-ON-CHIP DESIGN. GETTING STARTED WITH VHDL August 31, 2015 GAJSKI S Y-CHART (1983) TOP-DOWN DESIGN (1)

OUTLINE SYSTEM-ON-CHIP DESIGN. GETTING STARTED WITH VHDL August 31, 2015 GAJSKI S Y-CHART (1983) TOP-DOWN DESIGN (1) August 31, 2015 GETTING STARTED WITH VHDL 2 Top-down design VHDL history Min elements of VHDL Entities nd rhitetures Signls nd proesses Dt types Configurtions Simultor sis The testenh onept OUTLINE 3 GAJSKI

More information

Abbott RealTime 2N40 HBV 51-608234/R1. Customer Service: 1-800-553-7042. Key to symbols used

Abbott RealTime 2N40 HBV 51-608234/R1. Customer Service: 1-800-553-7042. Key to symbols used Aott RelTime 2N40 51-608234/R1 HBV Customer Servie: 1-800-553-7042 This pkge insert must e red refully prior to use. Pkge insert instrutions must e followed ordingly. Reliility of ssy results nnot e gurnteed

More information

ORGANIZER QUICK START GUIDE

ORGANIZER QUICK START GUIDE NOTES ON USING GOTOWEBINAR GoToWeinr orgnizers my hol Weinrs for up to 1,000 ttenees. The Weinr proess n e roken into three stges: Weinr Plnning, Weinr Presenttion n Weinr Follow-up. Orgnizers nee to first

More information

Hydromagnetic Unsteady Mixed Convection Flow Past an Infinite Vertical Porous Plate

Hydromagnetic Unsteady Mixed Convection Flow Past an Infinite Vertical Porous Plate pplie Mthemtis. ; (): 39-45 DO:.593/j.m..5 Hyromgneti Unstey Mixe Convetion Flo Pst n nfinite ertil Porous Plte B.. Shrm T. Chn R. C. Chuhry Deprtment of Mthemtis Birl nstitute of Tehnology & Siene Pilni

More information

JCM TRAINING OVERVIEW Multi-Download Module 2

JCM TRAINING OVERVIEW Multi-Download Module 2 Multi-Downlo Moule 2 JCM Trining Overview Mrh, 2012 Mrh, 2012 CLOSING THE MDM2 APPLICATION To lose the MDM2 Applition proee s follows: 1. Mouse-lik on the 'File' pullown Menu (See Figure 35 ) on the MDM2

More information

On Equivalence Between Network Topologies

On Equivalence Between Network Topologies On Equivlene Between Network Topologies Tre Ho Deprtment of Eletril Engineering Cliforni Institute of Tehnolog [email protected]; Mihelle Effros Deprtments of Eletril Engineering Cliforni Institute of Tehnolog

More information

Volumes by Cylindrical Shells: the Shell Method

Volumes by Cylindrical Shells: the Shell Method olumes Clinril Shells: the Shell Metho Another metho of fin the volumes of solis of revolution is the shell metho. It n usull fin volumes tht re otherwise iffiult to evlute using the Dis / Wsher metho.

More information

Determinants of Chlorpyrifos Exposures and Urinary 3,5,6-Trichloro-2-Pyridinol Levels Among Termiticide Applicators

Determinants of Chlorpyrifos Exposures and Urinary 3,5,6-Trichloro-2-Pyridinol Levels Among Termiticide Applicators Ann. oup. Hyg., Vol. 45, No. 4, pp. 309 321, 2001 Pulishe y Elsevier Siene Lt on ehlf of British Ouptionl Hygiene Soiety Printe in Gret Britin. 0003-4878/01/$20.00 PII: S0003-4878(01)00026-6 Determinnts

More information

Module 5. Three-phase AC Circuits. Version 2 EE IIT, Kharagpur

Module 5. Three-phase AC Circuits. Version 2 EE IIT, Kharagpur Module 5 Three-hse A iruits Version EE IIT, Khrgur esson 8 Three-hse Blned Suly Version EE IIT, Khrgur In the module, ontining six lessons (-7), the study of iruits, onsisting of the liner elements resistne,

More information

Distinct contribution of stem and progenitor cells to epidermal maintenance

Distinct contribution of stem and progenitor cells to epidermal maintenance ARTICLE doi:1.138/nture11393 Distint ontriution of stem nd progenitor ells to epiderml mintenne Guilhem Msré 1, Sophie Dekonink 1, Benjmin Drogt 1, Khlil Kss Youssef 1, Sylvin Brohée 1,2, Pngiot A. Sotiropoulou

More information

Revised products from the Medicare Learning Network (MLN) ICD-10-CM/PCS Myths and Facts, Fact Sheet, ICN 902143, downloadable.

Revised products from the Medicare Learning Network (MLN) ICD-10-CM/PCS Myths and Facts, Fact Sheet, ICN 902143, downloadable. DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Meire & Meii Servies Revise prouts from the Meire Lerning Network (MLN) ICD-10-CM/PCS Myths n Fts, Ft Sheet, ICN 902143, ownlole. MLN Mtters Numer: SE1325

More information

Rotating DC Motors Part II

Rotating DC Motors Part II Rotting Motors rt II II.1 Motor Equivlent Circuit The next step in our consiertion of motors is to evelop n equivlent circuit which cn be use to better unerstn motor opertion. The rmtures in rel motors

More information

Corrigendum-II Dated:19.05.2011

Corrigendum-II Dated:19.05.2011 10(21)/2010-NICSI NATIONAL INFORMATICS CENTRE SERVICES In. (NICSI) (A Government of Ini Enterprise uner NIC) Ministry of Communition & Informtion Tehnology Hll 2 & 3, 6 th Floor, NBCC Tower 15, Bhikiji

More information

1. Definition, Basic concepts, Types 2. Addition and Subtraction of Matrices 3. Scalar Multiplication 4. Assignment and answer key 5.

1. Definition, Basic concepts, Types 2. Addition and Subtraction of Matrices 3. Scalar Multiplication 4. Assignment and answer key 5. . Definition, Bsi onepts, Types. Addition nd Sutrtion of Mtries. Slr Multiplition. Assignment nd nswer key. Mtrix Multiplition. Assignment nd nswer key. Determinnt x x (digonl, minors, properties) summry

More information

Lesson 2.1 Inductive Reasoning

Lesson 2.1 Inductive Reasoning Lesson.1 Inutive Resoning Nme Perio Dte For Eerises 1 7, use inutive resoning to fin the net two terms in eh sequene. 1. 4, 8, 1, 16,,. 400, 00, 100, 0,,,. 1 8, 7, 1, 4,, 4.,,, 1, 1, 0,,. 60, 180, 10,

More information

Effect of Polyunsaturated Fatty Acids on Doxorubicin Cytotoxicity in Glioma Cells in vitro*

Effect of Polyunsaturated Fatty Acids on Doxorubicin Cytotoxicity in Glioma Cells in vitro* originl ppers Adv Clin Exp Med 2010, 19, 4, 481 487 ISSN 1230-025X Copyright y Wrolw Medil University Alij Zjdel 1, Adm Wilzok 1, Młgorzt Ltoh 2, Zofi Dzierżewiz 1 Effet of Polyunsturted Ftty Aids on Doxoruiin

More information

Copia autorizada por CDR

Copia autorizada por CDR IL-7 ts on DCs to suppress the T ell response nd utoimmunity y induing expression of the immunoregultory moleule CD9 Ivn D Msnfroni,, Ad Yeste,, Silvio M Vieir, Evn J Burns, Bonny Ptel, Ido Slom, Yn Wu,

More information

Angles 2.1. Exercise 2.1... Find the size of the lettered angles. Give reasons for your answers. a) b) c) Example

Angles 2.1. Exercise 2.1... Find the size of the lettered angles. Give reasons for your answers. a) b) c) Example 2.1 Angles Reognise lternte n orresponing ngles Key wors prllel lternte orresponing vertilly opposite Rememer, prllel lines re stright lines whih never meet or ross. The rrows show tht the lines re prllel

More information

Original Research. Immunohistochemical panel for differentiating renal cell carcinoma with clear and papillary features. Hanan AlSaeid Alshenawy

Original Research. Immunohistochemical panel for differentiating renal cell carcinoma with clear and papillary features. Hanan AlSaeid Alshenawy Originl Reserh Journl of Moleulr Pthophysiology www.sopemed.org DOI: 10.5455/jmp.20141017015551 Immunohistohemil pnel for differentiting renl ell rinom with ler nd ppillry fetures Hnn AlSeid Alshenwy Deprtment

More information

Plant Physiology and Biochemistry

Plant Physiology and Biochemistry Plnt Physiology nd Biohemistry 52 (2012) 38e51 Contents lists vilble t SiVerse SieneDiret Plnt Physiology nd Biohemistry journl homepge: www.elsevier.om/lote/plphy Reserh rtile Retive oxygen speies from

More information

Step-by-step full mouth rehabilitation of a nasopharyngeal carcinoma patient with tooth and implant-supported prostheses: A clinical report

Step-by-step full mouth rehabilitation of a nasopharyngeal carcinoma patient with tooth and implant-supported prostheses: A clinical report [Downloe free from http://www.ontemplinent.org on Wenesy, July 17, 2013, IP: 164.100.31.82] Clik here to ownlo free Anroi pplition for this journl Step-y-step full mouth rehilittion of nsophryngel rinom

More information

Swelling and Mechanical Properties of Hydrogels Composed of. Binary Blends of Inter-linked ph-responsive Microgel Particles

Swelling and Mechanical Properties of Hydrogels Composed of. Binary Blends of Inter-linked ph-responsive Microgel Particles Eletroi Supplemetry Mteril (ESI) for Soft Mtter. This jourl is The Royl Soiety of Chemistry 205 SUPPLEMENTARY INFRMATIN Swellig Mehil Properties of Hyrogels Compose of Biry Bles of Iter-like ph-resposive

More information

Formal concept analysis-based class hierarchy design in object-oriented software development

Formal concept analysis-based class hierarchy design in object-oriented software development Forml onept nlysis-se lss hierrhy esign in ojet-oriente softwre evelopment Roert Goin 1, Petko Vlthev 2 1 Déprtement informtique, UQAM, C.P. 8888, su. Centre Ville, Montrél (Q), Cn, H3C 3P8 2 DIRO, Université

More information

Boğaziçi University Department of Economics Spring 2016 EC 102 PRINCIPLES of MACROECONOMICS Problem Set 5 Answer Key

Boğaziçi University Department of Economics Spring 2016 EC 102 PRINCIPLES of MACROECONOMICS Problem Set 5 Answer Key Boğziçi University Deprtment of Eonomis Spring 2016 EC 102 PRINCIPLES of MACROECONOMICS Prolem Set 5 Answer Key 1. One yer ountry hs negtive net exports. The next yer it still hs negtive net exports n

More information

Bidirectional processing of pri-mirnas with branched terminal loops by Arabidopsis Dicer-like1

Bidirectional processing of pri-mirnas with branched terminal loops by Arabidopsis Dicer-like1 Bidiretionl proessing of pri-mirnas with rnhed terminl loops y Aridopsis Dier-like Hongling Zhu 3, Yuyi Zhou,2,4, Cludi Cstillo-González,2, Amer Lu,2, Chunxio Ge 2,5, Ying-To Zho 6, Liusheng Dun 4, Zhohu

More information

- DAY 1 - Website Design and Project Planning

- DAY 1 - Website Design and Project Planning Wesite Design nd Projet Plnning Ojetive This module provides n overview of the onepts of wesite design nd liner workflow for produing wesite. Prtiipnts will outline the sope of wesite projet, inluding

More information

85 BACTERIAL ENDOTOXINS TEST

85 BACTERIAL ENDOTOXINS TEST Offiil April 1, 2011 85 Bteril Enotoxins Test 1 85 BACTERIAL ENDOTOXINS TEST Portions of this generl hpter hve een hrmonize with the orresponing texts of the Europen Phrmopoei n/or the Jpnese Phrmopoei.

More information

Antibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening

Antibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Q. Wht re nturlly occurring or expected ntiodies? Q. Wht re typicl or unexpected

More information

Vectors Summary. Projection vector AC = ( Shortest distance from B to line A C D [OR = where m1. and m

Vectors Summary. Projection vector AC = ( Shortest distance from B to line A C D [OR = where m1. and m . Slr prout (ot prout): = osθ Vetors Summry Lws of ot prout: (i) = (ii) ( ) = = (iii) = (ngle etween two ientil vetors is egrees) (iv) = n re perpeniulr Applitions: (i) Projetion vetor: B Length of projetion

More information

Lesson 1: Getting started

Lesson 1: Getting started Answer key 0 Lesson 1: Getting strte 1 List the three min wys you enter t in QuikBooks. Forms, lists, registers 2 List three wys to ess fetures in QuikBooks. Menu r, Ion Br, Centers, Home pge 3 Wht ookkeeping

More information

Calculating Principal Strains using a Rectangular Strain Gage Rosette

Calculating Principal Strains using a Rectangular Strain Gage Rosette Clulting Prinipl Strins using Retngulr Strin Gge Rosette Strin gge rosettes re used often in engineering prtie to determine strin sttes t speifi points on struture. Figure illustrtes three ommonly used

More information

c b 5.00 10 5 N/m 2 (0.120 m 3 0.200 m 3 ), = 4.00 10 4 J. W total = W a b + W b c 2.00

c b 5.00 10 5 N/m 2 (0.120 m 3 0.200 m 3 ), = 4.00 10 4 J. W total = W a b + W b c 2.00 Chter 19, exmle rolems: (19.06) A gs undergoes two roesses. First: onstnt volume @ 0.200 m 3, isohori. Pressure inreses from 2.00 10 5 P to 5.00 10 5 P. Seond: Constnt ressure @ 5.00 10 5 P, isori. olume

More information

Enterprise Digital Signage Create a New Sign

Enterprise Digital Signage Create a New Sign Enterprise Digitl Signge Crete New Sign Intended Audiene: Content dministrtors of Enterprise Digitl Signge inluding stff with remote ess to sign.pitt.edu nd the Content Mnger softwre pplition for their

More information

6. developed the process that separated morphine from opium in 1803. a. F.W. Serturner b. Thomas DeQuincey c. Alder Wright d.

6. developed the process that separated morphine from opium in 1803. a. F.W. Serturner b. Thomas DeQuincey c. Alder Wright d. 1. The plnt from whih opium is me is.. Ppver somniferum. Cnnis stiv. ellonn. psiloyin mushrooms REFERENCES: pge 238 2. Opium omes from the.. mgi mushroom. mesl en. poppy. morning glory sees REFERENCES:

More information

Activation of insulin-like growth factor I receptor-mediated pathway by ginsenoside Rg1

Activation of insulin-like growth factor I receptor-mediated pathway by ginsenoside Rg1 British Journl of Phrmology (6) 147, 54 551 & 6 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.nture.om/jp Ativtion of insulin-like growth ftor I reeptor-medited pthwy y ginsenoside 1, Wen-Fng

More information

50 MATHCOUNTS LECTURES (10) RATIOS, RATES, AND PROPORTIONS

50 MATHCOUNTS LECTURES (10) RATIOS, RATES, AND PROPORTIONS 0 MATHCOUNTS LECTURES (0) RATIOS, RATES, AND PROPORTIONS BASIC KNOWLEDGE () RATIOS: Rtios re use to ompre two or more numers For n two numers n ( 0), the rtio is written s : = / Emple : If 4 stuents in

More information

StyleView SV32 Change Power System Batteries

StyleView SV32 Change Power System Batteries F the ltest User Instlltion Guie n StyleLink Softwre Downlo plese visit: Enontrrá l versión más reiente el mnul e instlión el usurio y el softwre e StyleLink en: Si vous souhitez téléhrger le ernier mnuel

More information

SECTION 7-2 Law of Cosines

SECTION 7-2 Law of Cosines 516 7 Additionl Topis in Trigonometry h d sin s () tn h h d 50. Surveying. The lyout in the figure t right is used to determine n inessile height h when seline d in plne perpendiulr to h n e estlished

More information

BEC TESTS Gli ascolti sono disponibili all indirizzo www.loescher.it/business

BEC TESTS Gli ascolti sono disponibili all indirizzo www.loescher.it/business Gli solti sono disponiili ll indirizzo www.loesher.it/usiness SURNAME AND NAME CLASS DATE BEC TEST Prt one Questions 1-8 For questions 1-8 you will her eight short reordings. For eh question, hoose one

More information

Granulocyte Colony-Stimulating Factor (Filgrastim) Treatment Primes for Increased ex Vivo Inducible Prostanoid Release

Granulocyte Colony-Stimulating Factor (Filgrastim) Treatment Primes for Increased ex Vivo Inducible Prostanoid Release Grnuloyte Colony-Stimulting Ftor (Filgrstim) Tretment Primes for Inresed ex Vivo Induile Prostnoid Relese Sonj von Aulok, Ev-Mri Boneerg, Isel Diterih, nd Thoms Hrtung Biohemil Phrmology, University of

More information

The homologous HD-Zip I transcription factors HaHB1 and AtHB13 confer cold tolerance via the induction of pathogenesis-related and glucanase proteins

The homologous HD-Zip I transcription factors HaHB1 and AtHB13 confer cold tolerance via the induction of pathogenesis-related and glucanase proteins The Plnt Journl (2012) 69, 141 153 doi: 10.1111/j.1365-313X.2011.04778.x The homologous HD-Zip I trnsription ftors HHB1 nd AtHB13 onfer old tolerne vi the indution of pthogenesis-relted nd glunse proteins

More information

Computing the 3D Voronoi Diagram Robustly: An Easy Explanation

Computing the 3D Voronoi Diagram Robustly: An Easy Explanation Computing the 3D Voronoi Digrm Roustly: An Esy Explntion Hugo Leoux Delft University of Tehnology (OTB setion GIS Tehnology) Jffln 9, 2628BX Delft, the Netherlns [email protected] Astrt Mny lgorithms exist

More information

S-Scrum: a Secure Methodology for Agile Development of Web Services

S-Scrum: a Secure Methodology for Agile Development of Web Services Worl of Computer Siene n Informtion Tehnology Journl (WCSIT) ISSN: 2221-0741 Vol. 3, No. 1, 15-19, 2013 S-Srum: Seure Methoology for Agile Development of We Servies Dvou Mougouei, Nor Fzli Moh Sni, Mohmm

More information

Metabolomic changes in fatty liver can be modified by dietary protein and calcium during energy restriction

Metabolomic changes in fatty liver can be modified by dietary protein and calcium during energy restriction Online Sumissions: wjg.wjgnet.om World J Gstroenterol 28 July 28; 14(28): 4462-4472 [email protected] World Journl of Gstroenterology ISSN 17-9327 doi:1.3748/wjg.14.4462 28 The WJG Press. All rights reserved.

More information

European Convention on Social and Medical Assistance

European Convention on Social and Medical Assistance Europen Convention on Soil nd Medil Assistne Pris, 11.XII.1953 Europen Trety Series - No. 14 The governments signtory hereto, eing memers of the Counil of Europe, Considering tht the im of the Counil of

More information

letters Solution structure of the DNA-binding domain of MafG

letters Solution structure of the DNA-binding domain of MafG letters Solution struture of the DNA-inding domin of MfG Hideki Kusunoki 1,2, Hozumi Motohshi 1,2, umiki Ktsuok 1, Akio Morohshi 3,4, Msyuki Ymmoto 1,2 nd Toshiyuki Tnk 2,3 1 Institute of Bsi Medil Siene,

More information

ELECTROVALUE: a LCA Approach

ELECTROVALUE: a LCA Approach A Network of Tehnology n Qulity NASA/C3P 2009 Interntionl Workshop on Environment n Alterntive ti Energy Globl Collbortion in Environmentl n Alterntive Energy Strtegies Assessment of WEEE Reuse in ELECTROVALUE:

More information

COMPONENTS: COMBINED LOADING

COMPONENTS: COMBINED LOADING LECTURE COMPONENTS: COMBINED LOADING Third Edition A. J. Clrk School of Engineering Deprtment of Civil nd Environmentl Engineering 24 Chpter 8.4 by Dr. Ibrhim A. Asskkf SPRING 2003 ENES 220 Mechnics of

More information

Euler Hermes Services Ireland Ltd. Terms & Conditions of Business for your Debt Collection Services

Euler Hermes Services Ireland Ltd. Terms & Conditions of Business for your Debt Collection Services Euler Hermes Servies Ireln Lt Terms & Conitions of Business for your Det Colletion Servies Contents Terms n Conitions of Business 1 The Servies 1 EHCI s Oligtions 1 Client s Oligtions 1 Soliitors 2 Fees

More information

KEY SKILLS INFORMATION TECHNOLOGY Level 3. Question Paper. 29 January 9 February 2001

KEY SKILLS INFORMATION TECHNOLOGY Level 3. Question Paper. 29 January 9 February 2001 KEY SKILLS INFORMATION TECHNOLOGY Level 3 Question Pper 29 Jnury 9 Ferury 2001 WHAT YOU NEED This Question Pper An Answer Booklet Aess to omputer, softwre nd printer You my use ilingul ditionry Do NOT

More information

Answer, Key Homework 10 David McIntyre 1

Answer, Key Homework 10 David McIntyre 1 Answer, Key Homework 10 Dvid McIntyre 1 This print-out should hve 22 questions, check tht it is complete. Multiple-choice questions my continue on the next column or pge: find ll choices efore mking your

More information

PLWAP Sequential Mining: Open Source Code

PLWAP Sequential Mining: Open Source Code PL Sequentil Mining: Open Soure Code C.I. Ezeife Shool of Computer Siene University of Windsor Windsor, Ontrio N9B 3P4 ezeife@uwindsor. Yi Lu Deprtment of Computer Siene Wyne Stte University Detroit, Mihign

More information

GUIDELINES. under THE PRIVATE HOSPITALS AND MEDICAL CLINICS ACT (1980) AND REGULATIONS (1991) MINISTRY OF HEALTH SINGAPORE

GUIDELINES. under THE PRIVATE HOSPITALS AND MEDICAL CLINICS ACT (1980) AND REGULATIONS (1991) MINISTRY OF HEALTH SINGAPORE GUIDELINES uner THE PRIVATE HOSPITALS AND MEDICAL CLINICS ACT (1980) AND REGULATIONS (1991) MINISTRY OF HEALTH SINGAPORE GUIDELINES FOR PRIVATE HOSPITALS, MEDICAL CLINICS AND CLINICAL LABORATORIES uner

More information

Small Businesses Decisions to Offer Health Insurance to Employees

Small Businesses Decisions to Offer Health Insurance to Employees Smll Businesses Decisions to Offer Helth Insurnce to Employees Ctherine McLughlin nd Adm Swinurn, June 2014 Employer-sponsored helth insurnce (ESI) is the dominnt source of coverge for nonelderly dults

More information

The Integrated Competencies for Dietetic Education and Practice ICDEP. Developed by the Partnership for Dietetic Education and Practice

The Integrated Competencies for Dietetic Education and Practice ICDEP. Developed by the Partnership for Dietetic Education and Practice The Integrte Competenies for Dieteti Eution n Prtie ICDEP Develope y the Supporte in prt y grnt from Humn Resoures & Skills Development Cn Version 2.0 April 2013 Tle of Contents Purpose... 1 Definitions

More information

Study on enzyme-assisted aqueous extraction of oil from soybean

Study on enzyme-assisted aqueous extraction of oil from soybean 8 Journl Scientific & Industril Reserch J SCI IND RES VOL 69 NOVEMBER 2010 Vol. 69, November 2010, pp. 8-865 Study on enzyme-ssisted queous extrction oil from soyben Jun-Qing Qin*, De-Hui Qin, Xing-Mo

More information

The design and functionalization of porous materials have

The design and functionalization of porous materials have ARTCLES PUBLSHED ONLNE: 26 AUGUST 22 DO:.38/NMAT344 Mroporous nnowire nnoeletroni sffolds for sntheti tissues Bozhi Tin,2,3, Ji Liu, Tl Dvir 2,4, Lihu Jin, Jonthn H. Tsui 2, Qun Qing, Zhigng Suo, Roert

More information

Data Security 1. 1 What is the function of the Jump instruction? 2 What are the main parts of the virus code? 3 What is the last act of the virus?

Data Security 1. 1 What is the function of the Jump instruction? 2 What are the main parts of the virus code? 3 What is the last act of the virus? UNIT 18 Dt Seurity 1 STARTER Wht stories do you think followed these hedlines? Compre nswers within your group. 1 Love ug retes worldwide hos. 2 Hkers rk Mirosoft softwre odes. 3 We phone sm. Wht other

More information

Innovation in Software Development Process by Introducing Toyota Production System

Innovation in Software Development Process by Introducing Toyota Production System Innovtion in Softwre Development Proess y Introduing Toyot Prodution System V Koihi Furugki V Tooru Tkgi V Akinori Skt V Disuke Okym (Mnusript reeived June 1, 2006) Fujitsu Softwre Tehnologies (formerly

More information

COVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION

COVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION COVER CROP VARIETY AND SEEDING RATE EFFECTS ON WINTER WEED SEED PRODUCTION Nthn S. Boyd nd Eric B. Brennn, USDA-ARS, Orgnic Reserch Progrm, 1636 E. Alisl Street, Slins, CA 93905 Astrct Weed mngement is

More information

THE LONGITUDINAL FIELD IN THE GTEM 1750 AND THE NATURE OF THE TERMINATION.

THE LONGITUDINAL FIELD IN THE GTEM 1750 AND THE NATURE OF THE TERMINATION. THE LONGITUDINAL FIELD IN THE GTEM 175 AND THE NATURE OF THE TERMINATION. Benjmin Guy Loder Ntionl Physil Lbortory, Queens Rod, Teddington, Middlesex, Englnd. TW11 LW Mrtin Alexnder Ntionl Physil Lbortory,

More information

WHAT HAPPENS WHEN YOU MIX COMPLEX NUMBERS WITH PRIME NUMBERS?

WHAT HAPPENS WHEN YOU MIX COMPLEX NUMBERS WITH PRIME NUMBERS? WHAT HAPPES WHE YOU MIX COMPLEX UMBERS WITH PRIME UMBERS? There s n ol syng, you n t pples n ornges. Mthemtns hte n t; they love to throw pples n ornges nto foo proessor n see wht hppens. Sometmes they

More information

Ratio and Proportion

Ratio and Proportion Rtio nd Proportion Rtio: The onept of rtio ours frequently nd in wide vriety of wys For exmple: A newspper reports tht the rtio of Repulins to Demorts on ertin Congressionl ommittee is 3 to The student/fulty

More information