Research Journal of Pharmaceutical, Biological and Chemical Sciences
|
|
|
- Angela Bruce
- 9 years ago
- Views:
Transcription
1 Research Journal of Pharmaceutical, Biological and Chemical Sciences Protein coding gene, cels2 shows congruency with 16S rrna phylogeny in highly evolving streptomycetes Madison P Munar 1,2*, Young-Geun Eom 1, Yeong-Suk Kim 1 and Tae-Jong Kim 1 1 Department of Forest Products and Biotechnology, College of Forest Science, Kookmin University, 77, Jeongneung-ro, Seongbuk-gu, , Seoul, South Korea 2 Department of Biology, College of Science, University of the Philippines Baguio, Governor Pack Road, Baguio City 2600, Philippines ABSTRACT This paper examined the potential of putative cellulose binding protein gene, cels2, in defining the molecular phylogeny of streptomycetes, a highly evolving and important soil-dwelling bacterial species. There have been numerous attempts on the use of molecular markers in establishing the phylogeny of this medically important group. However, cellulase genes have not yet been investigated. Results highlighted the higher evolutionary rate in cels2 gene (5%) than 16S rrna (0.5%) making it a good candidate as a molecular chronometer for future evolutionary studies in streptomycetes. Moreover, this study showed the congruency of tree topology using three different building algorithms, Unrooted Neighbor-Joining, Unrooted Maximum- Likelihood and Unrooted Unweighted-Pair Group with Arithmetic Mean of a protein coding gene and 16S rrna which were analyzed simultaneously using multiple sequence alignment. Keywords: cels2, 16S rrna, Streptomyces coelicolor M145, phylogeny, Neighbor-Joining, Maximum-Likelihood *Corresponding author January February 2015 RJPBCS 6(1) Page No. 108
2 INTRODUCTION Streptomycetes are soil-dwelling bacterial species that are reported to produce a plethora of secondary metabolites such as antifungal, antibacterial and anti-cancer drugs. Streptomycetes are also reported to produce industrially important compounds such as cellulase. The high guanine and cytosine bases in the genome of this bacterial species are of great interest because this made streptomycetes a highly evolving bacterial species [1]. At present, there are about 800 unidentified strains of streptomycetes and the growing number of these unidentified strains is becoming a challenge. Several studies were conducted in investigating the molecular phylogeny of streptomycetes which include the use of molecular markers such as ATP synthase (atpd), DNA gyrase subunit B (gyrb), DNA repair gene (reca), RNA polymerase (rpob), tryptophan synthase (trpb) and 16S rrna [2,3]. Previous researches suggested to look into more robust and highly polymorphic molecular markers that would resolve the confusing taxonomy of this bacterial group. Cellulase genes, however, were not yet fully investigated in streptomycetes. Cellulase genes in the genome of the model actinomycete, S. coelicolor A3 (2), were reported to be found in the arms of the linear chromosome of this fungal-like bacterial species [1]. Basic local alignment search tool (BLAST) suggests that there are about 19 species of Streptomyces with reported cellulase coding genes. This relatively low turnout of genetically related species indicates that cellulase genes in streptomycetes are not well studied and their importance as agents in carbon cycling appears yet under appreciated. Control strain MATERIALS AND METHODS Pure culture strain of S. coelicolor M145 was obtained from the Extract Collection of Useful Microorganisms (ECUM), Myongji University in South Korea. This was cultured in R5 minus agar medium which was modified from R5 medium that lacks KH 2 PO 4, CaCl 2 and L-proline [4]. The strain was incubated for five days at 28 C prior to extraction of chromosomal DNA. DNA Extraction Bacterial cells grown in R5 minus agar plate were aseptically transferred in 100 ml of R5 minus broth medium. The inoculated broth medium was incubated at 28 C with 200 rpm for three days in a shaking incubator (Innova 4300, New Brunswick Scientific Co., Inc, Edison, NJ, USA). About five hundred microliters of bacterial cells were collected in a microcentrifuge tube by centrifugation at 13,500 rpm. DNA was extracted using CTAB method [5]. Primer design There are 11 cellulase genes in S. coelicolor A3 (2) according to the genomic project ( The DNA sequence of cels2 gene (SCO1188) was viewed and annotated using the Artemis program. Homologous sequences of cels2 gene were identified using protein BLAST search in the database of National Center for Biotechnology Information (NCBI). Among the homologous sequences were S. coelicolor A3(2) (AL and AL ), Streptomyces sp. THW31(HQ2812.1), S. avermitilis MA-4680 (BA ), S. hygroscopicus subsp. jinggangensis 5008 (CP ), S. flavogriseus ATCC (CP ), Kitasatospora setae KM-6054 (AP ), S. scabiei (FN ), Streptomyces sp. SirexAA-E (CP0023.1), S. violaceusniger Tu 4113 (CP0024.1). Conserved sequences among the homologous strains were identified and oligonucleotide primers were designed using Primer3 program. The forward sequence with 19 base pairs having % GC ratio (CTGTACAACTGGTTCGCCG) and the reverse sequence with 23 base pairs having 47.83% GC ratio (GAGAAGAAGTTTTCCTGGCTGTC) of primers were used during the polymerase chain reaction for the amplification of cels2 gene. January February 2015 RJPBCS 6(1) Page No. 109
3 Polymerase Chain Reaction The optimized PCR mixture consisted of 1x e-taq buffer, 0.2 mm dntp, 0.8 µm/l each of forward and reverse primers, 0.05 U/µL e-taq polymerase (SolGent Co., Ltd), 1.0 µl of extracted DNA template was used and the total volume was adjusted to 10 µl per reaction volume. The optimized PCR profile cycle began with pre-denaturation at 94 C for two minutes for one cycle, followed by 40 cycles of denaturation at 94 C for 20 seconds, annealing at 61 C for 40 seconds and extension at 72 C for one minute and then a final extension at 94 C for five minutes for one cycle. PCR gradient machine (BIOER, Genepro) was used in this study. Five microliters of PCR products with 1.0 µl 6X loading dye (Invitrogen) were loaded into 1% agarose gel for electrophoresis using MUPID-2 plus (Mini gel electrophoresis) at 120V for 20 minutes. One kb ladder (Invitrogen) was used for size estimation in the gel electrophoresis. Ethidium bromide was used for gel staining for 15 minutes with constant shaking and the gel was de-stained with distilled water for another 15 minutes with constant shaking using Orbital shaker (FINEPCR). PCR amplicons were observed using Gel Documentation System (BIORAD). PCR amplicons were excised from gel and were sent to SolGent, Korea for sequencing. Phylogenetic analysis cels2 gene and 16S rrna deduced amino acid sequences were simultaneously analyzed using three different building algorithms which include two distance-based tree methods, Neighbor-Joining (NJ) [6] and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) [7] and one character-based tree method, Maximum-Likelihood (ML) [8]. The logic behind the use of three different building methods is that if a clade or certain grouping of species was supported by different building methods, with all their advantages and disadvantages, the phylogenetic tree obtained is from the data under analysis and is not biased from the method being used [9]. Jones-Taylor-Thornton (JTT) model was used for distance correction [10]. Bootstrap analysis using 1000 replicates was employed throughout the analyses to estimate the confidence limit of each divergence scenario [11]. RESULTS AND DISCUSSION NCBI annotated nine strains of Streptomyces with reported cels2 gene which includes S. coelicolor A3 (2) (AL ), S. ambofaciens ATCC (AM2383.1), S. viridosporus T7A (AF ), S. griseus subsp. griseus NBRC (AP ), S. flavogriseus ATCC (CP ), S. halstedii (U ), Streptomyces sp. THW31 (HQ2812.1), Streptomyces sp. SirexAA-E (CP0023.1) and Kitasatospora setae KM-6054 (AP ). However, only six strains with available 16S rrna sequences were used in the phylogenetic analyses (Table 1). DNA sequences of unknown streptomycetes isolated from soil were also included in the phylogenetic analyses. Table 1: Strains and GenBank accession numbers of sequences used in the phylogenetic analyses of cels2 gene and 16S rrna in streptomycetes. Strain Streptomyces coelicolor A3(2) Streptomyces sp. SirexAA-E Streptomyces hygroscopicus subsp. jinggangensis 5008 Streptomyces griseus subsp. griseus NBRC Streptomyces flavogriseus ATCC Kitasatospora setae KM-6054 GenBank accession number AL CP CP AP CP AP Based on cels2 phylogenetic trees (Fig. 1, 2 and 3), S. coelicolor M145 is identical with S. coelicolor A3 (2) and this was supported by % bootstrap value. The phylogenetic tree also suggests that all of the unidentified strains are unique to those species available in the public database. Notably, strains , and were consistently grouped in separate cluster from other strains in NJ, ML and UPGMA analyses (Fig. 1, 2 and 3, respectively). Streptomyces. sp. SirexAA-E and S. flavogriseus were consistently January February 2015 RJPBCS 6(1) Page No. 110
4 grouped in NJ, ML and UPGMA building methods and these were supported by 92% - 95% bootstrap values. Tree topology and clustering of species were congruent in the three building methods Streptomyces coelicolor M Figure 1: Unrooted Neighbor-Joining (NJ) tree of Streptomyces strains based on cels2 gene amino acid sequences. Unknown isolates of Streptomyces were found different from strains present in NCBI. Numbers at nodes represent bootstrap values from 1000 resampled datasets. Bar indicates sequence divergence. Jones-Taylor-Thornton (JTT) model was used for distance correction. (*) Homologous sequences from GenBank (see Table 1) Streptomyces coelicolor M Figure 2: Unrooted Maximum-Likelihood (ML) tree of Streptomyces strains based on cels2 gene amino acid sequences. Unknown isolates of Streptomyces were found different from strains present in NCBI. Numbers at nodes represent bootstrap values from 1000 resampled datasets. Bar indicates sequence divergence. Jones-Taylor-Thornton (JTT) model was used for distance correction. (*) Homologous sequences from GenBank (see Table 1). January February 2015 RJPBCS 6(1) Page No. 111
5 Streptomyces coelicolor M Figure 3: Unrooted Unweighted Pair Group with Arithmetic Mean (UPGMA) tree of Streptomyces strains based on cels2 gene amino acid sequences. Unknown isolates of Streptomyces were found different from strains present in NCBI. Numbers at nodes represent bootstrap values from 1000 resampled datasets. Bar indicates sequence divergence. Jones- Taylor-Thornton (JTT) model was used for distance correction. (*) Homologous sequences from GenBank (see Table 1) Figure 4: Unrooted Neighbor-Joining (NJ) tree of Streptomyces strains based on 16S rrna amino acid sequences. Unknown isolates of Streptomyces were supported by 16S rrna phylogenetic tree to be different strains from those strains registered in NCBI. Numbers at nodes represent bootstrap values from 1000 resampled datasets. Bar indicates sequence divergence. Jones-Taylor-Thornton (JTT) model was used for distance correction. (*) Homologous sequences from GenBank (see Table 1). S. coelicolor M145 was not included in the phylogenetic analysis due to the unavailability of 16S rrna sequence. Nonetheless, gene-based phylogenetic tree was observed to be supported by the highly conserved molecular chronometer, 16S rrna, especially in discriminating unidentified strains. January February 2015 RJPBCS 6(1) Page No. 112
6 Figure 5: Unrooted Maximum-Likelihood (ML) tree of Streptomyces strains based on 16S rrna amino acid sequences. Unknown isolates of Streptomyces were supported by 16S rrna phylogenetic tree to be different strains from those strains registered in NCBI. Numbers at nodes represent bootstrap values from 1000 resampled datasets. Bar indicates sequence divergence. Jones-Taylor-Thornton (JTT) model was used for distance correction. (*) Homologous sequences from GenBank (see Table 1). S. coelicolor M145 was not included in the phylogenetic analysis due to the unavailability of 16S rrna sequence. Nonetheless, gene-based phylogenetic tree was observed to be supported by the highly conserved molecular chronometer, 16S rrna, especially in discriminating unidentified strains Figure 6: Unrooted Unweighted Pair Group with Arithmetic Mean (UPGMA) tree of Streptomyces strains based on 16S rrna amino acid sequences. Unknown isolates of Streptomyces were supported by 16S rrna phylogenetic tree to be different strains from those strains registered in NCBI. Numbers at nodes represent bootstrap values from 1000 resampled datasets. Bar indicates sequence divergence. Jones-Taylor-Thornton (JTT) model was used for distance correction. (*) Homologous sequences from GenBank (see Table 1). S. coelicolor M145 was not included in the phylogenetic analysis due to the unavailability of 16S rrna sequence. Nonetheless, gene-based phylogenetic tree was observed to be supported by the highly conserved molecular chronometer, 16S rrna, especially in discriminating unidentified strains. January February 2015 RJPBCS 6(1) Page No. 113
7 16S rrna phylogenetic tree (Fig. 4, 5 and 6) confirmed that unidentified strains are unique to strains available in the public database. The phylogenetic tree generated using 16S rrna showed a more interesting topology. First, having 0.5% sequence divergence which is the lowest observed among the analyses. Second, there is clearer clustering of unidentified strains as compared to the cels2 gene-based phylogenetic tree. Unidentified isolates, , and , were also shown to be in the same cluster as observed in the cels2 gene-based phylogeny. Other clustering observed in 16S rrna phylogenetic tree were samples 119.2, , 1.82, , and 119.5, , 119.7, , , , , , , , 1.15, and These three different clusters formed by unknown and reference strains using 16S rrna were evident as two distinct clusters in cels2 gene-based phylogenetic tree. Streptomyces sp. SirexAA-E and S. flavogriseus were also observed to be consistently grouped in the phylogenetic analyses suggesting a close evolutionary origin between the two species. Design and optimization of polymerase chain reaction parameters to amplify the target gene was successful. Interestingly, cels2 gene has higher sequence divergence as compared to 16S rrna. Having higher sequence divergence than 16S rrna, cels2 gene has a potential to be used as a reference molecular chronometer in future phylogenetic studies on Streptomyces [12]. Apart from having higher sequence divergence, cels2 gene was also observed to be conserved in a number of Streptomyces species. Notably, tree topology of the cels2 gene demonstrated two separate clusters whereas the 16S rrna phylogeny revealed one monophyletic (S. coelicolor A3 (2)-like) and two separate clusters of K. setae-like phylogeny. The congruency of tree topology and species clustering in 16S rrna-based phylogeny and cels2 gene-based phylogeny suggests that cels2 can also be used in intraspecies discrimination within this bacterial group. In present study, we also found out that K. setae KM-6054 to be highly related species to Streptomyces as previously reported [13]. Three different building methods, NJ, ML and UPGMA also showed strong agreement on every analyses made using cels2 gene and 16S rrna. This study reiterates that intraspecies delineation of Streptomyces can be achieved using simultaneous analysis of protein coding genes and 16S rrna. ACKNOWLEDGEMENT This research was funded by the Next-Generation BioGreen 21 Program (No.: PJ009490), Rural Development Administration, Republic of Korea. Sincere gratitude is extended to Professor Elsie C. Jimenez of University of the Philippines Baguio for editing the manuscript and to the graduate students of Kookmin University, BioResource Laboratory, Youngseok Ham, Hee-Hoon Ahn, Yoon-Hee Kim and Han-Saem Park, for the technical support they extended during the conduct of the study. REFERENCES [1] Bently SD, et al. Nature 2002; 417: [2] Kim BJ, et al. Int J Syst Evol Microbiol 2004; 54: [3] Guo Y, et al. Int J Syst Evol Microbiol 2008; 58: [4] Lingzhu M, et al. J Antibiot 2011; 64: [5] William S, et al. Bacterial genomic DNA isolation using CTAB. DOE Joint Genomic Institute [6] Saitou N, and Nei M, Mol Biol Evol 1987;4: [7] Murtagh F, Computational Statistics Quarterly 1984; [8] Felsenstein J, PHYLIP (Phylogeny inference package), version 3.5c. Department of Genetics, University of Washington, Seattle, USA 13. [9] Chelo IM, Ze-Ze L, Tenreiro R, Int J Syst Evol Microbiol 2007; 57: [10] Jones DT, et al. Comput Appl Biosci 12; 8: [11] Felsentein J, Evolution, 1985; 39: [12] Yanez MA, et al. Int J Syst Evol Microbiol 2003; 53: [13] Hsiao N, and Kirby R, Antonie van Leeuwenhoek 2008; 93: January February 2015 RJPBCS 6(1) Page No. 114
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
The Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Nucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Introduction to cloning
1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. June Camerlengo. Santa Fe High School
A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING METHOD IN HIGH SCHOOL BIOTECHNOLOGY LABS. 1 June Camerlengo Santa Fe High School A STUDY ON THE EFFECTIVENESS OF PEER TUTORING AS A TEACHING
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Using Digital Photography to Supplement Learning of Biotechnology. Methods
RESEARCH ON LEARNING Using Digital Photography to Supplement Learning of Biotechnology Fran n orf l u s AbstrAct The author used digital photography to supplement learning of biotechnology by students
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
The Variability in the Fungal Ribosomal DNA (ITS1, ITS2, and 5.8 S rrna Gene): Its Biological Meaning and Application in Medical Mycology
The Variability in the Fungal Ribosomal DNA (ITS1, ITS2, and 5.8 S rrna Gene): Its Biological Meaning and Application in Medical Mycology M. Korabecna * Department of Biology, Faculty of Medicine in Pilsen,
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Biotechnology Explorer
Biotechnology Explorer Chromosome 16: PV92 PCR Informatics Kit Catalog #166-2100EDU explorer.bio-rad.com Note: Kit contains temperature-sensitive reagents. Open immediately upon arrival and store components
DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments
DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]
PTC DNA Fingerprint Gel
BIO 141 PTC DNA Fingerprint Analysis (Modified 3/14) PTC DNA Fingerprint Gel taster non- non- non- non- 100 bp taster taster taster taster taster taster taster ladder Tt tt Tt TT tt tt Tt tt 500 bp 300
