Comparison of Y-chromosomal lineage dating using either evolutionary
|
|
|
- Catherine Barnett
- 10 years ago
- Views:
Transcription
1 Comparison of Y-chromosomal lineage dating using either evolutionary or genealogical Y-STR mutation rates Chuan-Chao Wang 1, Hui Li 1,* 1 State Key Laboratory of Genetic Engineering and MOE Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai , China *Corresponding authors. Tel: Fax: (H.Li). addresses: [email protected] Abstract We have compared the Y chromosomal lineage dating between sequence data and commonly used Y-SNP plus Y-STR data. The coalescent times estimated using evolutionary Y-STR mutation rates correspond best with sequence-based dating when the lineages include the most ancient haplogroup A individuals. However, the times using slow mutated STR markers with genealogical rates fit well with sequence-based estimates in main lineages, such as haplogroup CT, DE, K, NO, IJ, P, E, C, I, J, N, O, and R. In addition, genealogical rates lead to more plausible time estimates for Neolithic coalescent sublineages compared with sequence-based dating. Keywords Y chromosome, Y-STR mutation rate, time estimation, Batwing Introduction The paternally inherited Y chromosome has been widely used in anthropology and population genetics to understand demographic history of human populations (Wang and Li, 2013). There are two kinds of extremely useful markers in Y chromosome, single nucleotide polymorphism (SNP) and short tandem repeat (STR). Over the last two decades, SNP and STR have been widely used in Y-chromosomal diversity studies (Jobling and Tyler-Smith, 2003). The most important link between genetic diversity and human history is time, for instance, the time when a lineage originated or expanded, or when a population split from another and migrated. Y-STR has also been used in time estimation for SNP lineages. Although this approach is widely used, there are still many ongoing debates about the best way to use STRs in lineage dating. In particular, there are two popularly used Y chromosomal STR mutation rates, that is, the genealogical rate and the evolutionary rate. The genealogical rates are directly observed rates in deep-rooted pedigrees or father-son pairs (Wei et al., 2013a; Zhivotovsky et al., 2004). The evolutionary rates are those calibrated against historical events, such as the divergence of the Maoris and Cook Islanders in the Pacific (Zhivotovsky et al., 2004). To choose which kind of mutation rate in the Y chromosome dating is controversial, since different rates can result in several -fold deviation. With the advent of next-generation sequencing technology, Y chromosomes of numerous human individuals have been entirely sequenced recently (Wei et al., 2013b; Poznik et al., 2013;
2 Francalacci et al., 2013; Yan et al., 2013; 1000 Genomes Project Consortium, 2012). The increasing large amount of Y chromosomal sequence data provides a very good opportunity to evaluate the previously proposed different kind of Y-STR mutation rates in time estimation (Wei et al., 2013a). Here, we have compared the Y chromosomal lineage dating between sequence data and commonly used Y-SNP plus Y-STR data using Batwing. Materials and methods The 1000 genomes dataset: About 8.9Mb sequence data on the unique regions of Y chromosome of the 377 male individuals were extracted from the 1000 Genomes Project Phase I from publicly accessible FTP sites (1000 Genomes Project Consortium, 2012) (supplementary table.1). Y chromosomal haplogroups classification (Van Geystelen et al., 2013), maximum likelihood tree construction (Guindon et al., 2010), and divergence time calculation (Drummond et al., 2002; Drummond and Rambaut, 2007) were following our previous works (Yan et al., 2013; Wang et al., 2013a). The STR data is also downloaded from FTP sites of 1000 Genome Project. The 23 STRs are the same as reported in Wei et al (2013). Median-joining networks (Bandelt et al., 1999) of haplotypes consisting of 21 YSTRs and 35 Y-SNPs were constructed using Network (Fluxus Engineering). Li Jin lab dataset: We selected 78 samples from our previous next-generation sequencing dataset, covering most sublineages of Haplogroup O, as well as Haplogroup C, D, G, J, N, Q, and R (Yan et al., 2013). Seventeen Y chromosome STRs were amplified using the AmpFlSTR Yfiler PCR Amplification kit and analyzed (Yan S and Wang CC et al., unpublished data). The details about next generation data analysis, phylogenetic tree calculation, and time estimation have been reported in our previous work (Yan et al., 2013). In addition, 366 male individuals belonging to haplogroup Oγ-F11 from widely distributed East Asian populations were also included in the Batwing analysis (Wang et al., 2013b). Time estimation for each Y chromosomal lineage were made using BATWING (Wilson et al., 2003) based on Y-SNP plus Y-STR method, under a model of exponential growth from an initially constant-sized population. The parameters used in estimation were following Xue et al (2006). Five sets of Y-STR mutation rates were applied in time estimations as Wei et al did (Wei et al., 2013a). These are a widely used evolutionary mutation rate (EMR) (Zhivotovsky et al., 2004), a recalibrated evolutionary mutation rate (remr) (Shi et al., 2010), two observed genealogical mutation rates (OMRB and OMRS) (Burgarella et al., 2011; Shi et al., 2010), and a genealogical mutation rate adjusted for population variation using logistic model (lmmr) (Burgarella et al., 2011). A total of 10 4 samples of the program s output representing 10 6 MCMC cycles were taken after discarding the first 3x10 3 samples as burn-in. The Time to the Most Recent Common Ancestor (TMRCA) is calculated using the product of the estimated population size N and the height of the tree T (in coalescent units) (Wilson et al., 2003). A generation time of 25 years was used to produce a time estimate in years. Pearson s correlation coefficient (r), Spearman s rank correlation coefficient (rho), and their significance were calculated using R (
3 Results The 377 male individuals extracted from the 1000 Genomes Project contain haplogroup A, B, C, D, E, G, I, J, N, O, Q, R, and T, and thus give a good representation of worldwide paternal lineages. The topology of maximum likelihood tree of those samples is congruent with the existing human Y chromosome tree (fig.1a, supplementary fig.1). The length of the branch in the tree is proportional to the number of mutations, and therefore also informative about the times when lineages diverged. The branch length between haplogroup A and out-of-africa primary haplogroup CT is extremely long, implying they have diverged since a very long time ago. A great number of branches have emerged in the near terminal of the tree, which gives a signal of recent population expansion. The within lineage population expansions are also observed in the Y-STR network, especially in lineage R1b1a2a1a2, E1b1a1a1f1a, E1b1a1a1g, O2b, N1c1a1a2a, and I1a1b (fig.1b). However, the Y-STR network fails to reveal the ancient phylogenetic structure correctly. Haplogroup A individual has not been placed in a very long branch in the network as suggested in the maximum likelihood SNP tree. Haplogroup G is grouped with haplogroup C, and haplogroup T is placed in the same branch with Q and R in the network. Haplogroup R branches from haplogroup Q, with the SNP M242 that defines Q being assigned as recurrent. The similar situation has also been observed in haplogroup D and E, I and J in the network tree. As the mutation rates of STR markers are about four to five orders of magnitude higher than SNPs, the sequence-based phylogenetic tree is much more reliable. The obvious inconsistency between sequence-based and STR-based tree remind us that there might be some bias in Y-chromosomal lineage dating using STR data. To infer the time depth of Y-chromosomal lineages, we calculated the date of each divergence event throughout the sequence-based tree using Bayesian method. The time to the most recent common ancestor (TMRCA) for all the 377 Y chromosomes estimated was thousand years ago (kya) (95% CI: kya). This is consistent with the published estimate of 105 kya (Cruciani et al., 2011) and kya (Wei et al., 2013b) for haplogroup A1b1b2b-M219. The next most important split point is the out-of-africa superhaplogroup CT, which we date here at kya (95% CI: kya). This corresponds well to our previous estimation of CT using 78 East Asian Y chromosomes at 3.9 Mbp of the NRY (54.1 kya with 95% CI: kya) (Yan et al., 2013). Only 2 ky later, DE branched off from CT. Most of other main branches (K, NO, IJ, P, E, C, I, J, O, and R) emerged between kya. A great number of sublineages branched off from the above main haplogroups in Neolithic time. We then compared sequence-based time estimation with Y-SNP plus Y-STR based dating. We first used 21 STR markers in Batwing estimation. The TMRCA of all the 377 Y chromosomes estimated using evolutionary STR mutation rates is kya, slightly higher than sequence-based TMRCA. However, the estimations using three genealogical mutation rates give the date almost 4-5 times lower than sequence-based TMRCA. This point is consistent with Wei et al s observation (Wei et al., 2013a). However, the ages for other main lineages (CT, DE, K, NO, IJ, P, E, C, I, J, N, O, and R) show large gaps with both the times estimated using evolutionary and genealogical STR mutation rates. The times using evolutionary rates show a slightly better correlation with the sequence-based estimation than using genealogical rates at the Y
4 chromosomal main lineage level (EMR: Pearson s r=0.892, Spearman s rho=0.940, p=1.878e-6; remr: Pearson s r=0.872, Spearman s rho=0.907, p=1.930e-5; OMRB: Pearson s r= 0.878, Spearman s rho=0.923, p=6.852e-6; OMRS: Pearson s r=0.865, Spearman s rho=0.896, p=3.481e-5; lmmr: Pearson s r=0.860, Spearman s rho=0.879, p=7.545e-5). For the sublineages coalesced in Neolithic Time (C3e, and from D2a1b to R1b1a2a1a2 in x-axis of fig.2a), the TMRCAs based on three genealogical rates are much more consistent with sequence-based TMRCAs than those based on evolutionary rates. At the sublineages level, the ages estimated using genealogical rates have a slightly better correlation with sequence-based estimation (EMR: Pearson's r=0.651, Spearman's rho=0.558, p=0.016; remr: Pearson's r=0.652, Spearman's rho=0.622, p=0.006; OMRB: Pearson's r=0.688, Spearman's rho=0.659, p=0.003; OMRS: Pearson's r=0.715, Spearman's rho=0.661, p=0.003; lmmr: Pearson's r=0.649, Spearman's rho=0.548, p=0.004). We next took two ways to see whether the time estimation using genealogical Y-STR mutation rates really corresponds best with sequence-based dating for Neolithic coalescent sublineages. In our previous work, we found three strong star-like Neolithic lineage expansions (Oα, Oβ, and Oγ) at about kya through sequencing 78 East Asian Y chromosomes at 3.9 Mbp of NRY 12. We used 15 STRs of the 78 individuals to do lineages dating. One evolutionary rate and three genealogical rates are used in Batwing (EMR and remr are the same for the 15 STRs we used). The results are very similar with the above analysis using 1000 genome dataset. The sequence-based TMRCAs for Oα, Oβ, and Oγ are almost the same with those estimated using genealogical STR rates, but 3-4 times younger than the times calculated with evolutionary rate. We then validated this result by estimating the TMRCA of 366 individuals belonging to haplogroup Oγ-F11 using 10 STRs (Wang et al., 2013b) in Batwing. This approach is to eliminate the possible bias in time estimation due to small sample size. The TMRCA of Oγ using genealogical rates is around 10 kya, however, TMRCA with evolutionary rate is even more than 30 kya (EMR: median=34.1, mean=46.0, sd=15.6; OMRB: median=11.1, mean=13.9, sd=3.29; OMRS: median=9.30, mean=11.7, sd=2.50; lmmr: median=9.40, mean=12.4, sd=3.87 in kya). The TMRCAs using genealogical rates are more close to that estimated with our previous sequencing data. We have noticed that TMRCAs for main lineages show large gaps with both the times estimated using evolutionary and genealogical STR mutation rates. This phenomenon reminds us that the evolutionary rate (6.9E-4 per locus per generation) might be too low and the genealogical rates might be too high in for time estimation of main lineages. As the genealogical rates are calculated from multiple pedigrees, each marker has an individual mutation rate, ranging from 4.0E-4 to 1.6E-2 per locus per generation. There might be some Y-STRs lead to more reliable estimates for the above main lineages. We then classified the 21 STRs of 1000 genome samples into two subsets according to their mutation rates: the first ten markers with higher rates are assigned as fast markers, the last ten markers with lower rates are assigned as slow markers (DYS389b was exclude in the analysis). We redid the time estimation in Batwing using fast and slow markers, respectively. The TMRCAs using fast markers (fig.3a) show a very similar pattern with those using combined markers (fig.2a), but the times using evolutionary rates are higher than previous estimates. However, the TMRCAs using slow markers fit well with sequence-based estimates (fig.3b) and are also highly correlated (OMRB: Pearson's r=0.898, Spearman's rho=0.956, p=
5 3.365E-7; OMRS: Pearson's r=0.870, Spearman's rho=0.940, p= 1.878E-6) in main lineages. Discussion In this study, we have compared the Y chromosomal lineage dating between sequence data and commonly used Y-SNP plus Y-STR data in Batwing. The TMRCAs using evolutionary Y-STR mutation rates correspond best with sequence-based dating when the lineages include the most ancient haplogroup A individuals. However, the TMRCAs using slow mutated STR markers with genealogical rates fit well with sequence-based estimates in main lineages, such as haplogroup CT, DE, K, NO, IJ, P, E, C, I, J, N, O, and R. Genealogical rates give times that are more similar to sequence-based dating for Neolithic coalescent sublineages, such as R1b1a2a1a2, E1b1a1a1f1a, E1b1a1a1g, Oα, Oβ, and Oγ. The conclusion drawn from our study is not an omnipotent rule in Y chromosomal lineage dating. First, all the analysis are calculated in Batwing using stepwise mutation model (SMM) for all the STRs. However, Different time estimation methods use different algorithms and assumptions, thus alternative methods probably fit more or less well with sequence data in time estimations. In addition, the best-fit mutation model might vary for different STRs. Second, some specific lineages might have their own unique best-fit STR mutation rates for time estimation. For instance, TMRCAs for many main lineages show large gaps with both the times estimated using evolutionary and genealogical STR mutation rates. However, the TMRCA for haplogroup E is about 43.8 kya, which is more consistent with the time estimated using evolutionary rates (fig.2a). Acknowledgements This work was supported by the National Excellent Youth Science Foundation of China ( ), National Natural Science Foundation of China ( , ), Shanghai Rising-Star Program (12QA ), Shanghai Commission of Education Research Innovation Key Project (11zz04), and Shanghai Professional Development Funding ( ).
6 Fig.1a. Phylogenetic tree of human Y chromosome. This tree was constructed using 377 samples sequenced in 1000 Genomes Project. The branch lengths are proportional to the number of SNPs on the branch. For more details, see supplementary fig.1; Fig.1b. Median-joining network representing the relationships between 377 Y chromosomes based on 35 variable Y-SNPs (classified the following haplogroups: A, B, CT, CF, DE, C, C1, C3, D, E, E1a, E1b1a1a1g, E1b1a1a1f, E2, F, G, IJ, I, I1, I2, J, K, NO, N, O, O1, O2, O2b, O3, T, P, R, R1a, R1b, Q) and 21 Y-STRs. Each circle represents a haplotype and has an area proportional to its frequency.
7 Fig.2a. Comparison of TMRCAs based on Y-SNP and 21 Y-STRs using five different Y-STR mutation rates in 377 samples of 1000 genome project, with the dates estimated based on sequence data. The duplicated locus DYS385 was not used in these analyses, and DYS389 was treated as DYS389I and DYS389b (DYS389II minus DYS389I). Fig.2b. Comparison of TMRCAs based on Y-SNP and 15 Y-STRs (DYS385a and DYS385b were also not used) using four different Y-STR mutation rates in 78 East Asian samples of Li Jin lab, with the dates estimated based on sequence data. For more details, see supplementary table.2
8 Fig.3a. Comparison of TMRCAs based on Y-SNP and 10 fast mutated Y-STRs using four different Y-STR mutation rates in 377 samples of 1000 genome project, with the dates estimated based on sequence data. Fig.3b. Comparison of TMRCAs based on Y-SNP and 10 slow mutated Y-STRs using three different Y-STR mutation rates in 377 samples of 1000 genome project, with the dates estimated based on sequence data. For more details, see supplementary table.2
9 References 1000 Genomes Project Consortium An integrated map of genetic variation from 1,092 human genomes. Nature 491: Bandelt HJ, Forster P, Röhl A Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol. 16: Burgarella C1, Navascués M Mutation rate estimates for 110 Y-chromosome STRs combining population and father-son pair data. Eur J Hum Genet. 19: Cruciani F, Trombetta B, Massaia A, Destro-Bisol G, Sellitto D, Scozzari R A revised root for the human Y chromosomal phylogenetic tree:the origin of patrilineal diversity in Africa. Am J Hum Genet. 88: Francalacci P, Morelli L, Angius A, Berutti R, Reinier F, Atzeni R, Pilu R, Busonero F, Maschio A, Zara I, et al Low-pass DNA sequencing of 1200 Sardinians reconstructs European Y-chromosome phylogeny. Science 341: Drummond AJ, Nicholls GK, Rodrigo AG, Solomon W Estimating mutation parameters, population history and genealogy simultaneously from temporally spaced sequence data. Genetics 161: Drummond AJ, Rambaut A BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol. 7: 214. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst Biol. 59: Jobling MA, Tyler-Smith C The human Y chromosome: an evolutionary marker comes of age. Nat. Rev. Genet. 4: Poznik GD, Henn BM, Yee MC, Sliwerska E, Euskirchen GM, Lin AA, Snyder M, Quintana-Murci L, Kidd JM, Underhill PA, et al Sequencing Y chromosomes resolves discrepancy in time to common ancestor of males versus females. Science 341: Shi W, Ayub Q, Vermeulen M, Shao RG, Zuniga S, van der Gaag K, de Knijff P, Kayser M, Xue Y, Tyler-Smith C A worldwide survey of human male demographic history based on Y-SNP and Y-STR data from the HGDP-CEPH populations. Mol Biol Evol. 27: Van Geystelen A, Decorte R, Larmuseau MH AMY-tree: an algorithm to use whole genome SNP calling for Y chromosomal phylogenetic applications. BMC Genomics. 14: 101. Wang CC, Li H Inferring Human History in East Asia from Y Chromosomes. Investig Genet. 4:11. Wang CC, Huang Y, Wen SQ, Chen C, Jin L, Li H. 2013a. Agriculture driving male expansion in Neolithic Time. arxiv preprint arxiv: Wang CC, Yan S, Qin ZD, Lu Y, Ding QL, Wei LH, Li SL, Yang YJ, Jin L, Li H; the Genographic Consortium. 2013b. Late Neolithic expansion of ancient Chinese revealed by Y chromosome haplogroup O3a1c J Syst Evol. 51: Wei W, Ayub Q, Xue Y, Tyler-Smith C. 2013a. A comparison of Y-chromosomal lineage dating using either resequencing or Y-SNP plus Y-STR genotyping. Forensic Sci Int Genet. 7: Wei W, Ayub Q, Chen Y, McCarthy S, Hou Y, Carbone I, Xue Y, Tyler-Smith C. 2013b. A calibrated human Y-chromosomal phylogeny based on resequencing. Genome Res. 23: Wilson IJ, Weale ME, Balding DJ Inferences from DNA data: population histories, evolutionary processes and forensic match probabilities. J. R. Stat. Soc. 116:
10 Xue Y, Wang Q, Long Q, Ng BL, Swerdlow H, Burton J, Skuce C, Taylor R, Abdellah Z, Zhao Y, et al Human Y chromosome base-substitution mutation rate measured by direct sequencing in a deep-rooting pedigree. Curr Biol. 19: Xue Y, Zerjal T, Bao W, Zhu S, Shu Q, Xu J, Du R, Fu S, Li P, Hurles ME, Yang H, Tyler-Smith C Male demography in East Asia: a north-south contrast in human population expansion times. Genetics 172: Yan S, Wang CC, Zheng HX, Wang W, Qin ZD, Wei LH, Wang Y, Pan XD, Fu WQ, He YG, et al Y Chromosomes of 40% Chinese Are Descendants of Three Neolithic Super-grandfathers. arxiv preprint arxiv: Zhivotovsky LA, Underhill PA, Cinnioğlu C, Kayser M, Morar B, Kivisild T, Scozzari R, Cruciani F, Destro-Bisol G, Spedini G, et al The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Am J Hum Genet. 74:
Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft
Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Manuscript Number: Title: A comment on the Paper: A comparison of Y-chromosomal lineage dating using either resequencing
Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing
Short Communication Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing T.C. Vieira 1,2,3,4, M.A.D. Gigonzac 2,3,4, D.M. Silva
Y Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine.
Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. The past two decades have witnessed an explosion of human genetic data. Innumerable
DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method
DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method Anatole A. Klyosov 1 Abstract Origin of peoples in a context of DNA genealogy is
What s in a name? Y chromosomes, surnames, and the genetic genealogy. Department of Genetics, University of Leicester, University Road, Leicester
What s in a name? Y chromosomes, surnames, and the genetic genealogy revolution Turi E. King and Mark A. Jobling Department of Genetics, University of Leicester, University Road, Leicester LE1 7RH, UK
The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample.
DNA testing Thanks for your enquiry about DNA testing. I oversee the Scottish DNA Project on behalf of the University of Strathclyde, Glasgow and act as representative for Family Tree DNA who host our
Online Y-chromosomal Short Tandem Repeat Haplotype Reference Database (YHRD) for U.S. Populations*
Manfred Kayser, 1 Ph.D.; Silke Brauer; 1 Sascha Willuweit; 2 Hiltrud Schädlich, 1 Ph.D.; Mark A. Batzer, 3 Ph.D.; Jennifer Zawacki; 4 Mechthild Prinz, 4 M.D.; Lutz Roewer, 2 Ph.D.; and Mark Stoneking,
Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the
Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has
Bayesian coalescent inference of population size history
Bayesian coalescent inference of population size history Alexei Drummond University of Auckland Workshop on Population and Speciation Genomics, 2016 1st February 2016 1 / 39 BEAST tutorials Population
I Have the Results of My Genetic Genealogy Test, Now What?
I Have the Results of My Genetic Genealogy Test, Now What? Version 2.1 1 I Have the Results of My Genetic Genealogy Test, Now What? Chapter 1: What Is (And Isn t) Genetic Genealogy? Chapter 2: How Do I
Biomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
From Africa to Aotearoa Part 1: Out of Africa
From Africa to Aotearoa Part 1: Out of Africa The spread of modern humans out of Africa started around 65,000 years ago, and ended with the settlement of New Zealand 750 years ago. These PowerPoint presentations
Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland
Am. J. Hum. Genet. 67:697 717, 2000 Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland Agnar Helgason, 1 Sigrún Sigurðardóttir, 3 Jayne Nicholson, 2 Bryan Sykes, 2 Emmeline W.
Presentation by: Ahmad Alsahaf. Research collaborator at the Hydroinformatics lab - Politecnico di Milano MSc in Automation and Control Engineering
Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen 9-October 2015 Presentation by: Ahmad Alsahaf Research collaborator at the Hydroinformatics lab - Politecnico di
Combining Data from Different Genotyping Platforms. Gonçalo Abecasis Center for Statistical Genetics University of Michigan
Combining Data from Different Genotyping Platforms Gonçalo Abecasis Center for Statistical Genetics University of Michigan The Challenge Detecting small effects requires very large sample sizes Combined
A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
REVIEWS. Computer programs for population genetics data analysis: a survival guide FOCUS ON STATISTICAL ANALYSIS
FOCUS ON STATISTICAL ANALYSIS REVIEWS Computer programs for population genetics data analysis: a survival guide Laurent Excoffier and Gerald Heckel Abstract The analysis of genetic diversity within species
The Functional but not Nonfunctional LILRA3 Contributes to Sex Bias in Susceptibility and Severity of ACPA-Positive Rheumatoid Arthritis
The Functional but not Nonfunctional LILRA3 Contributes to Sex Bias in Susceptibility and Severity of ACPA-Positive Rheumatoid Arthritis Yan Du Peking University People s Hospital 100044 Beijing CHINA
Paternity Testing. Chapter 23
Paternity Testing Chapter 23 Kinship and Paternity DNA analysis can also be used for: Kinship testing determining whether individuals are related Paternity testing determining the father of a child Missing
A New Method for Traffic Forecasting Based on the Data Mining Technology with Artificial Intelligent Algorithms
Research Journal of Applied Sciences, Engineering and Technology 5(12): 3417-3422, 213 ISSN: 24-7459; e-issn: 24-7467 Maxwell Scientific Organization, 213 Submitted: October 17, 212 Accepted: November
DNA as a Biometric. Biometric Consortium Conference 2011 Tampa, FL
DNA as a Biometric Biometric Consortium Conference 2011 Tampa, FL September 27, 2011 Dr. Peter M. Vallone Biochemical Science Division National Institute of Standards and Technology Gaithersburg, MD 20899
Online Supplement to Polygenic Influence on Educational Attainment. Genotyping was conducted with the Illumina HumanOmni1-Quad v1 platform using
Online Supplement to Polygenic Influence on Educational Attainment Construction of Polygenic Score for Educational Attainment Genotyping was conducted with the Illumina HumanOmni1-Quad v1 platform using
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
A Nomenclature System for the Tree of Human Y-Chromosomal Binary Haplogroups
Resource A Nomenclature System for the Tree of Human Y-Chromosomal Binary Haplogroups The Y Chromosome Consortium 1 The Y chromosome contains the largest nonrecombining block in the human genome. By virtue
Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis
Hum Genet (2005) 117: 428 443 DOI 10.1007/s00439-005-1333-9 ORIGINAL INVESTIGATION Manfred Kayser Æ Oscar Lao Æ Katja Anslinger Christa Augustin Æ Grazyna Bargel Æ Jeanett Edelmann Sahar Elias Æ Marielle
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Reduced-Median-Network Analysis of Complete Mitochondrial DNA Coding-Region Sequences for the Major African, Asian, and European Haplogroups
Am. J. Hum. Genet. 70:1152 1171, 2002 Reduced-Median-Network Analysis of Complete Mitochondrial DNA Coding-Region Sequences for the Major African, Asian, and European Haplogroups Corinna Herrnstadt, 1
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium
A Method of Cloud Resource Load Balancing Scheduling Based on Improved Adaptive Genetic Algorithm
Journal of Information & Computational Science 9: 16 (2012) 4801 4809 Available at http://www.joics.com A Method of Cloud Resource Load Balancing Scheduling Based on Improved Adaptive Genetic Algorithm
Development of a Web-based Information Service Platform for Protected Crop Pests
Development of a Web-based Information Service Platform for Protected Crop Pests Chong Huang 1, Haiguang Wang 1 1 Department of Plant Pathology, China Agricultural University, Beijing, P. R. China 100193
Rethinking Polynesian Origins: Human Settlement of the Pacific
LENScience Senior Biology Seminar Series Rethinking Polynesian Origins: Human Settlement of the Pacific Michal Denny, and Lisa Matisoo-Smith Our Polynesian ancestors are renowned as some of the world s
Applications of improved grey prediction model for power demand forecasting
Energy Conversion and Management 44 (2003) 2241 2249 www.elsevier.com/locate/enconman Applications of improved grey prediction model for power demand forecasting Che-Chiang Hsu a, *, Chia-Yon Chen b a
Report Concomitant Replacement of Language and mtdna in South Caspian Populations of Iran
Current Biology 16, 668 673, April 4, 2006 ª2006 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2006.02.021 Report Concomitant Replacement of Language and mtdna in South Caspian Populations of Iran
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
DNA for Defense Attorneys. Chapter 6
DNA for Defense Attorneys Chapter 6 Section 1: With Your Expert s Guidance, Interview the Lab Analyst Case File Curriculum Vitae Laboratory Protocols Understanding the information provided Section 2: Interpretation
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
SNP Essentials The same SNP story
HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
A comparison of methods for estimating the transition:transversion ratio from DNA sequences
Molecular Phylogenetics and Evolution 32 (2004) 495 503 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev A comparison of methods for estimating the transition:transversion ratio from
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
Asexual Versus Sexual Reproduction in Genetic Algorithms 1
Asexual Versus Sexual Reproduction in Genetic Algorithms Wendy Ann Deslauriers ([email protected]) Institute of Cognitive Science,Room 22, Dunton Tower Carleton University, 25 Colonel By Drive
Fault Analysis in Software with the Data Interaction of Classes
, pp.189-196 http://dx.doi.org/10.14257/ijsia.2015.9.9.17 Fault Analysis in Software with the Data Interaction of Classes Yan Xiaobo 1 and Wang Yichen 2 1 Science & Technology on Reliability & Environmental
Bayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Research on the UHF RFID Channel Coding Technology based on Simulink
Vol. 6, No. 7, 015 Research on the UHF RFID Channel Coding Technology based on Simulink Changzhi Wang Shanghai 0160, China Zhicai Shi* Shanghai 0160, China Dai Jian Shanghai 0160, China Li Meng Shanghai
PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES
Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS
Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro
Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information.
DNA-Analytik III. Genetische Variabilität
DNA-Analytik III Genetische Variabilität Genetische Variabilität Lexikon Scherer et al. Nat Genet Suppl 39:s7 (2007) Genetische Variabilität Sequenzvariation Mutationen (Mikro~) Basensubstitution Insertion
Genetics and Evolution: An ios Application to Supplement Introductory Courses in. Transmission and Evolutionary Genetics
G3: Genes Genomes Genetics Early Online, published on April 11, 2014 as doi:10.1534/g3.114.010215 Genetics and Evolution: An ios Application to Supplement Introductory Courses in Transmission and Evolutionary
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-jewish European populations
Hum Genet (2004) 114 : 354 365 DOI 10.1007/s00439-003-1073-7 354 ORIGINAL INVESTIGATION Doron M. Behar Daniel Garrigan Matthew E. Kaplan Zahra Moasher Dror Rosengarten Tatiana M. Karafet Lluis Quintana-Murci
SNPbrowser Software v3.5
Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium
GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters
GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters Michael B Miller , Michael Li , Gregg Lind , Soon-Young
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING Theo Meuwissen Institute for Animal Science and Aquaculture, Box 5025, 1432 Ås, Norway, [email protected] Summary
CASSI: Genome-Wide Interaction Analysis Software
CASSI: Genome-Wide Interaction Analysis Software 1 Contents 1 Introduction 3 2 Installation 3 3 Using CASSI 3 3.1 Input Files................................... 4 3.2 Options....................................
BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS
BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 [email protected] Genomics A genome is an organism s
( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years.
Frequently asked questions about A Genetic Atlas of Human Admixture History G. Hellenthal, G.B.J. Busby, G. Band, J.F. Wilson, C. Capelli, D. Falush, S. Myers, Science (2014) SUMMARY What is your work
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
International Language Character Code
, pp.161-166 http://dx.doi.org/10.14257/astl.2015.81.33 International Language Character Code with DNA Molecules Wei Wang, Zhengxu Zhao, Qian Xu School of Information Science and Technology, Shijiazhuang
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
A Rough Guide to BEAST 1.4
A Rough Guide to BEAST 1.4 Alexei J. Drummond 1, Simon Y.W. Ho, Nic Rawlence and Andrew Rambaut 2 1 Department of Computer Science The University of Auckland, Private Bag 92019 Auckland, New Zealand [email protected]
PRINCIPLES OF POPULATION GENETICS
PRINCIPLES OF POPULATION GENETICS FOURTH EDITION Daniel L. Hartl Harvard University Andrew G. Clark Cornell University UniversitSts- und Landesbibliothek Darmstadt Bibliothek Biologie Sinauer Associates,
An Analysis of Missing Data Treatment Methods and Their Application to Health Care Dataset
P P P Health An Analysis of Missing Data Treatment Methods and Their Application to Health Care Dataset Peng Liu 1, Elia El-Darzi 2, Lei Lei 1, Christos Vasilakis 2, Panagiotis Chountas 2, and Wei Huang
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait
TWINS AND GENETICS TWINS Heritability: Twin Studies Twin studies are often used to assess genetic effects on variation in a trait Comparing MZ/DZ twins can give evidence for genetic and/or environmental
The Haplotyping Problem: An Overview of Computational Models and Solutions
The Haplotyping Problem: An Overview of Computational Models and Solutions Paola Bonizzoni Gianluca Della Vedova Riccardo Dondi Jing Li June 16, 2008 Abstract The investigation of genetic differences among
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion
Data Mining - Evaluation of Classifiers
Data Mining - Evaluation of Classifiers Lecturer: JERZY STEFANOWSKI Institute of Computing Sciences Poznan University of Technology Poznan, Poland Lecture 4 SE Master Course 2008/2009 revised for 2010
Edlund, H., Allen, M. (2009) Y chromosomal STR analysis using Pyrosequencing technology. Forensic Science International: Genetics, 3(2):119-124
Till min familj List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I II III IV Edlund, H., Allen, M. (2009) Y chromosomal STR analysis
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics
Basic Principles of Forensic Molecular Biology and Genetics Population Genetics Significance of a Match What is the significance of: a fiber match? a hair match? a glass match? a DNA match? Meaning of
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Detailed mtdna Genotypes Permit a Reassessment of the Settlement and Population Structure of the Andaman Islands
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 136:19 27 (2008) Detailed mtdna Genotypes Permit a Reassessment of the Settlement and Population Structure of the Andaman Islands S.S. Barik, 1 R. Sahani, 1 B.V.R.
MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
Supporting Information. Phosphorus-, nitrogen- and carbon- containing polyelectrolyte complex:
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 S1 Supporting Information Phosphorus-, nitrogen- and carbon- containing polyelectrolyte complex:
DNA Sequence Alignment Analysis
Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes
