Regular Expressions and Pattern Matching
|
|
|
- Trevor Henry
- 9 years ago
- Views:
Transcription
1 Regular Expressions and Pattern Matching Regular Expression (regex): a separate language, allowing the construction of patterns. used in most programming languages. very powerful in Perl. Pattern Match: using regex to search data and look for a match. Overview: how to create regular expressions how to use them to match and extract data biological context
2 Parse files of data and information: fasta embl / genbank format html (web-pages) user input to programs So Why Regex? Check format Find illegal characters (validation) Search for sequences motifs
3 Simple Patterns place regex between pair of forward slashes (/ /). try: #!/usr/bin/perl while (<STDIN>) { if (/abc/) { print 1 >> $_ ; Run the script. Type in something that contains abc: abcfoobar Type in something that doesn't: fgh cba foobar ab c foobar print statement is returned if abc is matched within the typed input.
4 Can also match strings from files. Simple Patterns (2) genomes_desc.txt contains a few text lines containing information about three genomes. try: #!/usr/bin/perl open IN, <genomes_desc.txt ; while (<IN>) { if (/elegans/) { #match lines with this regex print; #print lines with match Parses each line in turn. Looks for elegans anywhere in line $_
5 Flexible matching There are many characters with special meanings metacharacters. star (*) matches any number of instances /ab*c/ => 'a' followed by zero or more 'b' followed by 'c' => abc or abbbbbbbc or ac plus (+) matches at least one instance /ab+c/ => 'a' followed by one or more 'b' followed by 'c' => abc or abbc or abbbbbbbbbbbbbbc NOT ac question mark (?) matches zero or one instance /ab?c/ => 'a' followed by 0 or 1 'b' followed by 'c' => abc or ac
6 More General Quantifiers Match a character a specific number or range of instances {x will match x number of instances. /ab{3c/ => abbbc {x,y will match between x and y instances. /a{2,4bc/ => aabc or aaabc or aaaabc {x, will match x+ instances. /abc{3,/ => abccc or abccccccccc or abcccccccccccccccccccccccccccccccccccccccccccccc cccccccccccccccccccccccccccccccccccccccccccccccc ccccccccccccccccccccccc
7 More metacharacters dot (.) refers to any character even tab (\t) and space but not newline (\n). /a.*c/ => 'a' followed by any number of any characters followed by 'c'
8 Escaping But I want to use these symbols in my regex!?! to use a *, +,? or. in the pattern when not a metacharacter, need to 'escape' them with a backslash. /C\. elegans/ => C. elegans only /C. elegans/ => Ca, Cb, C3, C>, C., etc... The 'delimitor' of the regex, forward slash /, and the 'escape' character, backslash \, are also metacharacters. These need to be escaped if required in regex. Important when trying to match URLs and addresses. /joe\.bloggs\@darwin\.co\.uk/ /www\.envgen\.nox\.ac\.uk\/biolinux\.html/
9 Using metacharacters. The file nemaglobins.embl contains 21 embl database files that contain a globin protein within their sequence. try: #!/usr/bin/perl $count; open IN, <nemaglobins.embl or die; while (<IN>) { if (/AC.*/) { #that's three spaces print; $count++; print total=$count\n ;
10 Grouping Patterns Can group patterns in parentheses (). Useful when coupled with quantifiers /elegans+/ => eleganssssssssssssss /(elegans)+/ => eleganselegans...elegans 1 2 n /eleg(ans){4/ => elegansansansans
11 Alternatives Want either this pattern or that pattern. Two ways: 1.) the vertical bar ' ' either the left side matches or the right side matches /(human mouse rat)/ => any string with human or mouse or rat. Combine with previous examples: /Fugu( \t)+rubripes/ matches if Fugu and rubripes are seperated by any mixture of spaces and tabs
12 2.) character class is a list of characters within '[]'. It will match any single character within the class. /[wxyz1234\t]/ => any of the nine. a range can be specified with '-' /[w-z1-4\t]/ => as above to match a hyphen it must be first in the class /[-a-za-z]/ => any letter character and a hyphen negating a character with '^' /[^z]/ => any character except z /[^abc]/ => any character except a or b or c
13 Other Shortcuts \d => any digit [0-9] \w => any word character [A-Za-z0-9_] \s => any white space [\t\n\r\f ] \D => any character except a digit [^\d] \W => any character except a word character [^\w] \S => any character except a white space [^\s] Can use any of these in conjunction with quantifiers, /\s*/ => any amount of white space
14 Using alternatives to find a hydrophobic region... try: open IN, "< nippo_sigpept.fsa" or die; while (<IN>) { if (/>/) { #a header line $count++; #keep running total of sequence number else { #not a header if (/[VILMFWCA]{8,/) { $match++; print "Hydrophobic region found in $match sequences from $count\n"; Could also have used /(V I L M F W C A){8,/
15 Revisited? So far matching against $_ Binding Operator The binding operator =~ matches the pattern on right against the string on left. Usually add the m operator (optional). $sumthing = 'Ascaris suum is a nematode'; if ($sumthing=~m/suum.*nematode/) { print this organism infects pigs!\n ;
16 Anchors /pattern/ will match anywhere in the string. Use anchors to hold pattern to a point in the string. caret ^ (shift 6) marks the beginning of string while dollar $ marks end of a string. /^elegans/ => elegans only at start of string. Not C. elegans. /Canis$/ => Canis only at end of string. Not Canis lupus. /^\s*$/ => a blank line. $ ignores new line character \n. N.B. compare use of ^ as an anchor with that in the character class.
17 Word Boundary Anchors (2) \b matches the start or end of a word. /\bmus\b/ would match mus but not musculus /la\b/ => Drosophila but not Plasmodium /\btes/ => Comamonas testosteroni but not Pan troglodytes \b ignores newline character. Be careful with full stops they're characters too!
18 Memory Variables Able to extract sections of the pattern match and store in a variable. Anything stored in parentheses () is written into a special variable. The first instance is $1, the second $2, the fourth $4 and so on. Extract from file: Organism: Homo sapiens... Extract from Perl script: while ($line=<in>) { if ($line=~m/organism:\s(\w)+\s(\w)+/) { $genus=$1; #stores Homo $species=$2; #stores sapiens
19 Substitutions Able to replace a pattern within a string with another string. Use the s operator s/abc/xyz/ => find abc and replace with xyz By default only the first instance of a match. Using 'g' modifier (global) will find and replace all instances. $line = 'abccdcbabc'; $line =~ s/abc/xyz/g; print $line; #produces xyzcdcbxyz; Run dna2rna.pl Now look at dna2rna.pl 1 2
20 dna2rna.pl #!/usr/bin/perl print "Enter DNA sequence\n"; while ($line = <STDIN>) { chomp $line; #remove trailing \n if ($line=~m/[^agct]/i){ #case insensitive infered by 'i' #modifier print "your sequence contained an invalid nucleotide: $&\nplease try again\n"; #'$&' is a special variable which stores what the #regular expression matched. Don't worry about it for now. else { $line=~s/t/u/g; #replace all lower case 't' $line=~s/t/u/g; #replace all upper case 'T' print "The RNA sequence is:\n$line\n"; print Try again or ctrl C to quit\n ;
21 EMBL file revisited using shortcuts and anchors to help make more robust: if (/AC.*/) { #that's three spaces can be rewritten as; if (/^AC\s{3(.*)\n$/){ #more certain to return what you want $accession=$1; #now have info stored to use later.
22 Now Its Your Turn :o) nemaglobins.embl contains entries for complete cds of nematode sequences. Foreach entry print the ACcession, OrganiSm name and AGCT content of the SeQuence. Output should read: Accession: AC00000 <tab> Species: Toxocara canis <newline> A: 34 G: 65 C: 24 T: 75 <newline><newline> Hints: The lines of interest are AC, OS, and SQ. Three regular expressions - one for each query. Use a series of if and elsif loops to search for regular expressions. Print when matched. Bonus point - remove the semi-colon from the accession id. Shout if need help.
Lecture 18 Regular Expressions
Lecture 18 Regular Expressions Many of today s web applications require matching patterns in a text document to look for specific information. A good example is parsing a html file to extract tags
Regular Expressions. In This Appendix
A Expressions In This Appendix Characters................... 888 Delimiters................... 888 Simple Strings................ 888 Special Characters............ 888 Rules....................... 891
?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
NGS data format NGS data format @SRR031028.1708655 GGATGATGGATGGATAGATAGATGAAGAGATGGATGGATGGGTGGGTGGTATGCAGCATACCTGAAGTGC BBBCB=ABBB@BA=?BABBBBA??B@BAAA>ABB;@5=@@@?8@:==99:465727:;41'.9>;933!4 @SRR031028.843803
Using Regular Expressions in Oracle
Using Regular Expressions in Oracle Everyday most of us deal with multiple string functions in Sql. May it be for truncating a string, searching for a substring or locating the presence of special characters.
Regular Expressions. General Concepts About Regular Expressions
Regular Expressions This appendix explains regular expressions and how to use them in Cisco IOS software commands. It also provides details for composing regular expressions. This appendix has the following
Perl in a nutshell. First CGI Script and Perl. Creating a Link to a Script. print Function. Parsing Data 4/27/2009. First CGI Script and Perl
First CGI Script and Perl Perl in a nutshell Prof. Rasley shebang line tells the operating system where the Perl interpreter is located necessary on UNIX comment line ignored by the Perl interpreter End
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Lecture 4. Regular Expressions grep and sed intro
Lecture 4 Regular Expressions grep and sed intro Previously Basic UNIX Commands Files: rm, cp, mv, ls, ln Processes: ps, kill Unix Filters cat, head, tail, tee, wc cut, paste find sort, uniq comm, diff,
Regular Expression Syntax
1 of 5 12/22/2014 9:55 AM EmEditor Home - EmEditor Help - How to - Search Regular Expression Syntax EmEditor regular expression syntax is based on Perl regular expression syntax. Literals All characters
Apply PERL to BioInformatics (II)
Apply PERL to BioInformatics (II) Lecture Note for Computational Biology 1 (LSM 5191) Jiren Wang http://www.bii.a-star.edu.sg/~jiren BioInformatics Institute Singapore Outline Some examples for manipulating
University Convocation. IT 3203 Introduction to Web Development. Pattern Matching. Why Match Patterns? The Search Method. The Replace Method
IT 3203 Introduction to Web Development Regular Expressions October 12 Notice: This session is being recorded. Copyright 2007 by Bob Brown University Convocation Tuesday, October 13, 11:00 AM 12:15 PM
DNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
The C++ Language. Loops. ! Recall that a loop is another of the four basic programming language structures
The C++ Language Loops Loops! Recall that a loop is another of the four basic programming language structures Repeat statements until some condition is false. Condition False True Statement1 2 1 Loops
Regular Expression Searching
Regular Expression Searching Regular expressions allow forensics analysts to search through large quantities of text information for patterns of data such as the following: Telephone Numbers Social Security
Regular Expressions Overview Suppose you needed to find a specific IPv4 address in a bunch of files? This is easy to do; you just specify the IP
Regular Expressions Overview Suppose you needed to find a specific IPv4 address in a bunch of files? This is easy to do; you just specify the IP address as a string and do a search. But, what if you didn
Advanced Bash Scripting. Joshua Malone ([email protected])
Advanced Bash Scripting Joshua Malone ([email protected]) Why script in bash? You re probably already using it Great at managing external programs Powerful scripting language Portable and version-stable
Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language
Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language www.freebsdonline.com Copyright 2006-2008 www.freebsdonline.com 2008/01/29 This course is about Perl Programming
Unix Shell Scripts. Contents. 1 Introduction. Norman Matloff. July 30, 2008. 1 Introduction 1. 2 Invoking Shell Scripts 2
Unix Shell Scripts Norman Matloff July 30, 2008 Contents 1 Introduction 1 2 Invoking Shell Scripts 2 2.1 Direct Interpretation....................................... 2 2.2 Indirect Interpretation......................................
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Kiwi Log Viewer. A Freeware Log Viewer for Windows. by SolarWinds, Inc.
Kiwi Log Viewer A Freeware Log Viewer for Windows by SolarWinds, Inc. Kiwi Log Viewer displays text based log files in a tabular format. Only a small section of the file is read from disk at a time which
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Computer Programming In QBasic
Computer Programming In QBasic Name: Class ID. Computer# Introduction You've probably used computers to play games, and to write reports for school. It's a lot more fun to create your own games to play
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
1 Description of The Simpletron
Simulating The Simpletron Computer 50 points 1 Description of The Simpletron In this assignment you will write a program to simulate a fictional computer that we will call the Simpletron. As its name implies
Excel: Introduction to Formulas
Excel: Introduction to Formulas Table of Contents Formulas Arithmetic & Comparison Operators... 2 Text Concatenation... 2 Operator Precedence... 2 UPPER, LOWER, PROPER and TRIM... 3 & (Ampersand)... 4
Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
Using PRX to Search and Replace Patterns in Text Strings
Paper CC06 Using PRX to Search and Replace Patterns in Text Strings Wenyu Hu, Merck Research Labs, Merck & Co., Inc., Upper Gwynedd, PA Liping Zhang, Merck Research Labs, Merck & Co., Inc., Upper Gwynedd,
Database manager does something that sounds trivial. It makes it easy to setup a new database for searching with Mascot. It also makes it easy to
1 Database manager does something that sounds trivial. It makes it easy to setup a new database for searching with Mascot. It also makes it easy to automate regular updates of these databases. 2 However,
Programming Languages CIS 443
Course Objectives Programming Languages CIS 443 0.1 Lexical analysis Syntax Semantics Functional programming Variable lifetime and scoping Parameter passing Object-oriented programming Continuations Exception
Regular Expressions. Abstract
Regular Expressions Sanjiv K. Bhatia Department of Mathematics & Computer Science University of Missouri St. Louis St. Louis, MO 63121 email: [email protected] Abstract Regular expressions provide a powerful
CS 1133, LAB 2: FUNCTIONS AND TESTING http://www.cs.cornell.edu/courses/cs1133/2015fa/labs/lab02.pdf
CS 1133, LAB 2: FUNCTIONS AND TESTING http://www.cs.cornell.edu/courses/cs1133/2015fa/labs/lab02.pdf First Name: Last Name: NetID: The purpose of this lab is to help you to better understand functions:
Sequence Database Administration
Sequence Database Administration 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases
Specify the location of an HTML control stored in the application repository. See Using the XPath search method, page 2.
Testing Dynamic Web Applications How To You can use XML Path Language (XPath) queries and URL format rules to test web sites or applications that contain dynamic content that changes on a regular basis.
RAST Automated Analysis. What is RAST for?
RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic
Hands-On UNIX Exercise:
Hands-On UNIX Exercise: This exercise takes you around some of the features of the shell. Even if you don't need to use them all straight away, it's very useful to be aware of them and to know how to deal
MyOra 3.0. User Guide. SQL Tool for Oracle. Jayam Systems, LLC
MyOra 3.0 SQL Tool for Oracle User Guide Jayam Systems, LLC Contents Features... 4 Connecting to the Database... 5 Login... 5 Login History... 6 Connection Indicator... 6 Closing the Connection... 7 SQL
Importing and Exporting With SPSS for Windows 17 TUT 117
Information Systems Services Importing and Exporting With TUT 117 Version 2.0 (Nov 2009) Contents 1. Introduction... 3 1.1 Aim of this Document... 3 2. Importing Data from Other Sources... 3 2.1 Reading
Basic C Shell. [email protected]. 11th August 2003
Basic C Shell [email protected] 11th August 2003 This is a very brief guide to how to use cshell to speed up your use of Unix commands. Googling C Shell Tutorial can lead you to more detailed information.
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Content of this lecture. Regular Expressions in Java. Hello, world! In Java. Programming in Java
Content of this lecture Regular Expressions in Java 2010-09-22 Birgit Grohe A very small Java program Regular expressions in Java Metacharacters Character classes and boundaries Quantifiers Backreferences
Introduction to Searching with Regular Expressions
Introduction to Searching with Regular Expressions Christopher M. Frenz Department of Computer Engineering Technology New York City College of Technology (CUNY) 300 Jay St Brooklyn, NY 11201 Email: [email protected]
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
MULTIPLICATION AND DIVISION OF REAL NUMBERS In this section we will complete the study of the four basic operations with real numbers.
1.4 Multiplication and (1-25) 25 In this section Multiplication of Real Numbers Division by Zero helpful hint The product of two numbers with like signs is positive, but the product of three numbers with
PHP Tutorial From beginner to master
PHP Tutorial From beginner to master PHP is a powerful tool for making dynamic and interactive Web pages. PHP is the widely-used, free, and efficient alternative to competitors such as Microsoft's ASP.
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
The Center for Teaching, Learning, & Technology
The Center for Teaching, Learning, & Technology Instructional Technology Workshops Microsoft Excel 2010 Formulas and Charts Albert Robinson / Delwar Sayeed Faculty and Staff Development Programs Colston
1. To start Installation: To install the reporting tool, copy the entire contents of the zip file to a directory of your choice. Run the exe.
CourseWebs Reporting Tool Desktop Application Instructions The CourseWebs Reporting tool is a desktop application that lets a system administrator modify existing reports and create new ones. Changes to
MyOra 3.5. User Guide. SQL Tool for Oracle. Kris Murthy
MyOra 3.5 SQL Tool for Oracle User Guide Kris Murthy Contents Features... 4 Connecting to the Database... 5 Login... 5 Login History... 6 Connection Indicator... 6 Closing the Connection... 7 SQL Editor...
Programming in Perl CSCI-2962 Final Exam
Rules and Information: Programming in Perl CSCI-2962 Final Exam 1. TURN OFF ALL CELULAR PHONES AND PAGERS! 2. Make sure you are seated at least one empty seat away from any other student. 3. Write your
Appendix K Introduction to Microsoft Visual C++ 6.0
Appendix K Introduction to Microsoft Visual C++ 6.0 This appendix serves as a quick reference for performing the following operations using the Microsoft Visual C++ integrated development environment (IDE):
7 Why Use Perl for CGI?
7 Why Use Perl for CGI? Perl is the de facto standard for CGI programming for a number of reasons, but perhaps the most important are: Socket Support: Perl makes it easy to create programs that interface
Regular Expressions (in Python)
Regular Expressions (in Python) Python or Egrep We will use Python. In some scripting languages you can call the command grep or egrep egrep pattern file.txt E.g. egrep ^A file.txt Will print all the line
Qlik REST Connector Installation and User Guide
Qlik REST Connector Installation and User Guide Qlik REST Connector Version 1.0 Newton, Massachusetts, November 2015 Authored by QlikTech International AB Copyright QlikTech International AB 2015, All
A Crash Course on UNIX
A Crash Course on UNIX UNIX is an "operating system". Interface between user and data stored on computer. A Windows-style interface is not required. Many flavors of UNIX (and windows interfaces). Solaris,
Introduction to Java Applications. 2005 Pearson Education, Inc. All rights reserved.
1 2 Introduction to Java Applications 2.2 First Program in Java: Printing a Line of Text 2 Application Executes when you use the java command to launch the Java Virtual Machine (JVM) Sample program Displays
Chapter 2: Elements of Java
Chapter 2: Elements of Java Basic components of a Java program Primitive data types Arithmetic expressions Type casting. The String type (introduction) Basic I/O statements Importing packages. 1 Introduction
Access Control and Audit Trail Software
Varian, Inc. 2700 Mitchell Drive Walnut Creek, CA 94598-1675/USA Access Control and Audit Trail Software Operation Manual Varian, Inc. 2002 03-914941-00:3 Table of Contents Introduction... 1 Access Control
DigitalPersona. Password Manager Pro. Version 5.0. Administrator Guide
DigitalPersona Password Manager Pro Version 5.0 Administrator Guide 2010 DigitalPersona, Inc. All Rights Reserved. All intellectual property rights in the DigitalPersona software, firmware, hardware and
Regular Expressions. The Complete Tutorial. Jan Goyvaerts
Regular Expressions The Complete Tutorial Jan Goyvaerts Regular Expressions: The Complete Tutorial Jan Goyvaerts Copyright 2006, 2007 Jan Goyvaerts. All rights reserved. Last updated July 2007. No part
HTML Codes - Characters and symbols
ASCII Codes HTML Codes Conversion References Control Characters English version Versión español Click here to add this link to your favorites. HTML Codes - Characters and symbols Standard ASCII set, HTML
CHARGE Anywhere. Mobile POS. User s Guide
CHARGE Anywhere Palm Treo Mobile POS User s Guide 1 PURPOSE... 4 2 SCOPE... 4 3 DEFINITIONS... 4 3.1 Quick Sale... 4 3.2 Sale... 4 3.3 Auth Only... 4 3.4 Force... 4 3.5 Void... 4 3.6 Retry... 4 3.7 Return...
Calculate Highest Common Factors(HCFs) & Least Common Multiples(LCMs) NA1
Calculate Highest Common Factors(HCFs) & Least Common Multiples(LCMs) NA1 What are the multiples of 5? The multiples are in the five times table What are the factors of 90? Each of these is a pair of factors.
App Building Guidelines
App Building Guidelines App Building Guidelines Table of Contents Definition of Apps... 2 Most Recent Vintage Dataset... 2 Meta Info tab... 2 Extension yxwz not yxmd... 3 Map Input... 3 Report Output...
Secrets of printf. 1 Background. 2 Simple Printing. Professor Don Colton. Brigham Young University Hawaii. 2.1 Naturally Special Characters
Secrets of Professor Don Colton Brigham Young University Hawaii is the C language function to do formatted printing. The same function is also available in PERL. This paper explains how works, and how
GOOGLE DOCS APPLICATION WORK WITH GOOGLE DOCUMENTS
GOOGLE DOCS APPLICATION WORK WITH GOOGLE DOCUMENTS Last Edited: 2012-07-09 1 Navigate the document interface... 4 Create and Name a new document... 5 Create a new Google document... 5 Name Google documents...
UNIX, Shell Scripting and Perl Introduction
UNIX, Shell Scripting and Perl Introduction Bart Zeydel 2003 Some useful commands grep searches files for a string. Useful for looking for errors in CAD tool output files. Usage: grep error * (looks for
URL encoding uses hex code prefixed by %. Quoted Printable encoding uses hex code prefixed by =.
ASCII = American National Standard Code for Information Interchange ANSI X3.4 1986 (R1997) (PDF), ANSI INCITS 4 1986 (R1997) (Printed Edition) Coded Character Set 7 Bit American National Standard Code
Microsoft Dynamics GP. SmartList Builder User s Guide With Excel Report Builder
Microsoft Dynamics GP SmartList Builder User s Guide With Excel Report Builder Copyright Copyright 2008 Microsoft Corporation. All rights reserved. Complying with all applicable copyright laws is the responsibility
Perl/CGI. CS 299 Web Programming and Design
Perl/CGI CGI Common: Gateway: Programming in Perl Interface: interacts with many different OSs CGI: server programsprovides uses a well-defined users with a method way to to gain interact access with to
Message Archiving User Guide
Message Archiving User Guide Spam Soap, Inc. 3193 Red Hill Avenue Costa Mesa, CA 92626 United States p.866.spam.out f.949.203.6425 e. [email protected] www.spamsoap.com RESTRICTION ON USE, PUBLICATION,
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Exercises for Design of Test Cases
Exercises for Design of Test Cases 2005-2010 Hans Schaefer Slide no. 1 Specification The system is an information system for buses, like www.nor-way.no or www.bus.is. The system has a web based interface.
BIGPOND ONLINE STORAGE USER GUIDE Issue 1.1.0-18 August 2005
BIGPOND ONLINE STORAGE USER GUIDE Issue 1.1.0-18 August 2005 PLEASE NOTE: The contents of this publication, and any associated documentation provided to you, must not be disclosed to any third party without
Excel for Mac Text Functions
[Type here] Excel for Mac Text Functions HOW TO CLEAN UP TEXT IN A FLASH This document looks at some of the tools available in Excel 2008 and Excel 2011 for manipulating text. Last updated 16 th July 2015
Deposit Direct. Getting Started Guide
Deposit Direct Getting Started Guide Table of Contents Before You Start... 3 Installing the Deposit Direct application for use with Microsoft Windows Vista... 4 Running Programs in Microsoft Windows Vista...
Pemrograman Dasar. Basic Elements Of Java
Pemrograman Dasar Basic Elements Of Java Compiling and Running a Java Application 2 Portable Java Application 3 Java Platform Platform: hardware or software environment in which a program runs. Oracle
Create a survey using Google Forms
Create a survey using Google Forms You can plan events, make a survey or poll, give students a quiz, or collect other information in an easy, streamlined way with Google Forms. Google Forms can be connected
Using Mail Merge in Microsoft Word 2003
Using Mail Merge in Microsoft Word 2003 Mail Merge Created: 12 April 2005 Note: You should be competent in Microsoft Word before you attempt this Tutorial. Open Microsoft Word 2003 Beginning the Merge
Personal Portfolios on Blackboard
Personal Portfolios on Blackboard This handout has four parts: 1. Creating Personal Portfolios p. 2-11 2. Creating Personal Artifacts p. 12-17 3. Sharing Personal Portfolios p. 18-22 4. Downloading Personal
Prepare your result file for input into SPSS
Prepare your result file for input into SPSS Isabelle Darcy When you use DMDX for your experiment, you get an.azk file, which is a simple text file that collects all the reaction times and accuracy of
FirstClass FAQ's An item is missing from my FirstClass desktop
FirstClass FAQ's An item is missing from my FirstClass desktop Deleted item: If you put a item on your desktop, you can delete it. To determine what kind of item (conference-original, conference-alias,
Employment intermediaries: data requirements for software developers
Employment intermediaries: data requirements for software developers Version 1.4 Last updated: 3 August 2015 1. Introduction... 1 2. Report template... 1 Formatting a CSV report... 1 3. Online service...
Section 1.4 Place Value Systems of Numeration in Other Bases
Section.4 Place Value Systems of Numeration in Other Bases Other Bases The Hindu-Arabic system that is used in most of the world today is a positional value system with a base of ten. The simplest reason
PPUM icare SINGLE SIGN ON
Double click the Single Sign On shortcut located in the desktop. Enter user PPUM icare ID in the User ID text box. Leave the Password text box as blank. Click Login button. You will be prompt about the
Integrated Accounting System for Mac OS X
Integrated Accounting System for Mac OS X Program version: 6.3 110401 2011 HansaWorld Ireland Limited, Dublin, Ireland Preface Standard Accounts is a powerful accounting system for Mac OS X. Text in square
Version 2.5.0 22 August 2016
Version 2.5.0 22 August 2016 Published by Just Great Software Co. Ltd. Copyright 2009 2016 Jan Goyvaerts. All rights reserved. RegexMagic and Just Great Software are trademarks of Jan Goyvaerts i Table
JavaScript: Introduction to Scripting. 2008 Pearson Education, Inc. All rights reserved.
1 6 JavaScript: Introduction to Scripting 2 Comment is free, but facts are sacred. C. P. Scott The creditor hath a better memory than the debtor. James Howell When faced with a decision, I always ask,
A Lex Tutorial. Victor Eijkhout. July 2004. 1 Introduction. 2 Structure of a lex file
A Lex Tutorial Victor Eijkhout July 2004 1 Introduction The unix utility lex parses a file of characters. It uses regular expression matching; typically it is used to tokenize the contents of the file.
Education Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide
Education Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide March 2013 Education Solutions Development, Inc. What s Inside The information in this reference
The Settings tab: Check Uncheck Uncheck
Hi! This tutorial shows you, the soon-to-be proud owner of a chatroom application, what the &^$*^*! you are supposed to do to make one. First no, don't do that. Stop it. Really, leave it alone. Good. First,
Umbraco v4 Editors Manual
Umbraco v4 Editors Manual Produced by the Umbraco Community Umbraco // The Friendly CMS Contents 1 Introduction... 3 2 Getting Started with Umbraco... 4 2.1 Logging On... 4 2.2 The Edit Mode Interface...
C&A AR Online Credit Card Processor Installation and Setup Instructions with Process Flow
4820 8 th Ave SE, Salem OR 97302 4820 8 TH AVE. SE SALEM, OREGON 97302 C&A AR Online Credit Card Processor Installation and Setup Instructions with Process Flow The general purpose of this program is to
TCP/IP Networking, Part 2: Web-Based Control
TCP/IP Networking, Part 2: Web-Based Control Microchip TCP/IP Stack HTTP2 Module 2007 Microchip Technology Incorporated. All Rights Reserved. Building Embedded Web Applications Slide 1 Welcome to the next
