Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language
|
|
|
- Muriel Chapman
- 9 years ago
- Views:
Transcription
1 Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language Copyright /01/29 This course is about Perl Programming Language. It is for beginners and it explain Perl basics in a easy to learn way. If you are a sysadmin and you learn Linux or UNIX this is what you need to be able to write Perl scripts, to know a language every sysadmin must know. PERL is a powerful scripting language, very popular among UNIX/Linux admins. This tutorials will try to cover everything you need to know in order to program in Perl. Perl stands for Practical Extraction an Report Language, it was first used as text processor, it borrows features from C, shell scripting (UNIX sh), sed, awk, Lisp, Pascal. It can be used also for developing dyamic web applications as CGIs. This tutorial was provided by You may freely distribute this document in any form without changing the text or removing copyright notice. 1
2 Table of Contents 1 Introduction Perl Variables Perl control structures Defining and using subroutines Using file parameters (positional parameters) Perl Regular Expressions About Tutorial Introduction PERL is a powerful scripting language, very popular among UNIX/Linux admins. This tutorials will try to cover everything you need to know in order to program in Perl. Perl stands for Practical Extraction an Report Language, it was first used as text processor, it borrows features from C, shell scripting (UNIX sh), sed, awk, Lisp, Pascal. It can be used also for developing dyamic web applications as CGIs. 1.1 Few things to know before start programming in Perl Perl code is portable. Most scripts are written for version 5.8 or higher. When start programming in Perl first you might want to find the path of Perl binary. On most UNIX/Linux systems you can do that with whereis command: whereis perl As a result of this command you might have: /usr/bin/perl. So your scripts must have first line of code with this value: #!/usr/bin/perl # rest of code # will be used for comments. On first line of sourcecode this line will help shell in finding what binary to use when running the script. 2
3 In order to properly run the script your source code must also have executable flag for the user you use to run the script. This can be achieved for example for file prog1.pl adding executable flag from command line: chown u+x progr1.pl So, to start your Perl script you will follow: a) Create an empty file: touch program.pl b) Add executable flag to that file: chown u+x program.pl c) Find where your Perl binary is: whereis perl (you will get something like /usr/bin/perl). c) Edit that file with your text editor, and add perl path with this syntax: #!/usr/bin/perl (not that # on first line of your code will not be seen as comment) edit program.pl and put there: #!/usr/bin/perl. Note: For Linux you can use nano, pico or mcedit. Edit is your default text editor in FreeBSD. If you have installed Midnight Commander package, you can use mcedit, which is nice. Note: use strict; put in perl sourcecode will force us to declare variables in a more safe (proper) way. All variables must be declared with my prefix. Note: By adding -w to #!/usr/bin/perl it will activate perl warnings, very usefull for debugging. 3
4 2 Perl Variables Perl has 3 types of variables: scalars; arrays; hashes; 2.1 Scalars Example on how to define a scalar variable in Perl: $var1 = "value" # a scalar variable var1 is defined and a string # "value" is assigned to that variable; $var2 = 100 # a scalar variable var2 is defined, and an #integer value is assigned. Example: To print a scalar value we will use: print "$var1"; 2.2 Arrays Example on how to define an array in = ( "Value1", "Value2", Value3"); Example on how to print an array: print "Our array variable In our example we ve used \n escape char to insert a new line (escape chars can be used the same way are used in C language). The previous example will display all values from array1 array. To display one element of the array: 4
5 print "First element of the array is: $array1[0]"; As you might notice we ve defined array but printed a single value of that array using $. This is correct because we want to print a single value. It is also possible to print multiple values from an array: print "Our array Previous example will print elements from 0 to element nr.2 from array1. You can also print multiple distinct elements from array: print "Our array The previous example will print only values for element 0, 4 and 7. Note that in perl first value of an array is number 0. That is fine but how do we find the number of elements of an array? print "Number of elements of an array: $#array1"; Note that $#array1 in our example is number of elements, but because elements from an array in Perl starts with value 0, the real number of elements of an array is $#array + 1. There is another method to define an = qw(value1 Value2 Value3 Value4); Perl functions for working with arrays: pop - remove last element of an array: push - add an element to the end of array; shift - removes first element of an array; unshift - add an element to the beginning of array; 5
6 sort - sort an array. Let s see some examples: Pop Function (remove last element of an = ("Data1", "Data2", "Data3"); print "Array1 print "Array1 after applying pop Push Function (add an element to the end of = ("Data1", "Data2", "Data3"); print "Array1 "Data4"; print "Array1 after applying push Shift Function (removes first element of an = ("Data1", "Data2", "Data3"); print "Array1 print "Array1 after applying shift 6
7 The same principle apply for unshift and sort functions. Sort functions works best with strings. 2.3 Hashes Hashes are types of variables defined as key - value pair. Example of defining a hash variable: %name_ = ("John", "[email protected]", "George", "[email protected]"); Another way to define a has variable: %name_ = ( John => "[email protected]", George => "[email protected]", ); Example of using hash variables: %name_ = ( "John", "[email protected]", "George", "[email protected]"); print $name_ {"john"; Note: Note: We ve used escape character to Also note that printing a hash variable means to print a scalar with value key between braces {. 3 Perl control structures 3.1 Conditionals For testing conditionals within Perl if it is used. To better illustrates, see the following example: $var1 = 100; 7
8 $var2 = 200; if ($var1 < $var2) { print "$var1 < $var2\n"; Note: When evaluating expressions if variables are numbers we will use mathematical operators ( < > = <= >= ==). When we use string variables we use string evaluation operators like gt (greater then) eq (equal) and so on. Note: When we evaluate two numbers to be identical, we use == operator (not = which is used for assigning values. Another example follows: $var1 = 400; $var2 = 200; if ($var1 < $var2) { print "$var1 < $var2\n"; elsif ($var1 > var2) { print "$var1 > $var2\n"; elsif function as a nested if. The inverse test of if is unless function: unless ($var1 == $var2) { print "$var1"; 8
9 3.2 Loops Learn Perl by Example - Perl Handbook for Beginners - Basics of Perl Scripting Language For Loops In Perl sometimes are many way to solve a problem. We will show 3 ways to construct a loop using for. Example 1: For loop using C style: # for loop example 1 for ($i = 1; $i < 100; $i++) { print "$i\n"; Example 2: for loops using ranges: # for loop example 2 $var1 = 1; $var2 = 100; $i = 1; for ($var1..$var2) { print "$i\n"; $i+=1; Example 3: loop using foreach: # for loop example = ( "Val1", "Val2", "Val3", "Val4", "Val5"); foreach (@array1) { print "$_\n"; 9
10 Note: $_ will print the current value of an array While Loops An example is presented next: $var1 = 1; $var2 = 8; while ($var1 < $var2) { print "$var1\n"; $var1 += 1; Until Loops Until is negation of while. Here is an example: $var1 = 1; $var2 = 8; until ($var2 < $var1) { print "$var2\n"; $var2 -= 1; 4 Defining and using subroutines Subroutines allow us to better structure our code, organize it and reuse it. A subrutine will start with keyword sub. The following example shows how to define a subroutine which calculates sum of two numbers: 10
11 $var1 = 100; $var2 = 200; $result = 0; $result = my_sum(); print "$result\n"; sub my_sum { $tmp = $var1 + $var2; return $tmp; Note: Subroutines might have parameters. When passing parameters to subroutines, it will be stored array. Do not confuse it with $_ which stores elements of an array in a loop. 5 Using file parameters (positional parameters) Sometimes we need to transmit parameters to our script is an array reserved for parameters transmitted to files (default value of number of arguments is set -1 if no parameters are transmitted. if ($#ARGV < 2) { print "You must have at least 3 parameters.\n"; else { print "Your parameters 11
12 6 Perl Regular Expressions Perl Regular Expressions are a strong point of perl. You can ease your sysadmin job by learning and using Perl Regex. 6.1 Searching for a string The following example will search for This string in expresion $exp. $exp = "This is a string"; if ($exp =~ /This/) { 6.2 Searching for a string using case insensitive The next example will search for string this in expresion $exp using case insensitive (case will be ignored in search). $exp = "This is a string"; if ($exp =~ /this/i) { 6.3 Searching for a digit The next example shows how to search for a digit in a string. $exp = "This is 8 string"; if ($exp =~ /\d/) { 12
13 6.4 Searching for 2 digits The next example shows how to search for two digits in a string. $exp = "This is 88 string"; if ($exp =~ /\d\d/) { 6.5 Searching for whitespaces The next example shows you how to use regular expresions to search for whitespaces in a string. $exp = "This is string"; if ($exp =~ /\s/) { 6.6 Searching for a string that begins with a pattern The following example shows you how to use regular expressions to check if a string begins with a keyword/string. $exp = "This is string"; if ($exp =~ /^This/) { 6.7 Searching for a string that ends with a pattern The following example shows you how to use regular expressions to check if a string ends with a keyword/string. 13
14 $exp = "This is string"; if ($exp =~ /string$/) { 6.8 Search for a digit with white space in front and after it The next example shows how to use perl regex to search for a digit with white space in front and after it. $exp = "This 1 is string"; if ($exp =~ /\s\d\s/) { 6.9 Search for a blank line The next example shows how to use Perl regex to search for a blank line. $exp = ""; if ($exp =~ /^$/) { 6.10 Replace a pattern The next example shows you how to use Perl regex to replace a text with a pattern. $exp = "This is a string"; 14
15 if ($exp =~ s/this is/test/) { print ("$exp\n"); 7 About Tutorial This tutorial was provided by 15
Perl in a nutshell. First CGI Script and Perl. Creating a Link to a Script. print Function. Parsing Data 4/27/2009. First CGI Script and Perl
First CGI Script and Perl Perl in a nutshell Prof. Rasley shebang line tells the operating system where the Perl interpreter is located necessary on UNIX comment line ignored by the Perl interpreter End
Unix Shell Scripts. Contents. 1 Introduction. Norman Matloff. July 30, 2008. 1 Introduction 1. 2 Invoking Shell Scripts 2
Unix Shell Scripts Norman Matloff July 30, 2008 Contents 1 Introduction 1 2 Invoking Shell Scripts 2 2.1 Direct Interpretation....................................... 2 2.2 Indirect Interpretation......................................
UNIX, Shell Scripting and Perl Introduction
UNIX, Shell Scripting and Perl Introduction Bart Zeydel 2003 Some useful commands grep searches files for a string. Useful for looking for errors in CAD tool output files. Usage: grep error * (looks for
A Crash Course on UNIX
A Crash Course on UNIX UNIX is an "operating system". Interface between user and data stored on computer. A Windows-style interface is not required. Many flavors of UNIX (and windows interfaces). Solaris,
Embedded Systems. Review of ANSI C Topics. A Review of ANSI C and Considerations for Embedded C Programming. Basic features of C
Embedded Systems A Review of ANSI C and Considerations for Embedded C Programming Dr. Jeff Jackson Lecture 2-1 Review of ANSI C Topics Basic features of C C fundamentals Basic data types Expressions Selection
Symbol Tables. Introduction
Symbol Tables Introduction A compiler needs to collect and use information about the names appearing in the source program. This information is entered into a data structure called a symbol table. The
grep, awk and sed three VERY useful command-line utilities Matt Probert, Uni of York grep = global regular expression print
grep, awk and sed three VERY useful command-line utilities Matt Probert, Uni of York grep = global regular expression print In the simplest terms, grep (global regular expression print) will search input
Outline. Unix shells Bourne-again Shell (bash) Interacting with bash Basic scripting References
Ryan Hulguin Outline Unix shells Bourne-again Shell (bash) Interacting with bash Basic scripting References Unix shells This lets users issue commands to the Unix operating system Users can interact with
JAVASCRIPT AND COOKIES
JAVASCRIPT AND COOKIES http://www.tutorialspoint.com/javascript/javascript_cookies.htm Copyright tutorialspoint.com What are Cookies? Web Browsers and Servers use HTTP protocol to communicate and HTTP
Lecture 4: Writing shell scripts
Handout 5 06/03/03 1 Your rst shell script Lecture 4: Writing shell scripts Shell scripts are nothing other than les that contain shell commands that are run when you type the le at the command line. That
A TOOL FOR DATA STRUCTURE VISUALIZATION AND USER-DEFINED ALGORITHM ANIMATION
A TOOL FOR DATA STRUCTURE VISUALIZATION AND USER-DEFINED ALGORITHM ANIMATION Tao Chen 1, Tarek Sobh 2 Abstract -- In this paper, a software application that features the visualization of commonly used
Top 72 Perl Interview Questions and Answers
Top 72 Perl Interview Questions and Answers 1. Difference between the variables in which chomp function work? Scalar: It is denoted by $ symbol. Variable can be a number or a string. Array: Denoted by
Unix Scripts and Job Scheduling
Unix Scripts and Job Scheduling Michael B. Spring Department of Information Science and Telecommunications University of Pittsburgh [email protected] http://www.sis.pitt.edu/~spring Overview Shell Scripts
Advanced Bash Scripting. Joshua Malone ([email protected])
Advanced Bash Scripting Joshua Malone ([email protected]) Why script in bash? You re probably already using it Great at managing external programs Powerful scripting language Portable and version-stable
An Introduction to Assembly Programming with the ARM 32-bit Processor Family
An Introduction to Assembly Programming with the ARM 32-bit Processor Family G. Agosta Politecnico di Milano December 3, 2011 Contents 1 Introduction 1 1.1 Prerequisites............................. 2
?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
NGS data format NGS data format @SRR031028.1708655 GGATGATGGATGGATAGATAGATGAAGAGATGGATGGATGGGTGGGTGGTATGCAGCATACCTGAAGTGC BBBCB=ABBB@BA=?BABBBBA??B@BAAA>ABB;@5=@@@?8@:==99:465727:;41'.9>;933!4 @SRR031028.843803
#!/usr/bin/perl use strict; use warnings; use Carp; use Data::Dumper; use Tie::IxHash; use Gschem 3; 3. Setup and initialize the global variables.
1. Introduction. This program creates a Bill of Materials (BOM) by parsing a gschem schematic file and grouping components that have identical attributes (except for reference designator). Only components
JavaScript: Introduction to Scripting. 2008 Pearson Education, Inc. All rights reserved.
1 6 JavaScript: Introduction to Scripting 2 Comment is free, but facts are sacred. C. P. Scott The creditor hath a better memory than the debtor. James Howell When faced with a decision, I always ask,
7 Why Use Perl for CGI?
7 Why Use Perl for CGI? Perl is the de facto standard for CGI programming for a number of reasons, but perhaps the most important are: Socket Support: Perl makes it easy to create programs that interface
Member Functions of the istream Class
Member Functions of the istream Class The extraction operator is of limited use because it always uses whitespace to delimit its reads of the input stream. It cannot be used to read those whitespace characters,
A Simple Shopping Cart using CGI
A Simple Shopping Cart using CGI Professor Don Colton, BYU Hawaii March 5, 2004 In this section of the course, we learn to use CGI and Perl to create a simple web-based shopping cart program. We assume
Computational Mathematics with Python
Boolean Arrays Classes Computational Mathematics with Python Basics Olivier Verdier and Claus Führer 2009-03-24 Olivier Verdier and Claus Führer Computational Mathematics with Python 2009-03-24 1 / 40
Sources: On the Web: Slides will be available on:
C programming Introduction The basics of algorithms Structure of a C code, compilation step Constant, variable type, variable scope Expression and operators: assignment, arithmetic operators, comparison,
CS2043 - Unix Tools & Scripting Lecture 9 Shell Scripting
CS2043 - Unix Tools & Scripting Lecture 9 Shell Scripting Spring 2015 1 February 9, 2015 1 based on slides by Hussam Abu-Libdeh, Bruno Abrahao and David Slater over the years Announcements Coursework adjustments
PYTHON Basics http://hetland.org/writing/instant-hacking.html
CWCS Workshop May 2009 PYTHON Basics http://hetland.org/writing/instant-hacking.html Python is an easy to learn, modern, interpreted, object-oriented programming language. It was designed to be as simple
Installing Java. Table of contents
Table of contents 1 Jargon...3 2 Introduction...4 3 How to install the JDK...4 3.1 Microsoft Windows 95... 4 3.1.1 Installing the JDK... 4 3.1.2 Setting the Path Variable...5 3.2 Microsoft Windows 98...
Lecture 9. Semantic Analysis Scoping and Symbol Table
Lecture 9. Semantic Analysis Scoping and Symbol Table Wei Le 2015.10 Outline Semantic analysis Scoping The Role of Symbol Table Implementing a Symbol Table Semantic Analysis Parser builds abstract syntax
Microsoft Windows PowerShell v2 For Administrators
Course 50414B: Microsoft Windows PowerShell v2 For Administrators Course Details Course Outline Module 1: Introduction to PowerShell the Basics This module explains how to install and configure PowerShell.
Introduction to Shell Programming
Introduction to Shell Programming what is shell programming? about cygwin review of basic UNIX TM pipelines of commands about shell scripts some new commands variables parameters and shift command substitution
PA2: Word Cloud (100 Points)
PA2: Word Cloud (100 Points) Due: 11:59pm, Thursday, April 16th Overview You will create a program to read in a text file and output the most frequent and unique words by using an ArrayList. Setup In all
Who s Doing What? Analyzing Ethernet LAN Traffic
by Paul Barry, [email protected] Abstract A small collection of Perl modules provides the basic building blocks for the creation of a Perl-based Ethernet network analyzer. I present a network analyzer
CGI Programming. What is CGI?
CGI Programming What is CGI? Common Gateway Interface A means of running an executable program via the Web. CGI is not a Perl-specific concept. Almost any language can produce CGI programs even C++ (gasp!!)
1. a procedure that you perform frequently. 2. Create a command. 3. Create a new. 4. Create custom for Excel.
Topics 1 Visual Basic Application Macro Language What You Can Do with VBA macro Types of VBA macro Recording VBA macros Example: MyName () If-Then statement Example: CheckCell () For-Next Loops Example:
Computational Mathematics with Python
Computational Mathematics with Python Basics Claus Führer, Jan Erik Solem, Olivier Verdier Spring 2010 Claus Führer, Jan Erik Solem, Olivier Verdier Computational Mathematics with Python Spring 2010 1
Computational Mathematics with Python
Numerical Analysis, Lund University, 2011 1 Computational Mathematics with Python Chapter 1: Basics Numerical Analysis, Lund University Claus Führer, Jan Erik Solem, Olivier Verdier, Tony Stillfjord Spring
Some Scanner Class Methods
Keyboard Input Scanner, Documentation, Style Java 5.0 has reasonable facilities for handling keyboard input. These facilities are provided by the Scanner class in the java.util package. A package is a
Informatica e Sistemi in Tempo Reale
Informatica e Sistemi in Tempo Reale Introduction to C programming Giuseppe Lipari http://retis.sssup.it/~lipari Scuola Superiore Sant Anna Pisa October 25, 2010 G. Lipari (Scuola Superiore Sant Anna)
Introduction to CloudScript
Introduction to CloudScript A NephoScale Whitepaper Authors: Nick Peterson, Alan Meadows Date: 2012-07-06 CloudScript is a build language for the cloud. It is a simple Domain Specific Language (DSL) that
Shell Scripts (1) For example: #!/bin/sh If they do not, the user's current shell will be used. Any Unix command can go in a shell script
Shell Programming Shell Scripts (1) Basically, a shell script is a text file with Unix commands in it. Shell scripts usually begin with a #! and a shell name For example: #!/bin/sh If they do not, the
Systems Programming & Scripting
Systems Programming & Scripting Lecture 14 - Shell Scripting: Control Structures, Functions Syst Prog & Scripting - Heriot Watt University 1 Control Structures Shell scripting supports creating more complex
Lab Experience 17. Programming Language Translation
Lab Experience 17 Programming Language Translation Objectives Gain insight into the translation process for converting one virtual machine to another See the process by which an assembler translates assembly
DATA 301 Introduction to Data Analytics Microsoft Excel VBA. Dr. Ramon Lawrence University of British Columbia Okanagan
DATA 301 Introduction to Data Analytics Microsoft Excel VBA Dr. Ramon Lawrence University of British Columbia Okanagan [email protected] DATA 301: Data Analytics (2) Why Microsoft Excel Visual Basic
HP-UX Essentials and Shell Programming Course Summary
Contact Us: (616) 875-4060 HP-UX Essentials and Shell Programming Course Summary Length: 5 Days Prerequisite: Basic computer skills Recommendation Statement: Student should be able to use a computer monitor,
VI(Visual) Editor Reference manual
VI(Visual) Editor Reference manual The vi is a text editor. It is small, powerful, and standard on most UNIX systems. The vi often frustrates new users with a unique distinction between its two modes:
Name: Class: Date: 9. The compiler ignores all comments they are there strictly for the convenience of anyone reading the program.
Name: Class: Date: Exam #1 - Prep True/False Indicate whether the statement is true or false. 1. Programming is the process of writing a computer program in a language that the computer can respond to
Programming in Perl CSCI-2962 Final Exam
Rules and Information: Programming in Perl CSCI-2962 Final Exam 1. TURN OFF ALL CELULAR PHONES AND PAGERS! 2. Make sure you are seated at least one empty seat away from any other student. 3. Write your
Bachelors of Computer Application Programming Principle & Algorithm (BCA-S102T)
Unit- I Introduction to c Language: C is a general-purpose computer programming language developed between 1969 and 1973 by Dennis Ritchie at the Bell Telephone Laboratories for use with the Unix operating
ESPResSo Summer School 2012
ESPResSo Summer School 2012 Introduction to Tcl Pedro A. Sánchez Institute for Computational Physics Allmandring 3 D-70569 Stuttgart Germany http://www.icp.uni-stuttgart.de 2/26 Outline History, Characteristics,
Excel: Introduction to Formulas
Excel: Introduction to Formulas Table of Contents Formulas Arithmetic & Comparison Operators... 2 Text Concatenation... 2 Operator Precedence... 2 UPPER, LOWER, PROPER and TRIM... 3 & (Ampersand)... 4
Project 2: Bejeweled
Project 2: Bejeweled Project Objective: Post: Tuesday March 26, 2013. Due: 11:59PM, Monday April 15, 2013 1. master the process of completing a programming project in UNIX. 2. get familiar with command
How to Write a Simple Makefile
Chapter 1 CHAPTER 1 How to Write a Simple Makefile The mechanics of programming usually follow a fairly simple routine of editing source files, compiling the source into an executable form, and debugging
Building Software Systems. Multi-module C Programs. Example Multi-module C Program. Example Multi-module C Program
Building Software Systems Multi-module C Programs Software systems need to be built / re-built during the development phase if distributed in source code form (change,compile,test,repeat) (assists portability)
PRI-(BASIC2) Preliminary Reference Information Mod date 3. Jun. 2015
PRI-(BASIC2) Table of content Introduction...2 New Comment...2 Long variable...2 Function definition...3 Function declaration...3 Function return value...3 Keyword return inside functions...4 Function
SendMIME Pro Installation & Users Guide
www.sendmime.com SendMIME Pro Installation & Users Guide Copyright 2002 SendMIME Software, All Rights Reserved. 6 Greer Street, Stittsville, Ontario Canada K2S 1H8 Phone: 613-831-4023 System Requirements
JavaScript: Control Statements I
1 7 JavaScript: Control Statements I 7.1 Introduction 2 The techniques you will learn here are applicable to most high-level languages, including JavaScript 1 7.2 Algorithms 3 Any computable problem can
Simple File Input & Output
Simple File Input & Output Handout Eight Although we are looking at file I/O (Input/Output) rather late in this course, it is actually one of the most important features of any programming language. The
dotdefender v5.12 for Apache Installation Guide Applicure Web Application Firewall Applicure Technologies Ltd. 1 of 11 support@applicure.
dotdefender v5.12 for Apache Installation Guide Applicure Web Application Firewall Applicure Technologies Ltd. 1 of 11 Installation Process The installation guide contains the following sections: System
Using the Radmind Command Line Tools to. Maintain Multiple Mac OS X Machines
Using the Radmind Command Line Tools to Maintain Multiple Mac OS X Machines Version 0.8.1 This document describes how to install, configure and use the radmind client and server tools to maintain a small
Basic C Shell. [email protected]. 11th August 2003
Basic C Shell [email protected] 11th August 2003 This is a very brief guide to how to use cshell to speed up your use of Unix commands. Googling C Shell Tutorial can lead you to more detailed information.
Lecture 18 Regular Expressions
Lecture 18 Regular Expressions Many of today s web applications require matching patterns in a text document to look for specific information. A good example is parsing a html file to extract tags
How to test and debug an ASP.NET application
Chapter 4 How to test and debug an ASP.NET application 113 4 How to test and debug an ASP.NET application If you ve done much programming, you know that testing and debugging are often the most difficult
Code Estimation Tools Directions for a Services Engagement
Code Estimation Tools Directions for a Services Engagement Summary Black Duck software provides two tools to calculate size, number, and category of files in a code base. This information is necessary
VB.NET Programming Fundamentals
Chapter 3 Objectives Programming Fundamentals In this chapter, you will: Learn about the programming language Write a module definition Use variables and data types Compute with Write decision-making statements
I PUC - Computer Science. Practical s Syllabus. Contents
I PUC - Computer Science Practical s Syllabus Contents Topics 1 Overview Of a Computer 1.1 Introduction 1.2 Functional Components of a computer (Working of each unit) 1.3 Evolution Of Computers 1.4 Generations
TIP: To access the WinRunner help system at any time, press the F1 key.
CHAPTER 11 TEST SCRIPT LANGUAGE We will now look at the TSL language. You have already been exposed to this language at various points of this book. All the recorded scripts that WinRunner creates when
SQL Injection Attack Lab Using Collabtive
Laboratory for Computer Security Education 1 SQL Injection Attack Lab Using Collabtive (Web Application: Collabtive) Copyright c 2006-2011 Wenliang Du, Syracuse University. The development of this document
NLP Programming Tutorial 0 - Programming Basics
NLP Programming Tutorial 0 - Programming Basics Graham Neubig Nara Institute of Science and Technology (NAIST) 1 About this Tutorial 14 parts, starting from easier topics Each time: During the tutorial:
Like any function, the UDF can be as simple or as complex as you want. Let's start with an easy one...
Building Custom Functions About User Defined Functions Excel provides the user with a large collection of ready-made functions, more than enough to satisfy the average user. Many more can be added by installing
Manage2 API. by: J. Nick Koston
Manage2 API by: J. Nick Koston Training Seminar 2006 Introduction! Hello, My name is Nick! This presentation is about the Manage2 API.! This also covers basic ideas behind our Manage2 system.! Our Manage2
GDB Tutorial. A Walkthrough with Examples. CMSC 212 - Spring 2009. Last modified March 22, 2009. GDB Tutorial
A Walkthrough with Examples CMSC 212 - Spring 2009 Last modified March 22, 2009 What is gdb? GNU Debugger A debugger for several languages, including C and C++ It allows you to inspect what the program
Hands-On UNIX Exercise:
Hands-On UNIX Exercise: This exercise takes you around some of the features of the shell. Even if you don't need to use them all straight away, it's very useful to be aware of them and to know how to deal
Introduction to Java
Introduction to Java The HelloWorld program Primitive data types Assignment and arithmetic operations User input Conditional statements Looping Arrays CSA0011 Matthew Xuereb 2008 1 Java Overview A high
CSC 120: Computer Science for the Sciences (R section)
CSC 120: Computer Science for the Sciences (R section) Radford M. Neal, University of Toronto, 2015 http://www.cs.utoronto.ca/ radford/csc120/ Week 2 Typing Stuff into R Can be Good... You can learn a
6. Control Structures
- 35 - Control Structures: 6. Control Structures A program is usually not limited to a linear sequence of instructions. During its process it may bifurcate, repeat code or take decisions. For that purpose,
PART-A Questions. 2. How does an enumerated statement differ from a typedef statement?
1. Distinguish & and && operators. PART-A Questions 2. How does an enumerated statement differ from a typedef statement? 3. What are the various members of a class? 4. Who can access the protected members
A Simple Perl Script
Perl What is Perl? Practical Extraction and Report Language Scripting language created by Larry Wall in the mid-80s Functionality and speed somewhere between low-level languages (like C) and high-level
6.170 Tutorial 3 - Ruby Basics
6.170 Tutorial 3 - Ruby Basics Prerequisites 1. Have Ruby installed on your computer a. If you use Mac/Linux, Ruby should already be preinstalled on your machine. b. If you have a Windows Machine, you
AWK: The Duct Tape of Computer Science Research. Tim Sherwood UC Santa Barbara
AWK: The Duct Tape of Computer Science Research Tim Sherwood UC Santa Barbara Duct Tape Systems Research Environment Lots of simulators, data, and analysis tools Since it is research, nothing works together
This is great when speed is important and relatively few words are necessary, but Max would be a terrible language for writing a text editor.
Dealing With ASCII ASCII, of course, is the numeric representation of letters used in most computers. In ASCII, there is a number for each character in a message. Max does not use ACSII very much. In the
Lecture 5. sed and awk
Lecture 5 sed and awk Last week Regular Expressions grep egrep Today Stream manipulation: sed awk Sed: Stream-oriented, Non- Interactive, Text Editor Look for patterns one line at a time, like grep Change
Lecture 22: C Programming 4 Embedded Systems
Lecture 22: C Programming 4 Embedded Systems Today s Goals Basic C programming process Variables and constants in C Pointers to access addresses Using a High Level Language High-level languages More human
MATLAB Tutorial. Chapter 6. Writing and calling functions
MATLAB Tutorial Chapter 6. Writing and calling functions In this chapter we discuss how to structure a program with multiple source code files. First, an explanation of how code files work in MATLAB is
Visual Basic Programming. An Introduction
Visual Basic Programming An Introduction Why Visual Basic? Programming for the Windows User Interface is extremely complicated. Other Graphical User Interfaces (GUI) are no better. Visual Basic provides
Introduction to Web Services
Department of Computer Science Imperial College London CERN School of Computing (icsc), 2005 Geneva, Switzerland 1 Fundamental Concepts Architectures & escience example 2 Distributed Computing Technologies
SQL Server Database Coding Standards and Guidelines
SQL Server Database Coding Standards and Guidelines http://www.sqlauthority.com Naming Tables: Stored Procs: Triggers: Indexes: Primary Keys: Foreign Keys: Defaults: Columns: General Rules: Rules: Pascal
Simulation Tools. Python for MATLAB Users I. Claus Führer. Automn 2009. Claus Führer Simulation Tools Automn 2009 1 / 65
Simulation Tools Python for MATLAB Users I Claus Führer Automn 2009 Claus Führer Simulation Tools Automn 2009 1 / 65 1 Preface 2 Python vs Other Languages 3 Examples and Demo 4 Python Basics Basic Operations
DATA STRUCTURES USING C
DATA STRUCTURES USING C QUESTION BANK UNIT I 1. Define data. 2. Define Entity. 3. Define information. 4. Define Array. 5. Define data structure. 6. Give any two applications of data structures. 7. Give
13 Classes & Objects with Constructors/Destructors
13 Classes & Objects with Constructors/Destructors 13.1 Introduction In object oriented programming, the emphasis is on data rather than function. Class is a way that binds the data & function together.
IBM Tivoli Access Manager for e-business 6.1: Writing External Authentication Interface Servers
IBM Tivoli Access Manager for e-business 6.1: Writing External Authentication Interface Servers White Paper Ori Pomerantz ([email protected]) July 2010 Copyright Notice Copyright 2010 IBM Corporation, including
Real SQL Programming. Persistent Stored Modules (PSM) PL/SQL Embedded SQL
Real SQL Programming Persistent Stored Modules (PSM) PL/SQL Embedded SQL 1 SQL in Real Programs We have seen only how SQL is used at the generic query interface --- an environment where we sit at a terminal
Hands-on Exercise 1: VBA Coding Basics
Hands-on Exercise 1: VBA Coding Basics This exercise introduces the basics of coding in Access VBA. The concepts you will practise in this exercise are essential for successfully completing subsequent
Dynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction
Lecture 11 Dynamic Programming 11.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
Channel Access Client Programming. Andrew Johnson Computer Scientist, AES-SSG
Channel Access Client Programming Andrew Johnson Computer Scientist, AES-SSG Channel Access The main programming interface for writing Channel Access clients is the library that comes with EPICS base Written
