Supporting Information for. Flow cytometer-based high throughput screening system for accelerated directed evolution of P450 monooxygenases

Size: px
Start display at page:

Download "Supporting Information for. Flow cytometer-based high throughput screening system for accelerated directed evolution of P450 monooxygenases"

Transcription

1 Supporting Informtion for Flow cytometer-bsed high throughput screening system for ccelerted directed evolution of P450 monooxygenses Ann Joelle Ruff 1#, Alexnder Dennig 1#, Georgette Wirtz 1, Miln Blnus 2, Ulrich Schwneberg 1* # Both uthors contributed eqully *Corresponding uthor: E-Mil: [email protected] 1 Lehrstuhl für Biotechnologie, RWTH Achen University, Worringerweg 1, Achen, Germny 2 School of Engineering nd Science, Jcobs University Bremen, Cmpus Ring 1, Bremen, Germny Jcobs University Experimentl All chemicls were of nlyticl grde or higher qulity nd purchsed from Sigm-Aldrich Chemie (Steinheim, Germny), AppliChem (Drmstdt, Germny), nd Crl Roth (Krlsruhe, Germny). Oligonucleotides were purchsed from Eurofins MWG Operon (Ebersberg, Germny) in slt-free form nd diluted in milli-q wter to finl concentrtion of 100 µm. All primers used re summrized in Supplementry Tble S1. Restriction enzymes nd nucleotides were purchsed from Ferments (St. Leon-Rot, Germny) nd polymerses from New Englnd Biolbs (Frnkfurt, Germny). PCRs were performed in 0.2 ml thin-wlled PCR tubes from Srstedt (Nuembrecht, Germny) employing Mstercycler Grdient PCR-mchine from Eppendorf (Hmburg, Germny). DNA ws quntified by NnoDrop photometer from NnoDrop Technologies (Wilmington, DE, USA). DNAsequencing ws performed t GATC Biotech (Konstnz, Germny) nd Eurofins MWG-Operon (Ebersberg, Germny). Anlysis of obtined sequencing dt ws performed using the Clone Mnger 9 Professionl Edition Softwre (Scientific & Eductionl Softwre, Cry, NC, USA). EpPCR librry genertion (0.05 mm, 0.1 mm, 0.2 mm MnCl 2 ) EpPCR-librries of P450 BM3 were constructed ccording with vrible MnCl 2 concentrtions 0.05 mm, 0.1 mm, 0.2 mm. 1 Gene specific primers P1 nd P2 (see supplementry tble S1) were used for insert mplifiction. A stndrd EpPCR mster mix of 50 µl contined: Templte plsmid DNA 1 ng/µl, Tq-buffer 1x, dntps 0.2 mm, Tq-polymerse 5 U, ech primer 0.3 pmol/µl, MnCl mm. EpPCR protocol: 94 C for 30 sec (1 cycle); 94 C for 30 sec, 60 C for 1 min, 72 C for 1 min/kb (30 cycles); 72 C for 10 min (1 cycle). For vector mplifiction the primers P3 nd P4 (see supplementry tble S1) were used. The PCR products were DpnI digested (20 U; 37 C, 3 h) nd purified using the Nucleospin Extrct II kit (Mcherey Ngel, Dueren, Germny). Vector-PCR (50 µl) contined: Templte DNA 50 ng/µl, HF-Buffer 1x, dntps 0.2 mm, Phusion High-Fidelity DNA Polymerse (NEB) 5 U, ech S 1

2 primer 0.5 pmol/µl. PCR protocol: 98 C for 30 sec (1 cycle); 98 C for 10 sec, 55 C for 30 sec, 72 C for 1 min/kb (25 cycles); 72 C for 5 min (1 cycle). PCR products were hybridized by using the PLICing cloning method. 2 Expression of P450 BM3 muteins P450 BM-3 mutein expression in flsks nd in deep-well microtiterpltes ws crried out s performed s described previously by Nzor et l.. 3 Flow cytometry ssy with whole cells Cell popultions subjected to be nlyzed by flow cytometry were expressed in flsks. As control, cells expressing the empty vector were used s negtive control. After centrifugtion of the culture (4000 rpm, 20 min, 4 C), cells were wshed in PBS-Buffer nd the pellet ws resuspended in sterile PBS-buffer (in 1/10 of the culture volume). Rection mixture (300 µl) contined, 25 µl resuspended cells, 1 µl BCCE (200 mm in DMSO), PBS-buffer (0.03 M NCl, 2.7 mm KCl, 0.01 M N 2 HPO 4, 1.8 mm KH 2 PO 4, ph 7.4 djusted with HCl) nd ws incubted 90 min. The rection mixture ws diluted 1:10 in PBS-buffer nd filled in 3.5 ml nlysis tubes (Srstedt, Nümbrecht, Germny). The prepred cells were nlyzed in CyFlow Spce flowcytometer (Prtec, Münster, Germny) t liquid flow-speed of 5 µl/min, using PBS-buffer s sheet fluid. Dt of SSC, FSC nd UV-lser emission (FL3: λ Ex 350 nm nd λ Em 450 nm) were recorded. Sorting of desired popultions occurred under size triggering nd gting the UV-lser emission response with trigger dely of 2, pulse of 10 nd sorting speed of events/sec. Sorted cells were collected, plted on LB kn (50 µg/ml) gr pltes nd incubted overnight t 37 C. Enriching for ctive clones ws chieved by wshing sorted nd recovered colonies from gr pltes nd expressing them in flsks followed by nother round of sorting. BCCE ctivity ssy in 96-well plte formt The ssy ws performed nlog to the MTP-ssy described by Nzor 3 with minor modifictions. The hrvested cells in deep-well pltes were resuspended in 300 µl Tris/HCl-buffer (0.1 M, ph 8.2). After ddition of 5 µl polymyxin B sulfte (3.6 mm), the 96-well pltes were incubted for 15 min t RT t 1000 rpm. 100 µl of the lyste were pipetted into blck flt bottom 96well MTP (Greiner Bio-one, Frickenhusen, Germny ) nd incubted for 5 min (700 rpm shking) with 2 µl of BCCE (2 mm in DMSO). The conversion of BCCE ws initited by ddition of 50 µl NADPH (1 mm). The fluorescent signl ws recorded for X min (λ Ex : 400 nm, λ Em : 440 nm) using n Infinite M1000 microtiter plte reder (Tecn Group, Männedorf, Switzerlnd). Protein purifiction P450 BM3 vrints were purified ccording to published protocol 4 by nion-exchngechromtogrphy using n ÄKTAprime plus pumping system (GE Helthcre, München, Germny) nd Kronlb ECOplus TAC 15/125PE5-AB-2 column (YMC Europe, Dinslken, Germny) pcked with Toyo Perl 650 S-DEAE Sephrose Mtrix (Tosoh bioscience, Tokyo, Jpn). The collected frctions were nlyzed on 10 % SDS-PAGE for protein purity. Frctions contining the highest mount of pure P450 BM3 monooxygense were recombined nd concentrted using n Amicon Centrifugl Filter S 2

3 Units (30 kd cut-off membrne; Millipore, Billeric, USA). Deslting of the purified BM3 vrints ws crried using PD-10 Deslting Column (GE Helthcre) equilibrted in Tris/HCl buffer (0.1 M, ph 7.8). Protein solutions were frozen in liquid nitrogen before lyophiliztion for 48 h in Christ ALPHA 1-2LD plus lyophilistor (Christ, Osterode m Hrz, Germny). Kinetic Chrcteristion of P450 BM3 vrints The P450 concentrtion in solution ws determined by crbonmonoxide (CO)-gssing. 5 For kinetic chrcteriztion rection mixture in blck flt bottom MTP contined: 196 µl tris/hcl-buffer (0.1 M, ph 7.8, nm purified enzyme, 2 µl of BCCE nd 5 µl ctlse (12000 U/ml). Estimtion of km nd Vmx were chieved by vrying BCCE concentrtions from 0 to 20 mm. The MTP ws incubted for 15 min t 800 rpm, before rection ws strted by ddition of 50 µl NADPH (1 mm). The fluorescent signl (λ Ex : 400 nm, λ Em : 440 nm) ws recorded using n Infinite M1000 microtiter plte reder (Tecn Group, Männedorf, Switzerlnd). All mesurements were done in triplictes. Concentrtion of the product ws clculted from stndrd curve obtined for 7-hydroxy-3-crboxy coumrin ethyl ester (3-CCE). Fitting of kinetic prmeters ws chieved using Origin 7.0 softwre (OriginLb Corportion, Northmpton, MA, USA). Substrte synthesis 6,7 Step 1 Synthesis of 3-crboxy-coumrin ethyl ester (3-CCE) 8.4 g (60.82 mmol) of 2,4-dihydroxybenzldehyde ws dissolved in 45 ml of nhydrous methnol. Solution ws stirred nd 8.7 g (54.32 mmol) of diethyl mlonte ws supplemented nd refluxed. 450 mg (5.16 mmol) of morpholin nd 150 mg (2.49 mmol) of cetic cid were supplemented to 2 ml of methnol nd stirred until the precipitte fully dissolved. This solution ws subsequently trnsferred to the refluxed rection mixture nd reflux ws continued for nother 3 hours. After cooling, the product ws filtered nd re-crystllized from boiling methnol (~300 ml). Step 2 Preprtion of sodium slt 3-crboxy-coumrin For this step, 1.5 g (6.81 mmol) of 3-CC ethyl ester were dissolved toluene (50 ml), stirred nd heted (120 C) nd concentrted by evportion to 5 ml (30-60 minutes). After cooling the mixture to room temperture, 0.5 g (10.84 mmol) of NH ws supplemented. The mixture ws heted to 120 C nd stirred until toluene evported (1-2 hours). The obtined slt ws dried in vcuum overnight. S 3

4 Step 3 Attching benzyl group to 3-CC ethyl ester 3 g (12.39 mmol) of prepred 3-CC methyl ester sodium slt ws dissolved in 200 ml DMF (dried with moleculr sieves). Mixture ws heted to 120 C. During heting, g (12.5 mmol) of benzyl bromide ws supplemented. Mixture ws stirred gently nd kept t 120 C for 2 hours. One g of benzyl bromide (5.85 mmol) ws supplemented nd conversion continued t 120 C for 4-6 hours nd the sme procedure ws repeted once more (supplementing of benzyl bromide 0.7 g, 4.09 mmol; 1 hrs 120 C). Subsequently the rection mixture ws cooled to room temperture nd poured into 400 ml of ice cold wter. After precipittion (30-60 min), the suspension ws filtered, rinsed with wter, dried nd re-dissolved in CH 2 Cl 2. The orgnic phse ws extrcted twice with wter, filtered, concentrted (Rotvp) nd the precipitte ws dried overnight in vcuum. The trgeted compounds were purified by chromtogrphy employing silic gel (DC60). Smple ws dissolved in CH 2 Cl 2 nd elution ws performed with n ethyl cette : CH 2 Cl 2 (1:20) mixture. Purity ws monitored on TLC using sme solvent system nd min frctions were pooled ccording to TLC. 13 C-NMR nd 1 H-NMR spectr were recorded using Bruker AV400 (Bruker, Mdison, WI, USA). 7-hydroxy-3-crboxy-coumrin ethyl ester (3-CCE): 1 H NMR (400 MHz, DMSO) δ 1.29 (t, 3H, J = 7.2 Hz, CH 3 ); 4.26 (q, 2H, J = 7.2 Hz, CH 2 ); 6.73 (s, 1H, ArH); 6.84 (d, 1H, J = 8.5 Hz, ArH); 7.75 (d, 1H, J = 8.8 Hz, ArH); 8.67 (s, 1H, ArH) ppm. 13 C NMR (400 MHz, DMSO) δ 14.09, 60.76, , , , , , , , , , ppm. 7-benzoxy-3-crboxy-coumrin ethyl ester (BCCE): 1 H NMR (400 MHz, CDCl 3 ) δ 1.32 (t, 3H, J = 7.0 Hz, CH 3 ); 4.31 (q, 2H, J = 7.0 Hz, CH 2 ); 5.07 (s, 2H, CH 2 ); 6.80 (d, 1H, J = 8.7 Hz, ArH); (m, 5H, Ph-Ring); 7.42 (d, 1H, J = 8.7 Hz, ArH); 8.41 (s, 1H, ArH) ppm. 13 C NMR (400 MHz, CDCl 3 ) δ 13.26, 60.69, 69.75, , , , , , , , , , , , , , , , ppm. S 4

5 Tble S1: Primer used in experimentl section Primer P1 Sequence (5-3 ) CATGGGCATGACAATTAAAGAAATGCCTCAG P2 CGACGGAGCTCGAATTCTTATTACCCAGC P3 CGAGCTCCGTCGACAAGCTTGCG P4 GTCATGCCCATGGTATATCTCCTTC bold letters represent phosphorothiolted nucleotides 1 b1 2 b2 Fig. S1: Phse contrst (1, b1) nd Fluorescence microscopy (2, b2) fter incubtion with BCCE nd whole cell expression using n empty vector () nd P450 BM3 F87A (b). S5

6 Fig. S2: Whole cell re-screening with BCCE fter sorting of mixed popultions of E. coli cells in rtios 1:1 nd 9:1 (ctive/inctive). 45 clones were tested for rtio 1:1 nd 15 clones for rtio 9:1. Threshold for inctive clones ws set ccording to cells not expressing P450 BM RFU [-] Time [s] BCCE [µm] Fig. S3: BCCE conversion with purified P450 BM3 M3 DM-1 (R47F F87A M354S D363H R471C N543S R255H) with vried concentrtion. S 6

7 Employed P450 BM3 vrints P450 M3: R47F F87A M354S D363H 3 ; P450 M3 DM: R47F F87A M354S D363H R471C N543S; P450 M3 DM-1: R47F F87A M354S D363H R471C N543S R255H; P450 M3 DM-2: R47F F87A M354S D363H R471C N543S R203H I401V F423L References (1) Cirino, P. C.; Myer, K. M.; Umeno, D. Methods Mol. Biol. (N. Y.). 2003, 231, 3-9. (2) Blnus, M.; Schenk, A.; Sdeghi, H.; Mrienhgen, J.; Schwneberg, U. Anl. Biochem. 2010, 406, (3) Nzor, J.; Dnnenmnn, S.; Adjei, R. O.; Fordjour, Y. B.; Ghmpson, I. T.; Blnus, M.; Rocctno, D.; Schwneberg, U. Protein Eng., Des. Sel. 2008, 21, (4) Schwneberg, U.; Spruer, A.; Schmidt-Dnnert, C.; Schmid, R. D. J. Chromtogr., A 1999, 848, (5) Omur, T.; Sto, R. J. Biol. Chem. 1964, (6) Chilvers, K. F.; Perry, J. D.; Jmes, A. L.; Reed, R. H. J. Appl. Microbiol. 2001, 91, (7) Sun Y.-F.; M S.-Y.; Zhng D.-D.; Cheng, X.-L. Imging Sci. Photochem. 2008, 26, S 7

Study on enzyme-assisted aqueous extraction of oil from soybean

Study on enzyme-assisted aqueous extraction of oil from soybean 8 Journl Scientific & Industril Reserch J SCI IND RES VOL 69 NOVEMBER 2010 Vol. 69, November 2010, pp. 8-865 Study on enzyme-ssisted queous extrction oil from soyben Jun-Qing Qin*, De-Hui Qin, Xing-Mo

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

TransformAid Bacterial Transformation Kit

TransformAid Bacterial Transformation Kit Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Supporting Information

Supporting Information Supporting Information Chemoproteomics-Enabled Discovery of a Potent and Selective Inhibitor of the DNA Repair Protein MGMT Chao Wang +, Daniel Abegg +, Dominic G. Hoch, and Alexander Adibekian* ange_201511301_sm_miscellaneous_information.pdf

More information

Supplementary Information for

Supplementary Information for Electronic Supplementary Material (ESI) for Polymer Chemistry. This journal is The Royal Society of Chemistry 2015 Supplementary Information for Doubly Responsive Polymersomes towards Monosaccharides and

More information

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual

SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript

More information

Protocol: HPLC (amino acids)

Protocol: HPLC (amino acids) Page 1 of 6 1. Chemicals Composition M MW gram volume (ml) product code 0-pthaldialdehyde C 8H 6O 2 134.13 Sigma P0657 Perchloric acid HClO 4 3.5 100.46 Dilute 70% stock solution 1:1 with demi to obtain

More information

ELECTRONIC SUPPLEMENTARY INFORMATION

ELECTRONIC SUPPLEMENTARY INFORMATION ELECTRONIC SUPPLEMENTARY INFORMATION General.. 1 1 HNMR titration fitplots.. 2 1 HNMR titration Job plots... 2 1 HNMR spectra of 1 + TBAacetate. 3 Isothermal Titration Calorimetry.. 3 High Resolution Mass

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

Transformation Protocol

Transformation Protocol To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic

More information

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency

More information

Rate and Activation Energy of the Iodination of Acetone

Rate and Activation Energy of the Iodination of Acetone nd Activtion Energ of the Iodintion of Acetone rl N. eer Dte of Eperiment: //00 Florence F. Ls (prtner) Abstrct: The rte, rte lw nd ctivtion energ of the iodintion of cetone re detered b observing the

More information

GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)

GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) 1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial

More information

Agrobacterium tumefaciens-mediated transformation of Colletotrichum graminicola and Colletotrichum sublineolum

Agrobacterium tumefaciens-mediated transformation of Colletotrichum graminicola and Colletotrichum sublineolum Agrobacterium tumefaciens-mediated transformation of Colletotrichum graminicola and Colletotrichum sublineolum Flowers and Vaillancourt, 2005. Current Genetics 48: 380-388 NOTE added by L. Vaillancourt:

More information

Supporting Information

Supporting Information Copyright WILEY VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2012. Supporting Information for Adv. Funct. Mater., DOI: 10.1002/adfm.201102486 Colorimetric Detection of Warfare Gases by Polydiacetylenes

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

HighPure Maxi Plasmid Kit

HighPure Maxi Plasmid Kit HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer

More information

4026 Synthesis of 2-chloro-2-methylpropane (tert-butyl chloride) from tert-butanol

4026 Synthesis of 2-chloro-2-methylpropane (tert-butyl chloride) from tert-butanol 4026 Synthesis of 2-chloro-2-methylpropane (tert-butyl chloride) from tert-butanol OH + HCl Cl + H 2 O C 4 H 10 O C 4 H 9 Cl (74.1) (36.5) (92.6) Classification Reaction types and substance classes nucleophilic

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Fig. S1: Effect of ISO- and TAC-treatments on the biosynthesis of FAS-II elongation products in M. tb H37Ra. LC/MS chromatograms showing a decrease in products with elemental compositions

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

Experimental procedures. Solid phase peptide synthesis (SPPS)

Experimental procedures. Solid phase peptide synthesis (SPPS) Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry This journal is The Royal Society of Chemistry 214 Experimental procedures Solid phase peptide synthesis (SPPS) Solid phase

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Plant Genomic DNA Extraction using CTAB

Plant Genomic DNA Extraction using CTAB Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however

More information

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

ELUTION OF DNA FROM AGAROSE GELS

ELUTION OF DNA FROM AGAROSE GELS ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to

More information

Cloning GFP into Mammalian cells

Cloning GFP into Mammalian cells Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan

More information

The International Association for the Properties of Water and Steam. Release on the Ionization Constant of H 2 O

The International Association for the Properties of Water and Steam. Release on the Ionization Constant of H 2 O The Interntionl Assocition for the Properties of Wter nd Stem Lucerne, Sitzerlnd August 7 Relese on the Ioniztion Constnt of H O 7 The Interntionl Assocition for the Properties of Wter nd Stem Publiction

More information

LAB 7 DNA RESTRICTION for CLONING

LAB 7 DNA RESTRICTION for CLONING BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction

More information

Southern Blot Analysis (from Baker lab, university of Florida)

Southern Blot Analysis (from Baker lab, university of Florida) Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN

More information

An In-Gel Digestion Protocol

An In-Gel Digestion Protocol An In-Gel Digestion Protocol This protocol describes the digestion of a protein present in an SDS-PAGE gel band with trypsin. The band can be taken from either a 1D or 2D electrophoresis gel. Reagents

More information

Peptide Antibody Production

Peptide Antibody Production Peptide Antibody Production A) Peptide BioSynthesis (http://www.biosyn.com, 800-227-0627) B) Conjugation of peptide to KLH (Imject Maleimide Activated KLH, PIERCE=Thermo #77605, 10 mg) C) Peptide affinity

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

Introduction to cloning

Introduction to cloning 1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

HiPer Total RNA Extraction Teaching Kit

HiPer Total RNA Extraction Teaching Kit HiPer Total RNA Extraction Teaching Kit Product Code: HTBM012 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1 hour Agarose Gel Electrophoresis: 1 hour Storage Instructions:

More information

The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.

The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA. INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade

More information

Eleni Kalogria Athanasia Varvaresou Spyridon Papageorgiou Evaggelia Protopapa Ioannis Tsaknis Alexios Matikas Irene Panderi

Eleni Kalogria Athanasia Varvaresou Spyridon Papageorgiou Evaggelia Protopapa Ioannis Tsaknis Alexios Matikas Irene Panderi Chromtogrphi (2014) 77:1275 1281 DOI 10.1007/s10337-014-2722-9 ORIGINAL Pre Column Derivtiztion HPLC Procedure for the Quntittion of Aluminium Chlorohydrte in Antiperspirnt Crems Using Quercetin s Chromogenic

More information

LAB 11 PLASMID DNA MINIPREP

LAB 11 PLASMID DNA MINIPREP LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.

More information

The D-glucosamine-derived pyridyl-triazole@palladium recoverable catalyst for Mizoroki-Heck reactions under solvent-free conditions

The D-glucosamine-derived pyridyl-triazole@palladium recoverable catalyst for Mizoroki-Heck reactions under solvent-free conditions Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 204 Supporting Information The D-glucosamine-derived pyridyl-triazole@palladium recoverable catalyst

More information

Mouse ES Cell Nucleofector Kit

Mouse ES Cell Nucleofector Kit page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol

More information

MEF Starter Nucleofector Kit

MEF Starter Nucleofector Kit page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated

More information

Protein Precipitation Protocols

Protein Precipitation Protocols Protein Precipitation Protocols Notes: All reagents need to high purity/hplc quality. All tubes used should be new or hand cleaned thoroughly with Micro90 detergent. High quality water needs to be used

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

Troubleshooting Guide for DNA Electrophoresis

Troubleshooting Guide for DNA Electrophoresis Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding

More information

A Ratiometric NMR ph Sensing Strategy Based on Slow- Proton-Exchange (SPE) Mechanism

A Ratiometric NMR ph Sensing Strategy Based on Slow- Proton-Exchange (SPE) Mechanism Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 A Ratiometric NMR ph Sensing Strategy Based on Slow- Proton-Exchange (SPE) Mechanism Loïse

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

HT F Homogeneous PARP Inhibition Assay Kit. HT F Homogeneous PARP Inhibition Assay Kit. 96 Tests. Table of Contents.

HT F Homogeneous PARP Inhibition Assay Kit. HT F Homogeneous PARP Inhibition Assay Kit. 96 Tests. Table of Contents. For Research Use Only. Not For Use In Diagnostic Procedures HT F Homogeneous PARP Inhibition Assay Kit 96 Tests HT F Homogeneous PARP Inhibition Assay Kit Cat# 4690-096-K Cat# 4690-096-K Table of Contents

More information

RNA Isolation for Frozen Mouse Livers and Reverse Transcription

RNA Isolation for Frozen Mouse Livers and Reverse Transcription RNA Isolation for Frozen Mouse Livers and Reverse Transcription I. Introduction RNA is typically isolated from tissue or cells based on the procedure originally described by Chomczynski and Sacchi in 1987.

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

DNA SPOOLING 1 ISOLATION OF DNA FROM ONION

DNA SPOOLING 1 ISOLATION OF DNA FROM ONION DNA SPOOLING 1 ISOLATION OF DNA FROM ONION INTRODUCTION This laboratory protocol will demonstrate several basic steps required for isolation of chromosomal DNA from cells. To extract the chromosomal DNA,

More information

Himaja M et al / IJRAP 2010, 1 (1) 147-152

Himaja M et al / IJRAP 2010, 1 (1) 147-152 imj M et l / IJRAP 2010, 1 (1) 147-152 Reserch Article Avilble online through www.ijrp.net SYTESIS AD ATIMICRBIAL ACTIVITY F DICTMI A AALGS imj Mlipeddi *, Mlipeddi Venktrmn b, Shoo Atish Kumr c, Annd

More information

Western Blot Protocol (updated on 05/20/14)

Western Blot Protocol (updated on 05/20/14) Western Blot Protocol (updated on 05/20/14) Required Solutions 10x PBS (1L) 80 g NaCl 2 g KCl 14.4 g Na 2 HPO 4 or 22 g Na 2 HPO 4 7H 2 O 2.4 g KH 2 PO 4 or 2 g KH 2 PO4 Adjust ph to 7.4 Autoclave PBST

More information

RNA Fragment DeepSeq Library Preparation Protocol

RNA Fragment DeepSeq Library Preparation Protocol RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Procedure for RNA isolation from human muscle or fat

Procedure for RNA isolation from human muscle or fat Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)

1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) 1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction

More information

AxyPrep TM Mag PCR Clean-up Protocol

AxyPrep TM Mag PCR Clean-up Protocol AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR

More information

Amaxa Mouse T Cell Nucleofector Kit

Amaxa Mouse T Cell Nucleofector Kit Amaxa Mouse T Cell Nucleofector Kit For T cells isolated from C57BL/6 & BALB/c mice Evaluated for murine T cells isolated from C57BL/6 & BALB/c mice This protocol is designed for murine lymphocytes or

More information

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supplementary Information Real-time monitoring of rolling circle amplification using aggregation-induced

More information

242 Z. Huang, S. Zhang / J. Chromatogr. B 792 (2003) 241 247

242 Z. Huang, S. Zhang / J. Chromatogr. B 792 (2003) 241 247 Journl of Chromtogrphy B, 792 (2003) 241 247 www.elsevier.com/ locte/ chromb Confirmtion of mphetmine, methmphetmine, MDA nd MDMA in urine smples using disk solid-phse extrction nd gs q chromtogrphy mss

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Islet Viability Assessment by Single Cell Flow Cytometry

Islet Viability Assessment by Single Cell Flow Cytometry Islet Viability Assessment by Single Cell Flow Cytometry Page 1 of 8 Purpose: To comprehensively assess the viability of the islet cell preparation prior to transplantation. Tissue Samples: A sample containing

More information

A prochelator with a modular masking group featuring hydrogen peroxide activation with concurrent fluorescent reporting

A prochelator with a modular masking group featuring hydrogen peroxide activation with concurrent fluorescent reporting Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information A prochelator with a modular masking group featuring hydrogen peroxide activation

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

oxidize 4-Cholesten-3-one

oxidize 4-Cholesten-3-one Isolation of Cholesterol from Egg Yolk Preparation: Bring a hard-boiled egg yolk to lab! Cholesterol (1) is a major component of cell membranes. An egg yolk contains about 200 milligrams of cholesterol,

More information

Northern blot analysis for microrna. (Narry Kim s lab)

Northern blot analysis for microrna. (Narry Kim s lab) Northern blot analysis for microrna (Narry Kim s lab) Materials 1. 10~50 μg of total RNA extracted from HeLa cells treated with sirna 2. RNA loading buffer 3. Probe: DNA oligonucleotide complementary to

More information

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

INSTRUCTIONS 56-1190-98. Edition AC

INSTRUCTIONS 56-1190-98. Edition AC Sephacryl S-100 High Resolution Sephacryl S-200 High Resolution Sephacryl S-300 High Resolution Sephacryl S-400 High Resolution Sephacryl S-500 High Resolution INSTRUCTIONS Sephacryl High Resolution chromatography

More information

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis

More information

Glutathione Resin. User Manual. User Manual. Cat. Nos. 635607, 635608, 635619 PT3306-1 (071414)

Glutathione Resin. User Manual. User Manual. Cat. Nos. 635607, 635608, 635619 PT3306-1 (071414) User Manual Glutathione Resin User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Cat. Nos. 635607, 635608, 635619 PT3306-1 (071414)

More information

DNA Isolation Kit for Cells and Tissues

DNA Isolation Kit for Cells and Tissues DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits

More information

Purification of GST-tagged Proteins

Purification of GST-tagged Proteins Purification of GST-tagged Proteins User Manual Protino GST/4B Columns 1 ml Protino GST/4B Columns 5 ml January 2010 / Rev. 01 MACHEREY-NAGEL MN Table of contents 1 Components 4 1.1 Kit contents and storage

More information

Western Blotting: Mini-gels

Western Blotting: Mini-gels Western Blotting: Mini-gels Materials a Protein Extraction Buffer (for callus or kernel), Solution Stock Final Volume Tris-HCl ph 80 1 M 200 mm 20 ml NaCl 4 M 100 mm 25 ml Sucrose 2 M 400 mm 20 ml EDTA

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

Phosphorus, colorimetry, phosphomolybdate, automated-segmented flow

Phosphorus, colorimetry, phosphomolybdate, automated-segmented flow Phosphorus, colorimetry, phosphomolybdate, automated-segmented flow Parameter and code: Phosphorus, total-in-bottom-material, dry weight, I-6600-88 (mg/kg as P): 00668 1. Application This method is used

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Standard Operating Procedure (SOP)

Standard Operating Procedure (SOP) Standard Operating Procedure (SOP) Title: Direct Fluorescent Antibody Test (DFAT) for the detection of Renibacterium salmoninarum in tissues Number: BACT-3 Version: 02 Created December 14, 2011 Approval:

More information

JaERM Software-as-a-Solution Package

JaERM Software-as-a-Solution Package JERM Softwre-s--Solution Pckge Enterprise Risk Mngement ( ERM ) Public listed compnies nd orgnistions providing finncil services re required by Monetry Authority of Singpore ( MAS ) nd/or Singpore Stock

More information

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information