Interfaculty efforts to approach High Performance Computing (HPC) needs. A decade history at Uniandes

Size: px
Start display at page:

Download "Interfaculty efforts to approach High Performance Computing (HPC) needs. A decade history at Uniandes"

Transcription

1 Interfaculty efforts to approach High Performance Computing (HPC) needs. A decade history at Uniandes Alejandro Reyes Ph.D. Assistant Professor Department of Biological Sciences Universidad de los Andes

2 Interfaculty efforts to approach High Performance Computing (HPC) needs. A decade history at Uniandes Harold Castro, Mario Villamizar, Andrés Holguin, Michael Perez, Diego M Riaño, Silvia Restrepo, Alejandro Reyes

3

4 Biology is Computer Sciences next Physics Physics invented internet Tim Berners-Lee, a British scientist at CERN, invented the World Wide Web (WWW) in 1989.

5 Physics was the birth of HPC at Uniandes Before 2005 two small computer clusters, one in Computer Engineering and one in Physics and university wide resources from IT department DSIT School of Sciences School of Engeneering

6 Growing need in physics for more computational power How to better use the computational power within the university for scientist inside and outside? Solution? GRID Cloud computing Cluster computing Dedicated infrastructure usually requires large financial investments

7 EELA E-Infraestructure shared between Europe and Latin America (2006)

8 EELA E-Infraestructure shared between Europe and Latin America (2006) Usuarios G R I D Usuarios Usuarios Uniandes VO EDTEAM VO DTEAM VO EELA VO UNIANDES INTERNET Otras VOs Usuarios VO OPT VO CMS Usuarios

9 EELA E-Infraestructure shared between Europe and Latin America (2006) Eventually leads to project grid-colombia to interconect different universities and regions (2009) Usuarios Uniandes Site Física Site Biología DTI Infraestructura de administración Site Ingeniería Sistemas MOX Site DTI VO UNIANDES

10 HPC and Biological Sciences? We all know Moore s law

11 HPC and Biological Sciences? 10000$ 1000$ 100$ Hiseq' 2000/2500' Hiseq'X' Hiseq2500'RR' NextSeq'500' 10$ Proton' 1$ SOLiD' MiSeq' GS'FLX' ABI$3730xl$ Roche/454$GS$ 0.1$ 0.01$ GA'II' PGM' GS'Junior' PacBio'RS' Illumina$GA$ Series4$ SOLiD$ Illumina$MiSeq$ Ion$Torrent$PGM$ 0.001$ PacBio$RS$ 454$GS$Junior$ $ Ion$Proton$ Illumina$Hiseq$2500$RR$ Sanger ' Illumina$Hiseq$X$ Lex$Nederbragt$(2014)$h3 p://dx.doi.org/ /m9.figshare $ Illumina$NextSeq$500$ $ 10$ 100$ 1000$ 10000$

12 HPC and Biological Sciences? Biology s equivalent to Moore s law: Just Better!

13 New generation of computer scientist now focused on solving biological problems PROYECTOS Aplicaciones Descripción Usuario BLAST HMMER Identifica una cadena de ADN o de proteínas con un grupo de bases de datos (ADN y proteínas) conocidas. Suite de programas para la creación y análisis de modelos estadísticos de un alineamiento múltiple Biología InterproScan Flujo de trabajo (pipeline) para la caracterización funcional de secuencias biológicas. CMS SW Software del proyecto CMS. Física PovRay Crea imágenes, animaciones mediante código. MPICH Implementación de MPI para paralelizar procesos Phedex Administración de información distribuida. Física Aplicaciones Administrativas Descripción Usuario Ganglia Provee monitoreo del estado de los servidores. DTI Genius Interfaz de usuario gráfica para usar el Grid. Todos

14 Usuarios Uniandes What was Biology s HPC capability (2010) Webserver Entrance Workstation Site Física Site Biología MOX DTI Infraestructura de administración Site Ingeniería Sistemas Site DTI Mobyle Galaxy VO UNIANDES NAS: Storage Biosge Computing nodes 3x 24 cores, 32Gb RAM 1x 24 cores, 128GB RAM NFS 2x0,5TB

15 Application: Metagenomic analysis of extreme environments (GEBIX) METAGENOMES WHAT IS COMMON? WHAT IS DIFFERENT? Corporación Corpogen; Universidad Nacional; Universidad del Cauca; Universidad del Valle; Universidad Javeriana; Universidad de Caldas Uniandes

16 gebix 2 Bioinformatics for GEBIX gebix 3 gebix 8 o Internet Almacenamient o gebix 7 gebix 4 gebix 5 gebix 6 biow n PU J bioinfmac bioin f UNIANDES

17 But most Bioinformatics users don t like command line software! Loni Pipeline Cortesía Javier Tabima

18 Building pipelines and running them from a web server allows different infrastructures to be used The computing cluster was heavily used while other computational resources such as teaching clasrooms and laboratories remained idle for most of the time

19 Solution: Bio-UnaGrid

20 Solution: Bio-UnaGrid A virtual machine is executed on each computer of a lab and it works as a slave on a cluster. There is the need for a dedicated node as cluster master

21 Solution: Bio-UnaGrid Virtual cluster can be defined by research groups, custom application environments, etc. A grid solution (several virtual clusters) can be deployed to fulfill different needs. Allow heterogeneous resources, not a good idea in cluster computing.

22 Solution: Bio-UnaGrid Aplicating LONI Pipeline on Grid infraestructure.

23 Solution: Bio-UnaGrid Aplicating LONI Pipeline on Grid infraestructure.

24 What if we want to select what type of machines to use? We want to deploy on-demand Computing Services. CLOUD COMPUTING And if we still want to use idle computing machines at the university? UnaCLOUD

25 The Second International Conference on Cloud Computing, GRIDs, and Virtualization (CLOUD COMPUTING 2011) UnaCloud THE PROBLEM More than 2000 CPU cores

26 The Second International Conference on Cloud Computing, GRIDs, and Virtualization (CLOUD COMPUTING 2011) UnaCloud THE DESIRED SOLUTION Debian with PBS

27 UnaCloud UnaCloud validates the convergence of cloud computing and virtual clusters offering promising opportunities to meet customized computational requirements through the use of an open source, low cost, extensible, interoperable, efficient, scalable, secure and opportunistic IaaS model. UnaCloud provides a multipurpose cloud computing experimental platform to deploy Customizable Virtual Clusters that support new specific computational requirements of academic and research projects. UnaCloud represents an economically attractive solution for building and deploying large scale computing infrastructures. UnaCloud cloud computing features are promising to reduce the development cycle and the generation of results depending on the agile and flexible provisioning and sharing of low cost computing resources Mario Villamizar, Harold Castro

28 Current status of HPC in Uniandes Joint effort Sciences, DSIT, Engineering Current infrastructure 10 servers 4 cores y 8 GB RAM 2 servers 8 cores y 16 GB RAM 6 servers 16 cores y 32 GB RAM Total Cores: servers 24 cores y 32 GB RAM 1 servers 24 cores y 128 GB RAM Total Cores: 96 6 servers 64 cores y 128 GB RAM Total Cores: 384 DSIT - Biology Storage: 15.5 TB /Users /Applications /Scratch Total current users : 30 Engineering (MOX) Storage: 10 TB /Users /Applications /Scratch Total current users: 68 Installed infrastructure 17 servers 24 cores y 192 GB RAM 2 servers 24 cores y 512 GB RAM Total Cores: 456 Storage: 90 TB Total Cores: servers 64 cores y 128 GB RAM Total Cores: 384 Centralized administration

29 Study of viruses (phages) in the human gut

30 Why study phages? Phages are the most abundant biological group on the planet. Phages are more diverse than their bacterial prey, by an estimated ratio of 10 phages per microbe. They play important roles in marine microbial communities. Important drivers of energy balance and nutrient recycling. Shape microbial communities and generate diversity at strain level. Rodriguez-Brito B, et al. (2010) Viral and microbial community dynamics in four aquatic environments. ISME J 4(6):

31 Why study human gut phages? Ecological importance: community dynamics lytic cycles. Evolutionary importance: Predator prey dynamics role in shaping community adaptations/diversity. Lysogenic cycle Horizontal gene transfer, response to environmental signals. Virome diversity fingerprint that can provide more resolution than bacterial species health versus disease.

32 Phage lifecycle Reyes, A.,et al (2012). Going viral: next-generation sequencing applied to phage populations in the human gut. Nature Reviews Microbiology. 10(9)

33 Initial characterization of human virome Initial MOAFTs samples: 4 families MZ twin pairs + Mother 3 Time points (0, 2, 12 months) Virus purification VLPs from frozen fecal samples 454 Sequencing (MDA amplified VLP DNA) Comparison against reference DB. NR_Viral_DB (tblastx) Sample Nomenclature: F: Family T1, T2: Twins M: Mother (R): Technical Replicate F1T1.1 F1T1.3 F1T2.1 F1T2.1(R) F1T2.2 F1T2.3 F1M.1 F1M.2 F2T1.1 F2T1.1(R) F2T1.2 F2T1.3 F2T2.1 F2T2.1(R) F2T2.2 F2M.1 F2M.1(R) F2M.2 F2M.3 F3T1.1 F3T1.2 F3T1.3 F3T2.1 F3T2.2 F3T2.3 F3M.1 F3M.2 F5T2.1 F5T2.1(R) F4T1.1 F4T1.2 F4T1.3 F4T2.1 F4T2.3 F4M.1 F4M.2 F4M.3 F4M.3(R) Percent assignable reads Average unknown 81±6% Reyes, A., et al (2010). Viruses in the faecal microbiota of monozygotic twins and their mothers. Nature, 466(7304),

34 The Malawi viromes and malnutrition Marasmus Kwashiorkor F93 F229 F112 F194 F284 F23 F56 F268 F196 F57 F138 F26 F10 Dz Mz Dz Mz Dz = Dizygotic Mz = Monozygotic Sibling Mother RUTF Kwashiorkor Marasmus Moderate Malnutrition Total: 231 samples Average 56, reads/sample Healthy F95 F37 F301 F47 F121 F209 F259 Dz Mz Age (Months) Reyes, A., et al (2015). Manuscript in preparation

35 New assembly strategies Linear contigs Circular contigs Number of samples Contig Length (bp) % 70% 90% 100% Percent of data used Median coverage of contig Average 90% of data assembled. Contigs 500nt - 200Kb in length. Large number of circular contigs (potential full genomes). Reyes, A., et al (2015). Manuscript in preparation

36 Contigs specific for twin pairs Healthy Kwashiorkor Marasmus Contigs present at high abundance in twin pair over time. Higher number of discriminatory contigs in twinpairs that developed malnutrition. VLP-derived contigs Log (RPMM) F301 F10 F37 F47 F121 F209 F259 F95 F56 F196 F268 F26 F57 F138 F93 F112 F194 F229 F284 F23 Mother Siblings Reyes, A., et al (2015). Manuscript in preparation

37 High diversity of new Eukaryotic viruses Reyes, A., et al (2015). Manuscript in preparation

38 Different lifestyles provides different advantages in the human gut. Reyes A, Semenkovich NP, Whiteson K, Rohwer F, & Gordon JI (2012) Going viral: next-generation sequencing applied to phage populations in the human gut. Nat Rev Microbiol:1-11.

39 Evaluate in a controlled environment viral:bacterial interactions First, introduce 15 prominent, sequenced members of the human gut microbiota into groups of 5 adult germ-free C57Bl/6 mice Then, after model microbiota assembles in mice, add a pool of previously characterized purified VLPs from 5 healthy adults. Microbes + VLPs Microbes + Heat killed VLPs No microbes + VLPs

40 Community changes observed during assembly Add live VLPs Add heat killed VLPs

41 Temporal changes on microbial community -> staged VLP attack 0.15 Bacteroides caccae Time of addition of Live VLPs B. caccae Relative Abundance B. caccae Live VLP Time (d)

42 Temporal changes on microbial community -> staged VLP attack 0.15 Change not seen with heat killed VLPs B. caccae Relative Abundance B. caccae Live VLP B. caccae Heat Killed VLP Time (d)

43 ϕhsc01 Absolute abundance Square root of viral genome equivalents per mg fecal pellet Temporal changes on microbial community -> staged VLP attack B. caccae Relative Abundance ϕhsc01 Live VLP B. caccae Live VLP B. caccae Heat Killed VLP Time (d)

44 ϕhsc01 Absolute abundance Square root of viral genome equivalents per mg fecal pellet Temporal changes on microbial community -> staged VLP attack ϕhsc01 37,323 bp B. caccae Relative Abundance Assembled 37kb circular Phage, contains: - Phage genes - Terminase - Helicase - DNA polymerase - Bacteroides-associated carbohydrate binding protein Anaerobic bacterial stress response transcription factor ϕhsc01 Live VLP B. caccae Live VLP B. caccae Heat Killed VLP Time (d)

45 Other 4 novel viral genomes identified Model Community + Live VLP Model Community + Heat-Killed VLP No obvious associations with a particular bacterial host. No evidence of integration into bacterial genomes. 4,800 4,200 5,400 3,600 6,000 0 ϕhsc02 6,209 bp 3, ,400 1,200 1,800 Viral abundance (square root of genome equivalents per mg fecal pellet weight) 3000 ϕhsc03 153,451 bp ϕhsc ,253 bp ϕhsc05 95,864 bp Time (d) 0 10, ,000 20, ,000 30, ,000 40, ,000 50, ,000 60,000 90,000 80,000 70, , ,000 90,000 20,000 80,000 30,000 70,000 40,000 60,000 50, ,000 9,000 81,000 18,000 72,000 27,000 63,000 36,000 54,000 45,000

46 New Sequencing/Computing technologies has helped us see the clear picture Early Sanger sequencing

47 New Sequencing/Computing technologies has helped us see the clear picture Current Metagenomics

48 New Sequencing/Computing technologies has helped us see the clear picture Hopefully in the close future However, this doesn t allow to learn enough about the biology!

49 Harold Castro Mario Villamizar Andrés Holguin Michael Perez Diego M Riaño Silvia Restrepo Thank You! bcem.uniandes.edu.co

50

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/

More information

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

PARALLEL & CLUSTER COMPUTING CS 6260 PROFESSOR: ELISE DE DONCKER BY: LINA HUSSEIN

PARALLEL & CLUSTER COMPUTING CS 6260 PROFESSOR: ELISE DE DONCKER BY: LINA HUSSEIN 1 PARALLEL & CLUSTER COMPUTING CS 6260 PROFESSOR: ELISE DE DONCKER BY: LINA HUSSEIN Introduction What is cluster computing? Classification of Cluster Computing Technologies: Beowulf cluster Construction

More information

Putting Genomes in the Cloud with WOS TM. ddn.com. DDN Whitepaper. Making data sharing faster, easier and more scalable

Putting Genomes in the Cloud with WOS TM. ddn.com. DDN Whitepaper. Making data sharing faster, easier and more scalable DDN Whitepaper Putting Genomes in the Cloud with WOS TM Making data sharing faster, easier and more scalable Table of Contents Cloud Computing 3 Build vs. Rent 4 Why WOS Fits the Cloud 4 Storing Sequences

More information

Computational infrastructure for NGS data analysis. José Carbonell Caballero Pablo Escobar

Computational infrastructure for NGS data analysis. José Carbonell Caballero Pablo Escobar Computational infrastructure for NGS data analysis José Carbonell Caballero Pablo Escobar Computational infrastructure for NGS Cluster definition: A computer cluster is a group of linked computers, working

More information

NGS Technologies for Genomics and Transcriptomics

NGS Technologies for Genomics and Transcriptomics NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human

More information

Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT

Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT Building Bioinformatics Capacity in Africa Nicky Mulder CBIO Group, UCT Outline What is bioinformatics? Why do we need IT infrastructure? What e-infrastructure does it require? How we are developing this

More information

HPC Cloud. Focus on your research. Floris Sluiter Project leader SARA

HPC Cloud. Focus on your research. Floris Sluiter Project leader SARA HPC Cloud Focus on your research Floris Sluiter Project leader SARA Why an HPC Cloud? Christophe Blanchet, IDB - Infrastructure Distributing Biology: Big task to port them all to your favorite architecture

More information

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions

More information

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!

More information

Alternative Deployment Models for Cloud Computing in HPC Applications. Society of HPC Professionals November 9, 2011 Steve Hebert, Nimbix

Alternative Deployment Models for Cloud Computing in HPC Applications. Society of HPC Professionals November 9, 2011 Steve Hebert, Nimbix Alternative Deployment Models for Cloud Computing in HPC Applications Society of HPC Professionals November 9, 2011 Steve Hebert, Nimbix The case for Cloud in HPC Build it in house Assemble in the cloud?

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Universidad Nacional Autónoma de México. Grid Activities in Mexico

Universidad Nacional Autónoma de México. Grid Activities in Mexico Universidad Nacional Autónoma de México October 2009 Grid Activities in Mexico Former Grid activities EELA impact JRU-MX integration Future work Former experience on Grid GRAMA project (http://www.grama.org.mx/)

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

GC3 Use cases for the Cloud

GC3 Use cases for the Cloud GC3: Grid Computing Competence Center GC3 Use cases for the Cloud Some real world examples suited for cloud systems Antonio Messina Trieste, 24.10.2013 Who am I System Architect

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory [email protected] NGS at the Academic Medical Center Sequence facility Laboratory

More information

Cloud Ready for Bioinformatics?

Cloud Ready for Bioinformatics? IDB acknowledges co-funding by the European Community's Seventh Framework Programme (INFSO-RI-261552) and the French National Research Agency's Arpege Programme (ANR-10-SEGI-001) Cloud Ready for Bioinformatics?

More information

SURFsara HPC Cloud Workshop

SURFsara HPC Cloud Workshop SURFsara HPC Cloud Workshop doc.hpccloud.surfsara.nl UvA workshop 2016-01-25 UvA HPC Course Jan 2016 Anatoli Danezi, Markus van Dijk [email protected] Agenda Introduction and Overview (current

More information

SURFsara HPC Cloud Workshop

SURFsara HPC Cloud Workshop SURFsara HPC Cloud Workshop www.cloud.sara.nl Tutorial 2014-06-11 UvA HPC and Big Data Course June 2014 Anatoli Danezi, Markus van Dijk [email protected] Agenda Introduction and Overview (current

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) [email protected] Paris November 2013 The Sanger DNA sequencing method Sequencing

More information

Typing in the NGS era: The way forward!

Typing in the NGS era: The way forward! Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)

More information

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT

NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT 1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun

More information

Range of studies: List of Courses Taught in Spanish CURSO 2014 15

Range of studies: List of Courses Taught in Spanish CURSO 2014 15 Course Title (English) Course Title (Spanish) Degree Year Semester Caracter Speciality Code ECTS Calculus for Infomatics Cálculo para la Computación BCE BSE BCSE 1st 1st Comp. Subjet 101 6 Discrete Mathematics

More information

Personalized Medicine and IT

Personalized Medicine and IT Personalized Medicine and IT Data-driven Medicine in the Age of Genomics www.intel.com/healthcare/bigdata Ketan Paranjape General Manager, Life Sciences Intel Corp. @Portlandketan 1 The Central Dogma of

More information

Curriculum Reform in Computing in Spain

Curriculum Reform in Computing in Spain Curriculum Reform in Computing in Spain Sergio Luján Mora Deparment of Software and Computing Systems Content Introduction Computing Disciplines i Computer Engineering Computer Science Information Systems

More information

Cloud Computing Architecture with OpenNebula HPC Cloud Use Cases

Cloud Computing Architecture with OpenNebula HPC Cloud Use Cases NASA Ames NASA Advanced Supercomputing (NAS) Division California, May 24th, 2012 Cloud Computing Architecture with OpenNebula HPC Cloud Use Cases Ignacio M. Llorente Project Director OpenNebula Project.

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Boas Betzler. Planet. Globally Distributed IaaS Platform Examples AWS and SoftLayer. November 9, 2015. 20014 IBM Corporation

Boas Betzler. Planet. Globally Distributed IaaS Platform Examples AWS and SoftLayer. November 9, 2015. 20014 IBM Corporation Boas Betzler Cloud IBM Distinguished Computing Engineer for a Smarter Planet Globally Distributed IaaS Platform Examples AWS and SoftLayer November 9, 2015 20014 IBM Corporation Building Data Centers The

More information

IBM Bluemix José Miguel Ordax Cassá [email protected] @jmordax

IBM Bluemix José Miguel Ordax Cassá ordax@es.ibm.com @jmordax Francisco J. Ramos [email protected] IBM Bluemix José Miguel Ordax Cassá [email protected] @jmordax Bluemix ayuda a Transformar ideas en proyectos Cualquier proyecto comienza con una línea de código

More information

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal

More information

Microbial Oceanomics using High-Throughput DNA Sequencing

Microbial Oceanomics using High-Throughput DNA Sequencing Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean

More information

EMBL Identity & Access Management

EMBL Identity & Access Management EMBL Identity & Access Management Rupert Lück EMBL Heidelberg e IRG Workshop Zürich Apr 24th 2008 Outline EMBL Overview Identity & Access Management for EMBL IT Requirements & Strategy Project Goal and

More information

INGENIERíA. Scada System for a Power Electronics Laboratory. Sistema SCADA para un laboratorio de electrónica de potencia Y D E S A R R O L L O

INGENIERíA. Scada System for a Power Electronics Laboratory. Sistema SCADA para un laboratorio de electrónica de potencia Y D E S A R R O L L O INGENIERíA Y D E S A R R O L L O Scada System for a Power Electronics Laboratory Sistema SCADA para un laboratorio de electrónica de potencia Alejandro Paz Parra* Carlos Alberto Lozano** Manuel Vicente

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Automated and Scalable Data Management System for Genome Sequencing Data

Automated and Scalable Data Management System for Genome Sequencing Data Automated and Scalable Data Management System for Genome Sequencing Data Michael Mueller NIHR Imperial BRC Informatics Facility Faculty of Medicine Hammersmith Hospital Campus Continuously falling costs

More information

Milestones of bacterial genetic research:

Milestones of bacterial genetic research: Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical

More information

DNA Sequencing and Personalised Medicine

DNA Sequencing and Personalised Medicine DNA Sequencing and Personalised Medicine Mick Watson Director of ARK-Genomics The Roslin Institute PERSONALISED MEDICINE What is personalised medicine? Personalized Medicine refers to the tailoring of

More information

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Managing and Conducting Biomedical Research on the Cloud Prasad Patil

Managing and Conducting Biomedical Research on the Cloud Prasad Patil Managing and Conducting Biomedical Research on the Cloud Prasad Patil Laboratory for Personalized Medicine Center for Biomedical Informatics Harvard Medical School SaaS & PaaS gmail google docs app engine

More information

Protein Protein Interaction Networks

Protein Protein Interaction Networks Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics

More information

Intro to Bioinformatics

Intro to Bioinformatics Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate

More information

Increasing Flash Throughput for Big Data Applications (Data Management Track)

Increasing Flash Throughput for Big Data Applications (Data Management Track) Scale Simplify Optimize Evolve Increasing Flash Throughput for Big Data Applications (Data Management Track) Flash Memory 1 Industry Context Addressing the challenge A proposed solution Review of the Benefits

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

Curriculum Vitae Dr. José Luis Herrera Diestra

Curriculum Vitae Dr. José Luis Herrera Diestra Personal Information: Curriculum Vitae Dr. José Luis Herrera Diestra Nationality: Venezuelan Date of Birth: 11/15/1977 Address: Cubiculo 10, Departamento de Calculo, Escuela Basica, Facultad de Ingenieria,

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,

More information

Fedora 14 & Red Hat. Descripción del curso:

Fedora 14 & Red Hat. Descripción del curso: Fedora 14 & Red Hat Descripción del curso: Este curso es para los usuarios de Linux que desean comenzar a construir habilidades desde nivel principiante y llegar a la administración de operativo, a un

More information

Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences

Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences WP11 Data Storage and Analysis Task 11.1 Coordination Deliverable 11.2 Community Needs of

More information

The Human Genome. Genetics and Personality. The Human Genome. The Human Genome 2/19/2009. Chapter 6. Controversy About Genes and Personality

The Human Genome. Genetics and Personality. The Human Genome. The Human Genome 2/19/2009. Chapter 6. Controversy About Genes and Personality The Human Genome Chapter 6 Genetics and Personality Genome refers to the complete set of genes that an organism possesses Human genome contains 30,000 80,000 genes on 23 pairs of chromosomes The Human

More information

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing

More information

MARY DOHERTY 1111 Holland Avenue Cambridge, MD 21613 Telephone: 413-887-8896 e-mail: [email protected]

MARY DOHERTY 1111 Holland Avenue Cambridge, MD 21613 Telephone: 413-887-8896 e-mail: mdoherty@umces.edu MARY DOHERTY 1111 Holland Avenue Cambridge, MD 21613 Telephone: 413-887-8896 e-mail: [email protected] PROFESSIONAL PREPARATION Postdoctoral: University of Maryland Center for Environmental Sciences Advisor:

More information

IBM PureSystems: Familia de Sistemas Expertos Integrados

IBM PureSystems: Familia de Sistemas Expertos Integrados IBM PureSystems: Familia de Sistemas Expertos Integrados Carlos Etchart Sales Support Specialist IBM Está IT listo para el Cambio? New server spending Power & cooling costs Server mgmt & admin costs 2013

More information

Twister4Azure: Data Analytics in the Cloud

Twister4Azure: Data Analytics in the Cloud Twister4Azure: Data Analytics in the Cloud Thilina Gunarathne, Xiaoming Gao and Judy Qiu, Indiana University Genome-scale data provided by next generation sequencing (NGS) has made it possible to identify

More information

IMCAS-BRC: toward better management and more efficient exploitation of microbial resources

IMCAS-BRC: toward better management and more efficient exploitation of microbial resources IMCAS-BRC: toward better management and more efficient exploitation of microbial resources Xiuzhu Dong Biological Resources Center Institute of Microbiology, Chinese Academy of Sciences Challenges Global

More information

How To Manage Cloud Service Provisioning And Maintenance

How To Manage Cloud Service Provisioning And Maintenance Managing Cloud Service Provisioning and SLA Enforcement via Holistic Monitoring Techniques Vincent C. Emeakaroha Matrikelnr: 0027525 [email protected] Supervisor: Univ.-Prof. Dr. Schahram Dustdar

More information

Implementation of kalman filter for the indoor location system of a lego nxt mobile robot. Abstract

Implementation of kalman filter for the indoor location system of a lego nxt mobile robot. Abstract Implementation of kalman filter for the indoor location system of a lego nxt mobile robot Leidy López Osorio * Giovanni Bermúdez Bohórquez ** Miguel Pérez Pereira *** submitted date: March 2013 received

More information

BIGS: A Framework for Large-Scale Image Processing and Analysis Over Distributed and Heterogeneous Computing Resources

BIGS: A Framework for Large-Scale Image Processing and Analysis Over Distributed and Heterogeneous Computing Resources BIGS: A Framework for Large-Scale Image Processing and Analysis Over Distributed and Heterogeneous Computing Resources Raúl Ramos-Pollán, Fabio González, Juan C. Caicedo, Angel Cruz- Roa, Jorge E. Camargo,

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Monitoreo de Bases de Datos

Monitoreo de Bases de Datos Monitoreo de Bases de Datos Monitoreo de Bases de Datos Las bases de datos son pieza fundamental de una Infraestructura, es de vital importancia su correcto monitoreo de métricas para efectos de lograr

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

International CEMarin Omics Workshop: Omics Techniques for the Study of Marine Organisms and Ecosystems

International CEMarin Omics Workshop: Omics Techniques for the Study of Marine Organisms and Ecosystems International CEMarin Omics Workshop: Omics Techniques for the Study of Marine Organisms and Ecosystems Genomics, proteomics and metabolomics, used alone, in combination with each other and/or with more

More information

Cloud Computing for Scientific Research

Cloud Computing for Scientific Research Cloud Computing for Scientific Research The NIH Nephele Project for Microbiome Analysis On behalf of: Yentram Huyen, Ph.D., Chief Nick Weber, Scientific Computing Project Manager Bioinformatics and Computational

More information

Curriculum Vitae Lic. José Rafael Pino Rusconi Chio +52 (998) 119 40 78 http://www.joserafaelpinorusconichio.com/ rpino67@hotmail.

Curriculum Vitae Lic. José Rafael Pino Rusconi Chio +52 (998) 119 40 78 http://www.joserafaelpinorusconichio.com/ rpino67@hotmail. Curriculum Vitae Lic. José Rafael Pino Rusconi Chio +52 (998) 119 40 78 http://www.joserafaelpinorusconichio.com/ [email protected] Content 1) Professional summary... 1 2) Professional Experience....

More information

Quick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students

Quick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students Quick Hit Activity Using UIL Science Contests For Formative and Summative Assessments of Pre-AP and AP Biology Students Activity Title: Quick Hit Goal of Activity: To perform formative and summative assessments

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Managing a Tier-2 Computer Centre with a Private Cloud Infrastructure

Managing a Tier-2 Computer Centre with a Private Cloud Infrastructure Managing a Tier-2 Computer Centre with a Private Cloud Infrastructure Stefano Bagnasco, Riccardo Brunetti, Stefano Lusso (INFN-Torino), Dario Berzano (CERN) ACAT2013 Beijing, May 16-21, 2013 motivation

More information

Complex Microbial Communities. Single-Stage Chemostat Model

Complex Microbial Communities. Single-Stage Chemostat Model Characterization of Complex Microbial Communities Developed in a Single-Stage Chemostat Model Of the Human Distal Gut Julie McDonald [email protected] Allen-Vercoe Laboratory University of Guelph Guelph,

More information

OpenCB a next generation big data analytics and visualisation platform for the Omics revolution

OpenCB a next generation big data analytics and visualisation platform for the Omics revolution OpenCB a next generation big data analytics and visualisation platform for the Omics revolution Development at the University of Cambridge - Closing the Omics / Moore s law gap with Dell & Intel Ignacio

More information

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era

More information

BENCHMARKING CLOUD DATABASES CASE STUDY on HBASE, HADOOP and CASSANDRA USING YCSB

BENCHMARKING CLOUD DATABASES CASE STUDY on HBASE, HADOOP and CASSANDRA USING YCSB BENCHMARKING CLOUD DATABASES CASE STUDY on HBASE, HADOOP and CASSANDRA USING YCSB Planet Size Data!? Gartner s 10 key IT trends for 2012 unstructured data will grow some 80% over the course of the next

More information

UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production

UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department

More information

Cloud Based Application Architectures using Smart Computing

Cloud Based Application Architectures using Smart Computing Cloud Based Application Architectures using Smart Computing How to Use this Guide Joyent Smart Technology represents a sophisticated evolution in cloud computing infrastructure. Most cloud computing products

More information

June 2009. Blade.org 2009 ALL RIGHTS RESERVED

June 2009. Blade.org 2009 ALL RIGHTS RESERVED Contributions for this vendor neutral technology paper have been provided by Blade.org members including NetApp, BLADE Network Technologies, and Double-Take Software. June 2009 Blade.org 2009 ALL RIGHTS

More information

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes

More information

Large-scale Research Data Management and Analysis Using Globus Services. Ravi Madduri Argonne National Lab University of Chicago @madduri

Large-scale Research Data Management and Analysis Using Globus Services. Ravi Madduri Argonne National Lab University of Chicago @madduri Large-scale Research Data Management and Analysis Using Globus Services Ravi Madduri Argonne National Lab University of Chicago @madduri Outline Who we are Challenges in Big Data Management and Analysis

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

CONCEPTS OF INDUSTRIAL AUTOMATION. By: Juan Carlos Mena Adolfo Ortiz Rosas Juan Camilo Acosta

CONCEPTS OF INDUSTRIAL AUTOMATION. By: Juan Carlos Mena Adolfo Ortiz Rosas Juan Camilo Acosta CONCEPTS OF By: Juan Carlos Mena Adolfo Ortiz Rosas Juan Camilo Acosta What is industrial automation? Introduction Implementation of normalized technologies for optimization of industrial process Where

More information

FACULTY OF MEDICAL SCIENCE

FACULTY OF MEDICAL SCIENCE Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

Big Data Challenges in Bioinformatics

Big Data Challenges in Bioinformatics Big Data Challenges in Bioinformatics BARCELONA SUPERCOMPUTING CENTER COMPUTER SCIENCE DEPARTMENT Autonomic Systems and ebusiness Pla?orms Jordi Torres [email protected] Talk outline! We talk about Petabyte?

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina [email protected] http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information