Molecular Diagnosis of Gastrointestinal Tumors

Transcription

1 Molecular Diagnosis of Gastrointestinal Tumors Zoltan Szentirmay National Institute of Oncology Center of Surgical and Molecular Tumor Pathology EEA and Norwegian Financial Mechanisms in Hungary, Development of joint Hungarian and Norwegian strategy for cancer treatment by molecular methods. (Prevention, early diagnosis and therapy)

2 Colorectal cancers

3 Patients and Methods Totally 634 surgically resected colorectal cancer samples. Database construction. Isolation of DNA form FFPE tumor samples by the assistance of MagNa Pure Compact machine. PCR-based microsatellite instability test according to Dietmaier and Hofstadter (Lab. Invest., 81: , 2001). Real-time PCR amplification and melting point analysis of KRAS exon 2 and BRAF exon 15 gene regions. DNA sequence analysis of amplicons.

4 Five-year Survivig Rate of Gastic and Colorectal Cancer Based on the National Cancer Registry % Canada Italy Norway Finland Hungary Kanada Olaszország Norvégia Finnország Magyarország Gastric Gyomorrák cancer Colorectal Vastagbélrák cancer Tusnády G, Gaudi I, Rejtő L, Kásler M és Szentirmay Z: Survival chances of Hungarian cancer patients in the National Cancer Registry. Magyar Onkol., 52: , 2008

5 Genetic classification of colorectal cancers MMR negative phenotype MMR positive phenotype Sporadic CrC develops via polypcancer sequence Hereditary nonpolyposis CrC (HNPCC) Sporadic CRC develops due to the CpG metilation of hmlh1 (CIMP+) Microsatellite stabilty (MSS) Chromosomal instability Microsatellite instability (MSI-H) Chromosomal stability

6 Kaplan-Meier probability survive of CrC according to the TNM-based clinical staging 1,0 0,8 Stage 1 p = ,6 Stage 2 0,4 Stage 3 0,2 Stage 4 0,0 Months

7 Correlation of TNM-based clinical stage and the genotype of CrC at the time of diagnosis Clinical stage HNPCC MSI-H CIMP+ MSI-H Polyp-Cancer MSS Stage (%) Stage (%) Total

8 Kaplan-Meier probability survive of CrC according to the genotype 1,0 0,8 HNPCC 0,6 Sporadic MLH1+, MSI-H 0,4 Sproradic MSS 0,2 0,0 P = hónap

9 Localization of genetically different CRCs Colorectal cancer Right halfcolon Localization % Left half-colon & rectum Total % Sporadic CIMP+ MSI-H HNPCC MSI-H Sporadic MSS P = 0.000

10 Significant genetic alterations influencing the therapy response of colorectal cancers 1. KRAS or BRAF mutation inhibits the therapeutic effects of anti-egfr antibodies. 2. The 5-fluorouracil-based chemotherapy has no any effects on microsatellite instable (MSI-H) carcinoma.

11 EGF Ligand-dependent gene activation EGF EGF Enhanced EGFR signal PTEN KD KD KD KD EGF EGF EGF PI3K mtor PIP3 AKT angiogenesis, cell proliferation, survive Enhanced EGF sensitivity Autocrine receptor stimulation RAS BRAF MEK ERK The receptor function is blocked Anti-EGFR mab ligand 2. exon 12/13 codon or mutation 15. exon V600E (GTG GAG) uncontrolled cell proliferation KD KD KD KD There is no EGFR signal TGFß MSI p21 p27 cyclin D CDK 4/6 unregulated cell cycle

12 Before anti-egfr treatment After anti-egfr treatment KRAS Disease-process: In spite of the anti-egfr treatment liver metastasis developed. G12V Wt control The patient died within two years. EGFR IH

13 Frequency distribution of gain-of-function mutations in codon 12 and codon 13 of KRAS gene (184 tumor samples) 25 Types of mutations

14 Localization of KRAS and BRAF positive CrCs Genetical state Right halfcolon Incidence % Left half colon & rectum Total % KRAS mut BRAF mut P = 0.000

15 Frequency distribution of KRAS and BRAF mutations in hereditary and sporadic CrC CrC types KRAS mut % BRAF mut % HNPCC MSI-H Sporadic CIMP+, MSI-H Sporadic MSS

16 Kaplan-Meier survival function of CrCs according to the KRAS mutation state 1,0 0,8 P = ,6 KRAS mutant 0,4 0,2 0,0 KRAS wt Months

17 Kaplan-Meier survival function of CrCs according to the BRAF mutation state 1,0 p = ,8 0,6 BRAF wt 0,4 BRAF mutant 0,2 0,0 Months

18 Gastrointestinal stromal tumor (GIST)

19 Study Population No. of tumor samples investigated: 72 Sex: Male 38, Female 34 Patients follow up period: between 17 years and 6 mounts Age distribution: % years

20 Methods Collection of formalin-fixed and paraffin-embedded tumor samples and database construction. CD117 and CD34 immunohistochemistry and pathological assessment of the tumor risk categories. Isolation of DNA form FFPE tumor samples by the assistance of MagNa Pure Compact machine. Real-time PCR amplification and melting point analysis of c-kit exon 9, exon 11, and PDGFRA exon 12 and exon 18 gene regions. High resolution capillary gel electrophoresis analysis of amplicons. High resolution melting analysis of c-kit exon 11 using LightCycler 480 PCR system to analyze genetic variations in PCR amplicons. DNA sequence analysis of amplicons.

21 High Resolution Melting Deletion (others) Point mut (red) Wt (blue)

22 C-kit exon 11 Comparison of the Mutation Analysis Methods Real-time PCR amplification and melting point analysis & sequencing High Resolution Melting Wt ********* ********* * * Wt Point mut Deletion Point mut ********* ********* Deletion ********** ********** Asterisks represent tumor samples

23 Localization of GIST (No = 72) Kaplan-Meier probability survival function Localization Frequency (%) Esophagus 2.8 Stomach Small Intestine Large Intestine Extra-intestinal Metastasis ,0 0,8 0,6 0,4 0,2 0,0 Stomach Large intestine Small intestine p= month

24 Pathological Risk Grouping of GIST (No = 72) RISK GROUPS FREQENCY (%) Low risk GIST 40.3 High risk GIST ,0 0,8 0,6 0,4 0,2 0,0 Kaplan-Meier probability survival function Low risk High risk p= month

25 Summary of Significant Genetik Alterations in GIST KIT PDGFRA Ligand-binding domain GIST, AML Extracellular domain (exon 9) GIST Juxtamembrane domain (exon 11) Imatinib (Gleevec) snsitive mut Juxtamembrane domain (exon 12) Gleevec rezistant mutations Tyrosine kinse II domain (exon 18)

26 Significant mutations in GIST 72 tumors Gleevec sensitive mutations, c-kit Exon 9 point m. & dupl Exon 11 del Exon 11 point mut Gleevec resistance mutation, PDGFRA Exon 18 point mut & delins Total 5 (6.9 %) 31 (43.1%) 15 (20.8 %) 8 (11.1 %) 59 (81.9%)

27 C-Kit exon 11 Highly Gleevec sensitive deletion mutations Types of deletion in 14 tumor samples cdna ACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC A---A ACCCATGTATGAA GAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACA TGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAG------GTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC ACCCATGTATGAAGTACAGTGG GG ACCCATGTATGAAGTACAGTGG CCAACACAACTTCC ACCCATGTATGAAGTACAGTGGAAG GACCCAACACAACTTCC ACCCATGTATGAAGTACAGTGGAAGGTT CC ACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAA---CC c

28 C-Kit exon 11 Highly Gleevec sensitive point mutations Mutation pattern (14 tumors) c.1669t c.1669t c.1727t 1650 c.1666c c.1676t 1730 ACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC >T >C >C >A >A >A >A >G >C >A >A >G >C >C

29 C-Kit exon 9 Moderately Gleevec sensitive point mutations and SNPs 9 tumors (5 mutations, 4 SNPs) c.1357t c.1391c 1354 c.1383a c.1414c 1430 GCTTCTGTACTGCCAGTGGATGTGCAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTC >C >G snp >G snp >T snp >T c.1445c c.1486g c c.1497g 1509 TATAGATTCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAGACTTCTGCCTAT >A snp >A >A >GCCTAT duplication

30 Detection and Frequency of Gene Alterations in exon 18 of PDGFRA Detection of p.d842v mutation by real-time PCR and melting point analysis GENE ALTERATION FREQUECY % c.2525a>t (p.d842v) Delins c.2472c>t snp c.2442t>c snp c.2526c>t snp c.2538t>c snp c.2525 A>T mut

31 Correlation Between the Mutation Status of c-kit exon 9 & 11 and the Metastatic Potential of GIST C-kit Metastasis Absent Present Total % Wild type Exon 9 & 11 point mut Exon 11 deletion Pearson chi-square P = The c-kit mutations promote the metastatic tendency of GIST

32 MP487/08, 55-year-old male with a 42x35x31 mm abdominal mass and a 22 mm in diameter nodule in the 5th segment of liver. Core biopsy from the abdominal mass and liver nodule. Primary tumor Liver metastasis KIT (CD117) KIT (CD117)

33 MP487/08 ckit exon 11: 35 bp deletion Mutant allele Wt allele Heterodimers Prim. Met. mut Heterodimers wt High resolution capillary gel electrophoresis

34 55 year-old male, at the time of diagnosis 8 moths after Gleevec treatment

35 Kaplan-Meier Probability Function of Gleevec Sensitive Mutation Bearing GIST Versus other Subtype of GIST 1,0 0,8 0,6 C-kit exon 9 & 11 mutant GIST (51 tumors) C-kit wt and PDGFRA resistance mutant GIST (21 tumors) 0,4 0,2 0, month