Evolution of resupination in Malagasy species of Bulbophyllum (Orchidaceae)

Transcription

1 Molecular Phylogenetics and Evolution 45 (2007) Evolution of resupination in Malagasy species of Bulbophyllum (Orchidaceae) Gunter A. Fischer a,b, *, Barbara Gravendeel c, Anton Sieder a, Jacky Andriantiana d, Paul Heiselmayer b, Phillip J. Cribb e, Eric de Camargo Smidt f, Rosabelle Samuel g, Michael Kiehn a a Department of Biogeography and Botanical Garden, University of Vienna, Rennweg 14, 1030 Vienna, Austria b Department of Organismic Biology, Ecology and Diversity of Plants, University of Salzburg, Hellbrunnerstrasse 34, 5020 Salzburg, Austria c National Herbarium of The Netherlands, Leiden University, Einsteinweg 2, P.O. Box 9514, 2300 RA Leiden, The Netherlands d Parc Botanique et Zoologique de Tsimbazaza (PBZT), Rue Fernand KASANGA, Tsimbazaza, Antananarivo 101, Madagascar e The Herbarium, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AE, UK f Feira de Santana State University, Department of Biological Sciences, Laboratory of Molecular Systematics of Plants, Road BR 116, Km 03, Feira de Santana, Bahia , Brazil g Department of Systematic and Evolutionary Botany, University of Vienna, Rennweg 14, 1030 Vienna, Austria Received 3 January 2007; revised 5 June 2007; accepted 22 June 2007 Available online 18 July 2007 Abstract Resupination is the orientation of zygomorphic flowers during development so that the median petal obtains the lowermost position in the mature flower. Despite its evolutionary and ecological significance, resupination has rarely been studied in a phylogenetic context. Ten types of resupination occur among the 210 species of the orchid genus Bulbophyllum on Madagascar. We investigated the evolution of resupination in a representative sample of these species by first reconstructing a combined nrits and cpdna phylogeny for a sectional reclassification and then plotting the different types of inflorescence development, which correlated well with main clades. Resupination by apical drooping of the rachis appears to have evolved from apical drooping of the peduncle. Erect inflorescences with resupinate flowers seem to have evolved several times into either erect inflorescences with (partly) non-resupinate flowers or pendulous inflorescences with resupinate flowers. Ó 2007 Elsevier Inc. All rights reserved. Keywords: Bulbophyllum; nrits; trnl trnf; trnf ndhj; psba trnh; trne trnd; Orchids; Phylogeny; Resupination 1. Introduction Resupination (from the Latin resupinus, which means facing upward) is the turning of floral buds in such a way that the median petal (called a labellum or lip in orchids) becomes the lowermost part of an opening flower (Ames, 1938). The latter can be achieved by torsion of the pedicel of the flower or other processes like the drooping of parts * Corresponding author. Address: Department of Organismic Biology, Ecology and Diversity of Plants, University of Salzburg, Hellbrunnerstrasse 34, 5020 Salzburg, Austria. Fax: address: gunter.fischer@sbg.ac.at (G.A. Fischer). of the inflorescence as well as development of pendulous inflorescences (Goebel, 1924; Ernst and Arditti, 1994). It is a common phenomenon in orchids and considered to be a diagnostic character of the family (Dressler, 1981). Although scientific evidence for its evolutionary and functional role is still lacking, resupination is generally assumed to expose the upper surface of orchid lips to light in order to emphasize colours and patterns to attract pollinators and facilitate pollination (Ernst and Arditti, 1994). Several physiological processes controlling resupination have been unraveled such as gravitropism and auxin levels (Goebel, 1924; Ernst and Arditti, 1994) but the phenomenon is still poorly understood. Even less is known about the evolution /$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi: /j.ympev

2 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) of resupination as only very few studies have examined the trait in a phylogenetic context (Clark and Zimmer, 2003; Lavin et al., 2003). The genus Bulbophyllum has recently been estimated to comprise 2400 species (Sieder et al., 2007). Its mostly epiphytic species are found in different habitats ranging from (sub)tropical dry forests to wet montane cloud forests and most of them are adapted to fly pollination (Bartareau, 1994; Borba and Semir, 1998; Tan et al., 2002; Nishida et al., 2004; Teixeira et al., 2004). In contrast with the majority of the orchids, an extremely large variation in ways of inflorescence development leading to resupination is present in the 210 species of Bulbophyllum currently described from Madagascar. Inflorescences are either pendulous or erect and resupination can be achieved through torsion of the pedicel and/or rachis (the part of the inflorescence containing flowers) or apical drooping of the peduncle (the sterile part of the inflorescence). This makes the genus an excellent model to study the evolution of development of resupination. For studying the evolution of resupination in Madagascan Bulbophyllum, a good phylogeny is needed. In recent years, several molecular phylogenetic studies of orchids have been published (Hedren et al., 2001; Pridgeon and Chase, 2001; Pridgeon et al., 2001b, 2003; Bateman et al., 2003; Cameron, 2004; Van den Berg et al., 2005; Carlsward et al., 2006) placing Bulbophyllum as sister to the genus Dendrobium within tribe Dendrobieae in the higher Epidendroids clade of subfamily Epidendroideae. Detailed molecular phylogenetic studies of Bulbophyllum have not been published to date but several are being prepared (Gravendeel et al., in preparation; Smidt et al., in preparation). The main objectives of the present study are to (1) reconstruct a multi-gene based phylogeny of Bulbophyllum on Madagascar; (2) test the monophyly of Madagascan Bulbophyllum; (3) compare this phylogeny with the infrageneric classifications of Madagascan Bulbophyllum proposed in the past and (4) reconstruct the evolution of resupination in this group of orchids using a phylogenetic framework. We investigated the phylogenetic relationships of the species of Bulbophyllum on Madagascar by analysing DNA sequences of the plastid trnl trnf, trnf ndhj, psba trnh, trne trnd and nrits regions. The trnl trnf and nrits regions are widely used within Orchidaceae to reconstruct phylogenetic relationships and have been shown useful for detecting DNA sequence divergence at the rank of species (Pridgeon et al., 1999, 2001a, 2003, 2005). Recently, the psba trnh region was proposed to be suitable for DNA bar-coding (Kress et al., 2005). The usefulness of the regions of trnf ndhj, psba trnh, and trne trnd for the reconstruction of phylogenetic relationships between closely related orchid species has not been reported previously (Fig. 1). 2. Materials and methods 2.1. Taxon sampling Species representing all sections of Madagascan Bulbophyllum as described by Schlechter (1924), Perrier de la Bâthie (1939), Bosser (1965, 1969, 1971, 1989, 2000, 2004) and Du Puy et al. (1999) were sampled except for the small sections Lyperocephalum [one species] and Lyperostachys [two species] for which it was not possible to obtain material (see Appendix A). A total of 65% of the species currently described for Madagascar was sampled. From all specimens investigated and from all types, drawings were prepared for identification. For sections Loxosepalum and Ploiarium, whose members are very difficult to distinguish from one other, it was not always possible to identify all accessions to species or to apply a valid name. Further taxonomic and nomenclatural work is necessary for these taxa. Living or silica dried samples were collected in Madagascar in the wild or taken from plants in the living collections at the Parc Botanique et Zoologique de Tsimbazaza (PBZT) in Antananarivo, Madagascar, or at the Botanical Gardens of the Universities of Vienna and Salzburg, all with the appropriate permission. Additional DNA samples were obtained from the Jodrell Laboratories, Kew. Voucher specimens for all accessions have been deposited in one or several of the following herbaria: Parc Botanique et Zoologique Tsimbazaza (TAN, Madagascar), University of Vienna (WU, Austria), University of Salzburg (SZU, Austria) or Royal Botanic Gardens Kew (K, UK). A total of 29 species of Bulbophyllum representing all major continents where the genus occurs, i.e., Africa, South America and Southeast Asia, were chosen as outgroups based on phylogenetic analyses of the Bulbophyllinae worldwide (Gravendeel et al., in preparation) DNA extraction, amplification, and sequencing Fig. 1. Overview of the trnl trnf and the flanking ndhj region sequenced. Arrows indicate the position and direction of primers used. The total length of the amplified region comprised 2272 bp. DNA was extracted from silica gel preserved, herbarium or fresh material using the 2 CTAB (cetyltrimethyl ammonium bromide) procedure of Doyle and Doyle (1987). PCR amplification was performed using GoTaq Ò DNA Polymerase, 5 Green GoTaq Ò Reaction Buffer, PCR Nucleotide Mix (all Promega GmbH, Vienna, Austria) following the manufacturer s protocol and 2 8 ng template DNA for a 50 ll reaction mixture.

3 360 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) The Primers 26SE and 17SE of Sun et al. (1994) where used for the amplification of the nrits regions with the following PCR program: an initial 2 min premelt at 94 C and 34 cycles of 1 min denaturation at 94 C, 1 min annealing at 50 C and 1 min extension at 72 C followed by a final extension for 7 min. For sequencing, the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGT AAAAGTCGTAACAAGG) (White et al., 1990) were used. The cpdna trnl trnf intron was amplified using a newly designed primer F1 (CGCTACGGACTTGATTGG AT) and primer F (Taberlet et al., 1991). The trnf ndhj intron was amplified using the primers E (Taberlet et al., 1991) and ndhj of Vijverberg and Bachmann (1999), psba trnh using the primers psba of Sang et al. (1997) and trnh GUG of Tate and Simpson (2003) and trne trnd using the primers trnd GUC and trne UUC of Demesure et al. (1995). Amplification was carried out with an initial 3 min premelt at 94 C and 30 cycles of 30 s denaturation at 94 C, 30 s annealing at 55 C and 1 min 40 s extension at 72 C followed by a final extension for 7 min at 72 C. PCR products were purified using Wizard Ò PCR Preps DNA Purification System (Promega GmbH, Vienna, Austria) and sequenced at Macrogen Inc., Korea. PCR products of nrits and trnl trnf were cloned using the TOPO-TA Cloning Kit (Invitrogen Corp.), following the manufacturer s protocol because multiple copies were found. Resulting colonies were screened and at least five positive clones were sequenced. The program VectorNTI (Invitrogen Corporation) was used to edit and assemble the sequences. All DNA sequences produced for this study were submitted to GenBank. For several species it was not possible to amplify all molecular markers (see Appendix A) DNA sequence alignment Multiple Sequence alignments were performed using ClustalX (Thompson et al., 1997) and VectorNTI (Invitrogen Corp.) with default settings. Verified sequences were visually inspected and manually adjusted using MacClade 4.08 OSX (Maddison and Maddison, 2005). In the trnl trnf matrix, an unalignable 64 bp part of the spacer region had to be excluded from the phylogenetic analyses for all of the species analysed. Due to the presence of multiple copies, the complete trnl trnf region had to be excluded for all species of sections Bifalcula and Calamaria. Indel coding was done manually following the simple coding method of Simmons and Ochoterena (2000) and with the aid of the program Seqstate (Müller, 2003b) Phylogenetic analysis Maximum parsimony (MP) analyses were undertaken for the individual markers (nrits, trnl trnf, ndhj, psba trnh and trne trnd), for the combined cpdna dataset and for all molecular markers combined using PAUP* 4.0b10 (Swofford, 2002) and PRAP (Müller, 2003a), which generate a command file for conducting parsimony ratchet searches with PAUP*. For each of the ten random additions, 200 ratchet iterations were performed. Each iteration comprised two rounds of TBR swapping, saving one shortest tree, which was used to compute a strict consensus. No further cycles had to be added since the same tree score was soon reached. Support was estimated using 1000 bootstrap replicates, saving 100 trees per replicate. Bootstrap percentages were interpreted as weak (50 74%), moderate (75 84%) or high (85 100%). Congruence between nrits and the combined cpdna data sets were tested using the incongruence length difference (ILD) test (Farris et al., 1995) as implemented by the partition homogeneity test in PAUP* for 100 replicates (heuristic search, simple addition, TBR branching swapping), each saving a maximum of 1000 most parsimonious trees per replicate. This method has been criticized recently (Dolphin et al., 2000; Reeves et al., 2001; Yoder et al., 2001; Norup et al., 2006), therefore we combined the two data sets to explore whether resolution and support would be improved by increasing the amount of sequencing data. This hard incongruence test was performed by directly visually comparing the support and resolution of each of the clades of the separate analyses with a higher bootstrap and posterior probability than BP > 75 and PP > 90 (Wiens, 1998; Sheahan and Chase, 2000; Norup et al., 2006). Bayesian Inference (BI) was generated for the individual markers, for the combined cpdna dataset and for all molecular markers combined using MrBayes (Huelsenbeck and Ronquist, 2001) using default settings. The best fitting model of sequence evolution (GTR + I + G) was chosen based on the result of a hierarchical likelihood ratio test conducted with Modeltest 3.7 (Posada and Crandall, 1998, 2001). Four Markov chains were run simultaneously for 1,000,000 generations and every 10th generation was sampled. After 250,000 generations, a stable probability was reached. All non-significant generations (p < 0.5) were discarded for the consensus tree. In total, 25 vegetative and floral characters (binary and multistate) were scored for the species from which DNA sequences could be obtained (see Table 1) based on observations from living material, alcohol preserved specimens and photographs. If a section or clade showed more than one character state or if the character state was unclear, the assumption equivocal was assigned. Character state optimization was reconstructed using a maximum parsimony assumption (ACCTRAN and DELTRAN optimization) in the Trace Character feature in MACCLADE version 4.08 (Maddison and Maddison, 2005). 3. Results 3.1. Analysis of chloroplast sequence data The combined alignment of all chloroplast markers consisted of 3898 positions (3690 nucleotides and 41

4 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Table 1 Morphological characters analysed 1 Size of the plant: 0 = minute (<1 cm)/ 1 = small/ 2 = intermediate/ 3 = large 2 Spiral vessels in tissue: 0 = present/1 = absent 3 Fresh sheaths or remnants of fresh sheaths covering the rhizome and part of the pseudobulbs: 0 = present/1 = absent 4 Pseudobulbs: 0 = crowded (distance between bulbs is less than the diameter of a bulb)/ 1 = moderately spaced (distance between bulbs is 1 10 times the diameter of a bulb/ 2 = widely spaced (more than ten times the diameter of a bulb) 5 Pseudobulbs: 0 = adaxially flattened/1 = laterally flattened/ 2 = otherwise 6 Number of leafs per pseudobulbs: 0 = 1/1 = 2 7 Type of inflorescence: 0 = synanthous/1 = hysteranthous 8 Rhachis zigzagging: 0 = yes/1 = no 9 Development of inflorescence types: 0 = A/1 = B/2 = C/3 = D1/ 4 = D2/5 = E1/6 = E2/7 = F/8 = G/9 = H 10 Peduncle setaceous (bristle like): 0 = yes/1 = no 11 Inflorescence: 0 = single-flowered/1 = multi-flowered 12 Length of pedicel: 0 = very short (flowers sit on the rhachis)/ 1 = moderate to long 13 Dorsal sepal margin ornamentation: 0 = with long hairs/ 1 = glabrous/2 = papillose 14 Surface of dorsal sepal: 0 = with long hairs/1 = glabrous/ 2 = papillose/3 = warty 15 Lateral sepal margin ornamentation: 0 = with long hairs/ 1 = glabrous/2 = papillose 16 Surface of lateral sepal: 0 = glabrous/1 = papillose/2 = warty 17 Petal apex margin ornamentation: 0 = with long hairs/1 = glabrous/ 2 = papillose/3 = erose 18 Petal apex surface ornamentation: 0 = with long hairs/1 = glabrous/ 2 = papillose 19 Lateral sepals fused (from the column-foot to the middle): 0 = yes/ 1=no 20 Lip moveable: 0 = yes/1 = no (lip enclosed by lateral sepals) 21 Upper margins of column with a tooth: 0 = yes/1 = no 22 Lip with basal acute teeth: 0 = present/1 = absent 23 Hairs on the lip: 0 = present/1 = absent 24 Column-foot with basal tooth: 0 = present/1 = absent 25 Lip apex: 0 = recurved/1 = straight autapomorphic indels varying in size from 1 to 587 bp) and contained 364 phylogenetic informative substitutions. Mean pairwise distance in the ingroup ranged from 0% to 10%. MP analyses yielded >10,000 most parsimonious trees (MPTs) with a length of 1265 steps, a Consistency Index (CI) of 0.65 and a Retention Index (RI) of The strict consensus tree and the BI trees were highly congruent (data not shown). In both analyses, Madagascan Bulbophyllum were strongly supported (BP99/PP100) as monophyletic with the exception of B. longiflorum (widespread in tropical Africa, Madagascar, the Mascarenes, tropical Asia and the south-west Pacific islands), which was deeply nested within the Asian Cirrhopetalum clade. In all trees, seven main clades (A H) were present. Clade A (BP87/PP100) consisted of taxa assigned to section Alcistachys, clade B (BP74/PP97) of section Kainochilus, and clade C of sections Bifalcula, Humblotiorchis and Calamaria (<BP50/PP51). Clade F comprised members of sections Lichenophylax, Trichopus and Pantoblepharon (BP55/ PP91), and clade G was made up of section Loxosepalum (BP87/PP95). Clade H consisted of some of the species of section Ploiarium, and clade E (<BP50/PP73) comprised a large polytomy containing clades F, G, H and taxa from sections Elasmotopus, Hymenopsepalum, Micromonanthe, Lepiophylax, Pachychlamys along with the species of section Ploiarium outside clade G. Clades A G were positioned on a basal polytomy together with B. cardiobulbum (section Calamaria) and B. petrae (section Polyradices) Analysis of nuclear sequence data The total alignment consisted of 906 positions (766 nucleotides and 140 indels varying in size from 1 to 31 bp) and contained 294 phylogenetically informative characters. Mean pairwise distance in the ingroup was similar to the chloroplast dataset. MP analyses yielded >10,000 MPTs with a length of 1724 steps, CI of 0.44 and RI of The strict consensus tree and the BI trees were highly congruent with the cpdna trees and internal nodes received similar statistical support. The monophyly of Malagasy Bulbophyllum with the exception of B. longiflorum was supported by BP88/PP Combined molecular analysis The partition homogeneity test for the nrits and cpdna datasets indicated that the partitions were significantly different from random partitions (p = 0.01). The visual node by node comparison, however, revealed no major incongruencies for the nodes with higher bootstrap support and posterior probability than BP > 75 and PP > 90. The much better resolved tree of the combined analysis compared to the separate analysis of the datasets supports our assumptions that the partition homogeneity test sometimes reveals unreliable results (Dolphin et al., 2000; Reeves et al., 2001; Yoder et al., 2001; Norup et al., 2006), especially for large datasets. The combined MP analyses yielded >10,000 MPTs with a length of 2312 steps, a CI of 0.57 and a RI of The total alignment consisted of 4456 characters and resulted in a similar topology that was, however, more fully resolved and better supported than the combined cpdna and nrits trees with the exception of B. cardiobulbum which ended up in clade C instead of on the basal polytomy. The MP strict consensus tree (not shown) was highly congruent with the BI tree (see Fig. 2). Monophyly of Madagascan Bulbophyllum (with the exception of B. longiflorum) was supported by BP100/ PP100, and of clades A H with BP97/PP99, BP100/PP99, BP87/PP80, BP100/PP100, BP67/PP99, BP84/PP99, BP71/PP98, and BP < 50/PP53, respectively.

5 362 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) /99 100/100 E 94/99 D 67/99 -/55 H -/53 C 87/80 -/53 G 71/98 99/99 53/92 A 97/99 B 100/99 97/100 G1 100/99 H1 F 84/99 97/100 85/99 -/84 -/93 -/90 -/62 60/79 C2 89/93 -/67 75/100 52/97 94/100 -/98 70/94 96/98 80/100 G2 C1 73/61 95/ /100 81/99 69/99 -/90 -/68 73/73 89/100 -/80 99/100 95/99 55/56 -/69 -/95 -/55 99/99 F1 -/99 59/ /100 89/100 97/100 78/99 94/100 69/100 69/99 69/97 84/100 99/100 82/83 67/58 94/100 85/100 57/76 72/100 66/94 97/99 -/73 74/89 -/91 -/58 100/99 100/100 53/96 51/98 100/ /100 94/ / /99 51/95 85/100 84/100 -/66 60/84 65/82 -/55 -/97 100/100 79/99 62/100 96/ / /99 100/99 100/99 61/90 F2 54/- 92/100 B. petrae B. variegatum B. hamelinii B. occlusum B. sulfureum B. alexandreae B. edentatum B. anjozorobeense B. horizontale B. imerinense B. minutum B. implexum B. capuronii B. complanatum B. bicoloratum B. occultum nov. B. elliotii B. sambiranense B. samibiranese B. sambiranense B. elliotii B. quadrifarium B. sambiranense B. pervillei B. elliotii B. lecouflei B. trifarium B. obtusatum B. humblotii B. cardiobulbum B. analamazoatreae B. analamazoatreae B. oxycalyx var. rubescens B. oxycalyx B. rauhii B. rauhii var. andranobeense nov. B. aubrevillei B. francoisii B. francoisii B. amphorimorphum B. liparidioides B. longivaginans B. longivaginans B. vestitum var. meridionale B. vestitum B. molossus B. pachypus B. pachypus B. sandrangatense B. jackyi B. coriophorum B. aff. labatii B. turkii nov. nov. B. insolitum B. aggregatum B. oreodorum B. nitens B. auriflorum indet. B. henrici var. rectangulare B. humbertii B. henrici var. rectangulare B. ankaizinense B. rubiginosum B. cyclanthum nov. B. peyrotii B. platypodum B. amoenum B. ambatoavense B. marovoense B. aff. baronii B. aff. sphaerobulbum B. aff. sphaerobulbum B. aff. baronii B. nutans B. nutans B. nutans B. nutans B. ventriosum B. ochrochlamys B. approximatum B. aff. baronii B. aff. baronii B. melleum B. alleizettei B. nutans B. leandrianum B. calyptropus B. conchidioides B. sciaphile B. ikongoense nov. B. hapalanthos nov. B. ciliatilabrum B. pleurothallopsis B. pantoblepharon B. muscicola B. intertextum B. lupulinum B. mayombeense B. barbigerum B. falcatum B. oxychilum B. chloropterum B. plumosum B. glutinosum B. cribbianum B. bracteolatum B. orectopetalum B. siamense B. smitinandii B. dearei B. dearei B. lobbii B. affine B. macranthum B. patens B. emiliorum B. alsiosum B. hamatipes B. membranifolium B. pileatum B. longiflorum B. longiflorum B. picturatum B. cumingii B. biflorum Africa South America Asia Asia Polyradices Alcistachys Kainochilus Bifalcula Calamaria Humblotiorchis Calamaria Hymenosepalum Elasmotopus Pachychlamys Ploiarium Loxosepalum Micromonanthe Lepiophylax Pachychlamys Lichenophylax Trichopus Pantoblepharon Micromonanthe Outgroup Cirrhopetalum Outgroup sect. Cirrhopetalum Fig. 2. Consensus tree resulting from BI analysis of the combined (nrits and cpdna) data. Bootstrap support and posterior probability values are indicated above the nodes. Section names shaded refer to paraphyletic sections whereas names in bold were found to be monophyletic.

6 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Discussion 4.1. Monophyly and sectional relationships of Madagascan Bulbophyllum In all molecular datasets, Madagascan Bulbophyllum was found to be monophyletic with the exception of B. longiflorum, the only species of the large section Cirrhopetalum also occurring outside Asia. The two sampled accessions, one from Madagascar and one from the island of La Réunion, were deeply nested within an Asian clade comprising 4 species of section Cirrhopetalum and 14 species from different Asian sections. The morphology of B. longiflorum supports this phylogenetic position as the umbellate inflorescence which characterizes the predominantly Asian section Cirrhopetalum is also present in B. longiflorum, justifying its taxonomic assignment to this section. Phylogenetic analyses of additional samples of this species from other parts of its distribution area such as Africa, Indonesia, Malaysia, the Philippines, Papua New Guinea and the Pacific islands and additional species of sect. Cirrhopetalum (comprising ca. 80 species) might show whether this taxon arrived in Madagascar by long distance dispersal. Only five of the 18 sections described by Schlechter (1924), form strongly supported monophyletic groups in the combined molecular analysis (viz., Alcistachys, Bifalcula, Kainochilus, Lichenophylax, and Loxosepalum). Unique morphological synapomorphies characterizing clades are scarce, but supporting combinations of characters are abundant. All species of section Alcistachys (clade A; BP97/PP99) have laterally flattened, bifoliate pseudobulbs, the plants are large, and the inflorescence is synanthous and multi-flowered. Schlechter (1924) used these same features to characterize this section along with the size of the floral bracts and the surface structure of the anther. The latter traits were not scored in this study as they could not be divided into discrete states. The majority of the species of section Kainochilus (clade B) are large to medium-sized plants with unifoliate or bifoliate, brown to red coloured pseudobulbs, multi-flowered erect inflorescences, a hairy lip, and a column with a large tooth on the upper margin. This latter feature occurs in species of section Kainochilus but also in members of the neotropical section Didactyle although this is probably a convergence as the South American species of Bulbophyllum form a distinct well-supported group (Camargo Smidt et al., in preparation). Schlechter (1924) used the majority of the above mentioned characters to recognize Kainochilus. Section Bifalcula (clade D; BP100/PP100) is characterized by small plants, bifoliate pseudobulbs, and a basal tooth on the lip, which is a unique synapomorphy for this group. All species except B. capuronii have a zigzag rachis. Schlechter (1924) used these additional characters for recognition of sect. Bifalcula. Our analyses showed that the hitherto unplaced B. complanatum clearly belongs to this section as well. Section Lichenophylax (clade F1; BP99/PP100) has very tiny, bifoliate pseudobulbs and obligately single-flowered inflorescences, the last character being unique to this group in Madagascar (Fig. 3E). Bulbophyllum muscicola (sect. Micromonanthe), B. petrae (sect. Polyradices) and B. insolitum (sect. Ploiarium) can be single- or many-flowered, depending on the growing conditions. Section Loxosepalum (clade G1; BP100/PP99) is characterized by uni- or bifoliate pseudobulbs, multi-flowered inflorescences and a glabrous perianth. Six of the 18 sections circumscribed by Schlechter (1924) were found to be paraphyletic in the combined molecular analysis. The transfer of several species to other sections is necessary to make these sections monophyletic as discussed below. All characters used by Schlechter (1924) to circumscribe sections Calamaria and Humblotiorchis (subclade C2) were found to be equivocal based on a morphological analyses (Fischer et al., in preparation). The species in these sections are small to large in size, the pseudobulbs are laterally flattened or roundish and can be crowded or moderately spaced, bear one or two leaves, the inflorescence is multi-flowered, and the lip is hairy or glabrous. It was not possible to identify any character (either molecular or morphological) to distinguish sect. Humblotiorchis from sect. Calamaria. We therefore propose to merge them, the latter name having prioroity. Section Elasmotopus (clade H1) is characterized by bifoliate pseudobulbs, multi-flowered inflorescences and a lip with a recurved apex forming a cup-like structure, characters that are also present in B. analamazaoatrae. Schlechter (1924) nevertheless removed this species from section Elasmotopus and placed it in the monotypic section Hymenosepalum because of its unifoliate pseudobulbs. Our analyses clearly show, however, that B. analamazaoatrae is nested within Elasmotopus and we therefore propose to merge section Hymenosepalum with Elasmotopus to make the latter monophyletic. No morphological traits could be found to characterize the paraphyletic section Micromonanthe which comprises five species of which Bulbophyllum muscicola, B. calyptropus and B. conchidioides were analysed phylogenetically, B. moldekeanum was analysed morphologically (Fischer et al., unpublished data) and B. johannis which lacks a type specimen and therefore remains as an unclear entity. Based on the very short type description (Wendland and Kränzlin, 1894) we propose to treat it as a synonym to Bulbophyllum muscicola which (clade F2) shows features, such as a thin rhizome, crowded pseudobulbs and very polymorphic flowers that Schlechter (1924) believed best fitting sect. Micromonanthe, originally described for taxa from Papua New Guinea. However, these characters are present in many Bulbophyllum species and therefore not useful for delimiting sections. Therefore we propose to disband section Micromonanthe in Madagascar and transfer B. muscicola and B. moldekeanum to section Trichopus (clade F2) to make the latter monophyletic. The other species traditionally assigned to section Micromonathe, B. calyptropus and

7 364 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Polyradices Alcistachys Kainochilus Bifalcula Calamaria Humblotiorchis Calamaria Elasmotopus, Hymenosepalum Pachychlamys Ploiarium Loxosepalum Lepiophylax, Micromonanthe Pachychlamys Lichenophylax Trichopus Pantoblepharon, Micromonanthe Polyradices Alcistachys Kainochilus Bifalcula Calamaria Humblotiorchis Calamaria Elasmotopus, Hymenosepalum Pachychlamys Ploiarium Loxosepalum Lepiophylax, Micromonanthe Pachychlamys Lichenophylax Trichopus Pantoblepharon, Micromonanthe A: pseudobulbs adaxially flattened laterally flattened otherwise equivocal B: number of leafs per pseudobulb two one equivocal C: type of inflorescence synanthous hysteranthous D: peduncle setaceous no yes equivocal E: inflorescence multiflowered singleflowered equivocal F: length of pedicel very short (flowers sit on the rhachis) moderate to long G: lip moveable yes no (lip is enclosed by lateral sepals) H: hairs on the lip present absent equivocal Fig. 3. Reconstruction of character state evolution of selected morphological key features mapped on the simplified combined (nrits and cpdna) phylogeny using a maximum parsimony assumption (ACCTRAN and DELTRAN optimization) with the Trace Character option in MacClade.

8 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) B. conchidiodes (clade G2), are phylogenetically nested in clade G2 together with Bulbophyllum sciaphile which belongs to sect. Lepiophylax which is characterized by the unique combination of flattened, bifoliate pseudobulbs and a multi-flowered inflorescence with predominantly white coloured flowers (Schlechter, 1924). B. calyptropus and B. conchidiodes fit morphologically in section Lepiophylax with exception of the unifoliate pseudobulbs. However, within clade G a reversal from one- to two-leafed pseudobulbs occurred several times and should not be regarded as a taxonomic feature to define sections (Fig. 3). As clade G2 received very strong statistical support (BP99/PP100), we propose to transfer B.conchidioides and B. calyptropus to section Lepiophylax which then should be characterized by uni- or bifoliate pseudobulbs. Sections Pantoblepharon and Trichopus (clade F2) are intermixed with one another in the combined molecular phylogeny. Species of both groups have adaxially flattened, unifoliate pseudobulbs (Fig. 3A and B), multi-flowered inflorescences and sepals and petals with hairy or papillose margins, with the exception of B. muscicola. The lip is ciliate in all species and the column-foot has an acute basal tooth. Schlechter (1924) originally defined section Pantoblepharon mainly by the hairy sepals, petals and lip and section Trichopus by the setaceous peduncle, unifoliate pseudobulbs and the shape of the stelidia. The latter trait was not scored in this study as it could not be divided into discrete states. However all the characters provided by Schlechter (1924) seem to fit both sections, keeping the small number of species belonging to these sections (14) in mind, we propose to merge them. Section Pachychlamys was found to be polyphyletic within clade E. Morphologically, section Pachychlamys is characterized by hysteranthous inflorescences and the presence of (remnants of) sheaths covering the rhizome and pseudobulbs. These features are clearly homoplasious (see Fig. 3C and F) and should therefore not be used to define sections. Based on the current phylogenetic position and on the morphological characters (shape of the lip, form of the tepals) it is clear that B. ikongoense should be excluded from section Pachychlamys therefore we propose to placed it in a section of its own. Additional molecular work is needed to asses whether the two recovered subclades in the combined molecular phylogeny of section Pachychlamys and B. liparidioides within clade H, will form a wellsupported clade when faster evolving markers are sequenced. Due to unresolved polytomies or weak statistical support in the combined molecular phylogeny, the status of several remaining sections and species could not yet be fully ascertained. Section Ploiarium (part of clade H) is morphologically well characterized by the (partly fused) lateral sepals, which form a boat-like structure, and immobile lip (Fig. 3G; Schlechter (1924)). In the combined molecular phylogeny, species assigned to this section, however, ended up in five separate subclades forming part of the basal polytomy. Future studies with faster evolving molecular markers will be needed to clarify the status of this section. Although members of sections Ploiarium and Pachychlamys share a very short pedicel (Fig. 3F), our study does not suggest that they are closely related. Bulbophyllum cardiobulbum (clade C), assigned to section Calamaria by Bosser (1965), appears in our combined tree as sister to sections Bifalcula, Calamaria and Humblotiorchis. Morphologically, this species is intermediate as it shows traits of sects. Alcistachys, Calamaria and Kainochilus such as an erect inflorescence, hairs on the lip and laterally flattened two-leafed pseudobulbs. In its current phylogenetic position it is a remnant of an ancestral lineage of clade C. This hypothesis is supported by the recent discovery of a new species which is sister to B. cardiobulbum (Fischer et al., unpublished data). Therefore we propose to put it in a section of its own, to make section Calamaria monophyletic. The monotypic section Polyradices (Fischer et al., 2007) comprises only B. petrae. This species is tiny, lacks spiral vessels and has densely clustered and bilaterally flattened unifoliate pseudobulbs (Fig. 3A and B). Its few-flowered inflorescence is sessile, and the sepals, petals and lip are glabrous (Fig. 3H) but the former are finely papillose on the margin and the latter is slightly papillose beneath. This unique combination of morphological characters is consistent with the isolated position as part of the basal polytomy in our combined molecular phylogeny Evolution of inflorescence development and resupination Resupinate orchid flowers were drawn by several authors as early as the 16th and 17th century (Arditti, 2002). Linnaeus (1780) first employed the term florum resupinatio for unfolding movements of flowers and Goebel (1924) subsequently attempted to classify the different ways in which resupination occurs in orchid flowers. Goebel acknowledged the fact that for many orchids, the movement and the positioning of the inflorescence are important for resupination and he recognized separate categories of erect, horizontal and pendulous inflorescences. The ten different ways of inflorescence development of Madagascan species of Bulbophyllum (Plate 1) will now be discussed according to these categories. The peduncle and lateral sepals have been indicated in dark and light grey, respectively, to clarify the position of the different organs during inflorescence development (Fig. 4). The evolution of the different types of inflorescence development is inferred by mapping them on the combined molecular phylogeny of Madagascan Bulbophyllum. In erect inflorescences, Goebel distinguished flowers which remain unaltered in their position from those whose position is altered during development. Erect inflorescences with non-resupinate flowers (Fig. 4: Type A) occur in Madagascan Bulbophyllum mainly in section Kainochilus, of which several species have inflorescences of this type. Species closely related to B. alexandrae sect. Kainochilus likewise have erect inflorescences and non-resupinate flowers

9 366 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Plate 1. Overview of different types of inflorescences in Bulbophyllum species from Madagascar. but with pedicels oriented in an angle up to 135 between the base and apex of the pedicel by apical drooping, reversing the lateral sepals (grey coloured in Fig. 4: Type B) from the most abaxial in the most adaxial position (Fig. 4: Type B), which also occur in B. cardiobulbum sect. Calamaria. When inflorescence development is mapped on the combined molecular phylogeny (Fig. 5), Type B inflorescences evolved from an ancestor bearing either erect inflorescences

10 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Types of inflorescence development Resupination A B C D1 D2 E1 E2 F G H Fig. 4. Schematic overview of inflorescence development in Bulbophyllum species of Madagascar. A description of the different types is given in Fig. 5.

11 368 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Kainochilus Polyradices Bifalcula Humblotiorchis Calamaria Alcistachys Lichenophylax Trichopus Pantoblepharon Micromonanthe Pachychlamys Hymenosepalum Elasmotopus Pachychlamys Ploiarium Types of inflorescence development (A) Erect inflorescence, flowers not resupinate (B) Erect inflorescence, apical drooping of the pedicel up to 135 degrees, flowers not resupinate (C) Erect inflorescence, torsion of the pedicel with/without apical drooping of the peduncle, all flowers resupinate (D1) Erect inflorescence, apical drooping of the peduncle up to 135 degrees, youngest flowers resupinate (D2) Erect inflorescence, apical drooping of the peduncle up to 135 degrees and drooping of the oldest flowers, all flowers resupinate (E1) Erect inflorescence, drooping of the peduncle up to 90 degrees, flowers not resupinate (E2) Erect inflorescence, drooping of the peduncle up to 180 degrees, all flowers resupinate (F) Erect inflorescence, apical drooping and torsion of the rhachis, all flowers resupinate (G) Pendulous inflorescence, all flowers resupinate (H) Erect inflorescence, apical drooping of the peduncle, flower resupinate Loxosepalum Micromonanthe Lepiophylax equivocal Fig. 5. Reconstruction of character state evolution of inflorescence development mapped on the combined (nrits and cpdna) phylogeny using a maximum parsimony assumption (ACCTRAN and DELTRAN optimization) with the Trace Character option in MacClade.

12 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) with non-resupinate flowers (Type A) or resupinate flowers with the peduncle apically drooping up to 180 as compared to its original upright position (Type E2). For the inflorescences in which the position is altered, Goebel made a distinction between species in which the apical part of the inflorescence droops and those in which torsion of the pedicel and ovary occurs. Zimmermann (1933) followed Goebel s basic types but distinguished more subclasses, which are discussed in respect to Madagascan Bulbophyllum. Erect inflorescences with resupinate flowers resulting from twisted pedicels and peduncles with or without apical drooping (Fig. 4: Type C) only have been observed in sections Pantoblepharon and Trichopus. Regardless whether the peduncle is erect or drooping, all flowers face the same direction, which provides additional support for the hypothesis that they are closely related. Erect inflorescences with resupinate flowers by apical drooping and torsion of the rachis (Fig. 4: Type F) mainly evolved in sections Elasmotopus and Pachychlamys and in some species of sections Calamaria and Ploiarium. Type F seems to have evolved from either Type E1 or E2 (Fig. 5). The apical drooping of the rachis is clearly an active growth mechanism as inflorescences stretched out with wire start to elongate until tension of the wire slackened after which they continue drooping again (Fischer, unpublished data). Erect inflorescences with a solitary, resupinate flower by apical drooping of the peduncle (Fig. 4: Type H) occurs in Madagascan Bulbophyllum only in section Lichenophylax but is very common in Asian Bulbophyllum. Type H is different from Type C by the fact that resupination of the single flowers occurs by apical drooping of the peduncle only whereas the multiple flowers of Type C become resupinate by torsion of the pedicel as well. Resupination of flowers on horizontal inflorescences were first described for African species of Bulbophyllum belonging to section Megaclinium by Goebel (1924). Zimmermann (1933) recognized two types of resupination in these species: in the first, the flowers remain unaltered in the same position whereas in the second, the ovary twists in such a way that the lip becomes the lowermost part of the perianth. Although our observations correspond to the basic principles described by Goebel (1924) and Zimmermann (1933), there seem to be many additional intermediate types of resupination in Madagascan species of Bulbophyllum that may also involve apical drooping of the inflorescence axis. Erect inflorescences with young, resupinate flowers by apical drooping of the inflorescence axis up to 135 (Fig. 4: Type D1) and erect inflorescences with resupinate flowers of all ages by apical drooping of the inflorescence axis up to 135 and drooping of the oldest flowers (Fig. 4: Type D2) evolved in sections Loxosepalum and Lepiophylax. Whether Type D2 is derived from Type D1 remains unclear, as the topology of the molecular phylogeny is not sufficiently resolved. Erect inflorescences with non-resupinate flowers and drooping of the peduncle up to 90 (Fig. 4: Type E1) predominantly evolved in section Ploiarium. The angle of drooping varies considerably between species, and some members of this section also have erect inflorescences with apical drooping and torsion of the rachis (Type F) or without resupinate flowers (Fig. 5: Type A). Erect inflorescences with resupinate flowers by drooping of the peduncle up to (Fig. 4: Type E2) is common in section Alcistachys and also evolved in section Calamaria. For pendulous inflorescences, Goebel (1924) stated that flowers are always resupinate and that resupination can occur in multiple ways. In the Madagascan species of Bulbophyllum, only a single type occurs without any torsion or drooping of the peduncle (Fig. 4: Type G), which is also common in members of Dendrobiinae, Gongorinae and Stanhopeinae (Goebel, 1924; Zimmermann, 1933). Type G evolved several times in Madagascan Bulbophyllum in each of these sections Calamaria, Ploiarium and Polyradices. Experiments were carried out on species exhibiting almost all types of inflorescence development to clarify whether movements of floral parts are an active physiological process or passive based on gravitational forces (Zimmermann, 1933; Ames, 1938; Arditti, 2002; Hill, 1939; Nyman et al., 1984, 1985; Ernst and Arditti, 1994; Went, 1926). Plants placed upside down in early bud stages always developed their inflorescences in such a way that the lip ultimately obtained the lowermost position in the flower, which suggests that resupination is influenced by gravity. Exclusion of light did not inhibit or eliminate resupination, but removal of auxin sources from the flower, such as gynostemia or ovaries did. Orchid flowers were generally found to be temporarily sensitive to resupination during specific (mostly early) stages of development only. This would explain why only a portion of the flowers of Type D1 end up resupinate: by the time the rachis stops drooping apically, the lowermost flowers are too old to respond to gravity. The direction of torsion of the pedicel and ovary of Madagascan Bulbophyllum can be clockwise or counterclockwise. For some species the direction of turning is random (Type D2), whereas others turn their buds in a single direction only (Type C). Regarding the functional significance of resupination, no empirical evidence has yet been collected, but it is assumed that resupination may facilitate pollination by providing landing platforms for pollinators, exposing labella to sunlight for optimal display of ultraviolet or colour patterns, raising the temperature of labella to volatilize scents, providing space for opening flowers, and/or protecting young flower buds (Arditti, 2002). A hitherto overlooked explanation could be that resupination also facilitates the positioning of pollinia on specific parts of the body of pollinators so that hybridization between sympatric or pollinator-sharing species is prevented. The different orientation of flowers may lead to pre-zygotic isolation promoting speciation, and is therefore of evolutionary significance. Studies analysing resupination in a phylogenetic context are scarce. Clark and Zimmer (2003) and Lavin et al. (2003) discovered flower resupination to be an important

13 370 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) synapomorphy for clades in molecular phylogenies of the genera Alloplectus (Gesneriaceae) and Poissonia (Fabaceae), respectively. The results of these studies indicate that resupination can be of systematic value. However, in Madagascan Bulbophyllum, despite the characterization of various clades by a unique resupination type, there are also multiple independent transitions from one type to the other, underscoring the fact that resupination can also be evolutionary fairly labile. With the molecular phylogenetic framework for Madagascan Bulbophyllum reconstructed here, more knowledge about the evolution of resupination in orchids was achieved. Resupination by apical drooping of the rachis seems to have evolved from apical drooping of the peduncle. Erect inflorescences with non-resupinate flowers have evolved several times into either erect inflorescences with (partly) non-resupinate flowers or pendulous inflorescences with resupinate flowers. The genetics of resupination in Madagascan Bulbophyllum is now being investigated by crossing species from sister groups with different resupination types for quantitative trait loci (QTL) analysis as done previously by Hodges et al. (2002) for species of Aquilegia differing in floral orientation. Interspecific crossing have already successfully been made for this purpose by Fischer et al. (unpublished data). Although nothing is known about the genetics underlying the various inflorescence types characterized in the present study, yet, it seems feasible that only a small number of genes is involved because of (i) the recurrent evolution of the same inflorescence type (Fig. 5: Types A, D, E, F, G); and (ii) the often simple genetic basis of flower orientation known from other plant groups (Hodges et al., 2002; Prazmo, 1965). The evolution of an ecological and evolutionary interesting process is finally better understood. Hopefully, unraveling the genetics of resupination will follow in the not too distant future. Acknowledgments We wish to express our thanks to Joseph Arditti and two anonymous reviewers for very useful feedback on earlier drafts of this manuscript, Jaap Vermeulen (National Herbarium of The Netherlands, Leiden University) for useful comments on the taxonomy and molecular systematics of Bulbophyllum, Mark Chase and the Kew DNA Bank for DNA aliquots, Hans Peter Comes for various discussions, Justin Moat for species distribution data, Johan Hermanns and Thierry Pailler for plant material and help in identifications, literature and herbarium research, Jean Noel Labat and Jean Bosser for help with herbarium material, Solo Rapanarivo for facilities and hospitality in PBZT (Parc Botanique et Zoologique de Tsimbazaza), DEF (Department des Eaux et Fôrets, Madagascar) for the collaboration and collecting permits, the National History Museum in Paris for type specimens and Maria Pichler for assistance in the lab. The staff of the Oakes Ames Orchid Library at Harvard University is thanked for assistance in obtaining rare literature. The present work was carried out in the context of Austrian Science Fund project FWF Bio to G.A.F. and M.K. and a Fulbright Junior Scholarship and Netherlands Organisation for Scientific Research Grant MV to B.G.

14 Appendix A List of taxa studied Section Species Geographic origin Herbarium/Voucher Genbank accession number nrits trnl F ndhj psba trnd Alcistachys Bulbophyllum occlusum Ridl. Madagascar, Toamasina Prov., road to Lakato WU/FS722 EF EF EF EF EF Alcistachys B. sulfureum Schltr. Madagascar, Fianarantsoa Prov., road to WU/FS1585 EF EF EF EF EF Alcistachys B. variegatum Thouars Madagascar, Fianarantsoa Prov., Farafangana WU/FS799 EF EF EF EF EF Bifalcula B. capuronii Bosser Madagascar, Fianarantsoa Prov., Farafangana WU/FS1010 EF EF EF EF Bifalcula B. minutum Thouars Madagascar, Mahajanga Prov., Ambanja WU/FS1207 EF EF EF EF EF Bifalcula B. implexum Jum. & H. Perrier Madagascar, Fianarantsoa Prov., Farafangana WU/FS1006 EF EF EF EF EF Bifalcula B. complanatum H. Perrier Madagascar, Mahajanga Prov., Ambanja WU/FS1298 EF Calamaria B. bicoloratum Schltr. Madagascar, Fianarantsoa Prov., Farafangana SZU/OR EF EF EF EF Calamaria B. cardiobulbum Bosser Madagascar, Antananarivo Prov., Anjozorobe WU/FS1315 EF EF EF EF EF Calamaria B. sambiranense Jum. & H. Perrier Madagascar, Antananarivo Prov., Tsinjoarivo WU/FS2229 EF EF EF EF EF Calamaria B. sambiranense Jum. & H. Perrier Madagascar, Toliara Prov., Analavelona WU/FS2124 EF EF EF EF EF Calamaria B. sambiranense Jum. & H. Perrier Madagascar, Fianarantsoa Prov., Andringitra WU/FS2019 EF EF EF EF EF Calamaria B. elliottii Rolfe Madagascar, Fianarantsoa Prov., Irondro WU/FS863 EF EF EF EF EF Calamaria B. hildebrandtii Rchb. f. Madagascar, Mahajanga Prov., Antsonihy WU/FS1133 EF EF EF EF Calamaria B. quadrifarium Rolfe Madagascar, Fianarantsoa Prov., between WU/FS826 EF EF EF EF EF Ifanadiana and Kianjavato Calamaria B. lecouflei Bosser Madagascar, Antsiranana Prov., Daraina WU/FS1278 EF EF EF EF EF Calamaria B. obtusatum (Jum. & H. Perrier) Madagascar, Mahajanga Prov., Mangindrano WU/FS1170 EF EF EF EF EF Schltr. Calamaria B. occultum Thouars Madagascar, Toamasina Prov., Lakato WU/FS617 EF EF EF EF EF Calamaria B. pervillei Rolfe ex Elliot Madagascar, Fianarantsoa Prov., Farafangana WU/FS818 EF EF EF EF EF Calamaria B. sambiranense Jum. & H. Perrier Madagascar, Tana flower market WU/FS1459 EF EF EF EF EF Calamaria nov. Madagascar, Antsiranana Prov., Daraina WU/FS1232 EF EF EF EF EF Calamaria B. trifarium Rolfe Madagascar, Mahajanga, Ambanja WU/FS1224 EF EF EF EF EF Calamaria B. sambiranense Jum. & H. Perrier Madagascar, Mahajanga, Mangindrano WU/FS1173 EF EF EF EF EF Cirrhopetalum B. longiflorum Thouars Madagascar, Toamasina Prov., Masoala K/Chase EF EF EF EF EF Cirrhopetalum B. longiflorum Thouars La Réunion WU/OR EF EF EF EF EF Elasmotopus B. aubrevillei Bosser Madagascar, Toamasina Prov., Maromizaha K/Hermans 5200 EF EF EF EF EF Elasmotopus B. aubrevillei Bosser Madagascar, Toamasina Prov., road to Lakato WU/FS620 EF EF EF Elasmotopus B. francoisii H. Perrier Madagascar, Toamasina Prov., Ambatovy WU/FS795 EF EF EF EF EF Elasmotopus B. francoisii H. Perrier Madagascar, Toamasina Prov., road to Lakato WU/FS691 EF EF EF EF EF Elasmotopus B. oxycalyx Schltr. Madagascar, Toamasina Prov., Ambatovy SZU/OR EF EF EF EF EF Elasmotopus B. oxycalyx Schltr. var. rubescens Madagascar, Antananarivo Prov., Tampoketsa K/Hermans 5490 EF EF EF EF EF (Schltr.) Bosser d Ankzobe Elasmotopus B. rauhii Toill.-Gen. & Bosser Madagascar, Antananarivo Prov., Anjozorobe WU/FS1326 EF EF EF EF EF Elasmotopus B. rauhii Toill.-Gen. & Bosser var. Madagascar, Toamasina Prov., Andasibe WU/FS1435 EF EF EF EF EF andranobeense Bosser Elasmotopus nov. Madagascar, Toamasina Prov., road to Lakato WU/FS688 EF EF EF EF EF Elasmotopus B. amphorimorphum H. Perrier Madagascar, Toamasina Prov., Maromizaha K/Hermans 5173 EF EF EF EF EF Humblotiorchis B. humblottii Rolfe Madagascar, Toamasina Prov., Ambatovy WU/FS1008 EF EF EF EF EF Hymenosepalum B. analamazoatrae Schltr. Madagascar, Toamasina Prov., Ambatovy WU/FS773 EF EF EF EF EF Hymenosepalum B. analamazoatrae Schltr. var. nov. Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Kainochilus B. alexandrae Schltr. Madagascar, Toamasina Prov., Ambatovy WU/FS779 EF EF EF EF EF (continued on next page) G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007)

15 Appendix A (continued) Section Species Geographic origin Herbarium/Voucher Genbank accession number nrits trnl F ndhj psba trnd Kainochilus B. anjozorobeense Bosser Madagascar, Tana flower market WU/FS1457 EF EF EF Kainochilus B. edentatum H. Perrier Madagascar, Fianarantsoa Prov., WU/FS866 EF EF EF EF EF Ambalamanaka Kainochilus B. horizontale Bosser Madagascar, Toamasina Prov., Ambatovy WU/AJL148 EF EF EF Kainochilus B. imerinense Schltr. Madagascar, Fianarantsoa Prov., road to WU/FS901 EF EF EF EF EF Lepiophylax B. sciaphile Bosser Madagascar, Toamasina Prov., Ambatovy WU/FS769 EF EF EF EF Lichenophylax B. hapalanthos Garay Madagascar, Toamasina Prov., road to Lakato WU/FS880 EF EF EF EF EF Lichenophylax nov. Madagascar, Toamasina Prov., road to Lakato WU/FS709 EF EF Lichenophylax nov. Madagascar, Fianarantsoa Prov., WU/FS1552 EF EF EF EF EF Ambinanindrano Loxosepalum B. aff. baronii Ridl. Madagascar, Antananarivo Prov., Mount Ibity WU/FS949 EF EF EF EF EF Loxosepalum B. aff. baronii Ridl. Madagascar, Fianarantsoa Prov., road to WU/FS869 EF EF EF EF EF Loxosepalum B. aff. baronii Ridl. Madagascar, Fianarantsoa Prov., road to WU/FS937 EF EF EF EF Loxosepalum B. aff. baronii Ridl. Madagascar WU/FS988 EF EF EF EF EF Loxosepalum B. aff. sphaerobulbum H. Perrier Madagascar, Toamasina Prov., road to Lakato WU/FS612 EF EF EF EF EF Loxosepalum B. aff. sphaerobulbum H. Perrier Madagascar, Toamasina Prov., Ambatovy WU/FS798 EF EF EF EF EF Loxosepalum B. alleizettei Schltr. Madagascar, Toamasina Prov., Ambatovy WU/FS746 EF EF EF EF EF Loxosepalum B. ambatoavense Bosser Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Loxosepalum B. amoenum Bosser Madagascar, Fianarantsoa Prov., road to WU/FS932 EF EF EF EF EF Loxosepalum B. approximatum Ridl. Madagascar, Toamasina Prov., road to Lakato WU/FS633 EF EF EF EF EF Loxosepalum B. leandrianum H. Perrier Madagascar, Toamasina Prov., road to Lakato WU/FS1028 EF EF EF EF EF Loxosepalum B. marovoense H. Perrier Madagascar, Toamasina Prov., Ambatovy SZU/OR EF EF EF EF EF Loxosepalum B. melleum H. Perrier Madagascar, Toamasina Prov., Col de K/Hermans 5483 EF EF EF EF EF Mantady Loxosepalum B. ochrochlamys Schltr. Madagascar, Fianarantsoa Prov., road to WU/FS871 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., Ambatovy WU/FS741 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov. WU/FS1651 EF EF EF EF EF Loxosepalum B. aff. baronii Ridl. Madagascar, Toamasina Prov., road to Lakato WU/FS683 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., Ambatovy WU/O EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., Ambatovy WU/FS745 EF EF EF EF EF Loxosepalum B. ventriosum H. Perrier Madagascar, Toamasina Prov., road to Lakato WU/FS640 EF EF EF EF EF Loxosepalum Madagascar, Fianarantsoa Prov., road to WU/FS874 EF EF EF EF EF Loxosepalum Madagascar, Fianarantsoa Prov., road to WU/FS933 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., road to Lakato WU/FS674 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., Ambatovy WU/FS787 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., road to Lakato WU/FS650 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., road to Lakato K/Hermans 5233 EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Loxosepalum Madagascar, Toamasina Prov. SZU/OR EF EF EF EF Loxosepalum B. nutans (Thouars) Thouars Mauritius WU/099B147-1 EF EF EF EF EF Loxosepalum B. nutans (Thouars) Thouars Mauritius WU/099B148-1 EF EF EF EF EF G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007)

16 Loxosepalum B. nutans (Thouars) Thouars Madagascar, Fianarantsoa Prov., road to WU/FS971 EF EF EF EF EF Loxosepalum B. nutans (Thouars) Thouars Madagascar, Fianarantsoa Prov., road to WU/FS970 EF EF EF EF EF Micromonanthe B. calyptropus Schltr. Madagascar, Antananarivo Prov., Tsinjoarivo WU/FS2202 EF EF EF EF EF Micromonanthe B. conchidioides Ridl. Madagascar, Toamasina Prov., road to Lakato WU/FS682 EF EF EF EF EF Micromonanthe B. muscicola Schltr. Madagascar, Toamasina Prov., Ambatovy WU/FS790 EF EF EF EF Pachychlamys B. ikongoense H. Perrier Madagascar, Fianarantsoa Prov., WU/FS1514 EF EF EF EF Ambinanindrano Pachychlamys B. liparidioides Schltr. Madagascar, Toamasina Prov., road to Lakato WU/FS706 EF EF EF EF EF Pachychlamys B. longivaginans H. Perrier Madagascar, Toamasina Prov., Andasibe WU/FS1402 EF EF EF EF EF Pachychlamys B. longivaginans H. Perrier Madagascar, Toamasina Prov., Ambavanasy WU/O EF EF EF EF EF Forest Pachychlamys B. molossus Rchb. f. Madagascar, Toamasina Prov., road to Lakato WU/FS622 EF EF EF EF EF Pachychlamys B. pachypus Schltr. Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Pachychlamys B. pachypus Schltr. Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Pachychlamys B. sandrangatense Bosser Madagascar, Toamasina Prov., road to Lakato WU/FS661 EF EF EF EF EF Pachychlamys B. vestitum Bosser var. meridionale Madagascar, Toamasina Prov., Andasibe K/Hermans 4943 EF EF EF EF EF Bosser Pachychlamys B. vestitum Bosser Madagascar, Toamasina Prov., road to Lakato WU/FS631 EF EF EF EF EF Pachychlamys Madagascar, Toamasina Prov., road to Lakato WU/FS669 EF EF EF EF EF Pantoblepharon B. pantoblepharon Schltr. Madagascar, Fianarantsoa Prov., road to WU/FS975 EF EF EF EF EF Pantoblepharon B. pleurothallopsis Schltr. Madagascar, Fianarantsoa Prov., SZU/OR EF EF EF EF EF Ambalamanaka Ploiarium B. aff. labatii Bosser Madagascar, Toamasina Prov., Ambatovy WU/FS737 EF EF EF EF Ploiarium B. aggregatum Bosser Madagascar, Fianarantsoa Prov., between WU/FS832 EF EF EF EF EF Ifanadiana and Kianjavato Ploiarium B. ankaizinense (Jum. & H. Perrier) Madagascar, Toamasina Prov., Ambatovy SZU/OR EF EF EF EF EF Schltr. Ploiarium B. auriflorum H. Perrier Madagascar, Toamasina Prov., Andasibe K/Hermans 4871 EF EF EF EF Ploiarium B. coriophorum Ridl. Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Ploiarium B. hamelinii W. Watson Madagascar, Toamasina Prov., road to Lakato SZU/OR EF EF EF EF EF Ploiarium B. henrici Schltr. var. rectangulare Madagascar, Toamasina Prov., road to Lakato WU/FS656 EF EF EF EF EF H. Perrier Ploiarium B. henrici Schltr. var. rectangulare Madagascar, Toamasina Prov., Ambatovy SZU/OR EF EF EF EF EF H. Perrier Ploiarium B. humbertii Schltr. Madagascar, Fianarantsoa Prov., south of K/Hermans 3466 EF EF EF EF EF Ambositra Ploiarium B. insolitum Bosser Madagascar, Toamasina Prov., road to Lakato WU/FS648 EF EF EF EF EF Ploiarium B. jackyi G. A. Fischer, et al. Madagascar, Fianarantsoa Prov., Farafangana WU/FS868 EF EF EF EF EF Ploiarium B. cyclanthum Schltr. Madagascar, Fianarantsoa Prov., road to K/Hermans 5571 EF EF EF EF Ploiarium B. nitens Jum. & H. Perrier Madagascar, Fianarantsoa Prov., road to WU/FS870 EF EF EF EF EF Ploiarium B. oreodorum Schltr. Madagascar, Fianarantsoa Prov., Andringitra WU/FS2011 EF EF EF EF EF Ploiarium B. peyrotii Bosser Madagascar, Toamasina Prov., Ambatovy SZU/OR EF EF EF EF EF Ploiarium B. platypodum H. Perrier Madagascar, Fianarantsoa Prov., road to K/Hermans 5046 EF EF EF EF EF Ploiarium B. rubiginosum Schltr. Madagascar, Fianarantsoa Prov., Farafangana WU/FS1035 EF EF EF EF EF Ploiarium nov. Madagascar, Toamasina Prov., road to Lakato WU/FS602 EF EF EF EF (continued on next page) G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007)

17 Appendix A (continued) Section Species Geographic origin Herbarium/Voucher Genbank accession number nrits trnl F ndhj psba trnd Ploiarium nov. Madagascar, Toamasina Prov., Ambavanasy WU/O EF EF EF EF EF Forest Ploiarium nov. Madagascar, Toamasina Prov., road to Lakato WU/FS1946 EF EF EF EF EF Ploiarium nov. Madagascar, Toamasina Prov., road to Lakato WU/FS1926 EF EF EF EF EF Ploiarium B. turkii Bosser & P. J. Cribb Madagascar, Fianarantsoa Prov., road to WU/FS1595 EF EF EF EF EF Ploiarium Madagascar, Fianarantsoa Prov., road to WU/FS958 EF EF EF EF Ploiarium Madagascar, Toamasina Prov., Ambatovy WU/O EF EF EF EF EF Ploiarium Madagascar, Fiananrantsoa, Ambalamanaka WU/FS1558 EF EF EF EF EF Ploiarium Madagascar, Toamasina Prov., Col de K/Hermans 4887 EF EF EF EF EF Mantady Ploiarium Madagascar, Fianarantsoa Prov., road to WU/FS1610 EF EF EF EF EF Ploiarium Madagascar, Fianarantsoa Prov., between WU/FS833 EF EF EF EF EF Ifanadiana and Kianjavato Ploiarium Madagascar, Fianarantsoa Prov., road to WU/FS960 EF EF EF EF EF Ploiarium Madagascar, Toamasina Prov., road to Lakato WU/FS624 EF Ploiarium Madagascar, Toamasina Prov., road to Lakato WU/FS711 EF EF EF EF EF Ploiarium Madagascar, Toamasina Prov., Didy WU/O EF EF EF EF EF Ploiarium Madagascar, Toamasina Prov., Ambatovy WU/FS1040 EF EF EF EF EF Ploiarium Madagascar, Fianarantsoa Prov., Col de Tapia WU/FS1480 EF EF EF EF EF Ploiarium Madagascar, Fianarantsoa Prov., road to WU/FS943 EF EF EF EF EF Ploiarium Madagascar, Toamasina Prov., Didy WU/FS907 EF EF EF EF EF Ploiarium Madagascar, Fianarantsoa Prov., Andasibe K/Hermans 3948 EF EF EF EF Polyradices B. petrae G. A. Fischer et al. Madagascar, Toamasina Prov., Ambatovy WU/FS2287 EF EF EF EF Trichopus B. ciliatilabrum H. Perrier Madagascar, Toamasina Prov., road to Lakato WU/FS604 EF EF EF EF EF Trichopus Madagascar, Fianarantsoa Prov., road to WU/FS1622 EF EF EF EF EF Sestochilus B. affine Lindl. Asia SZU/OR EF Sestochilus B. alsiosum Ames Philippines, Luzon SZU/OR EF Group 1 (Vermeulen, 1987) B. barbigerum Lindl. Africa L/SBGO 1692 EF Cirrhopetalum B. biflorum Teijsm. & Binn. Malaysia SZU/OR EF Bolbophyllaria B. bracteolatum Lindl. Venezuela WU/ 5/80 EF Cirrhopetalum B. burfordiense Hort. ex Garay et al. unknown M.W.K.Goh and AY J.Elliot 1002 Xiphizusa B. aff. chloropterum Rchb. f. Brasil, Bahia, Jussari HUEFS/E.C.Smidt EF Bolbophyllaria B. cribbianum Toscano Brasil, Bahia, Mucugê HUEFS/E.L.Borba EF Cirrhopetalum B. cumingii (Lindl.) Rchb. f. Philippines, Mindanao SZU/OR EF EF EF EF Sestochilus B. dearei (Hort.) Rchb.f. Philippines, Mindanao SZU/OR EF Sestochilus B. dearei (Hort.) Rchb.f. Philippines, Mindanao SZU/OR EF G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007)

18 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Sestochilus B. emiliorum Ames & Quisumb. Philippines SZU/OR EF Group 5 (Megaclinium) B. falcatum (Lindl.) Rchb. f. Cameroon WU/23/94 EF (Vermeulen, 1987) Didactyle B. glutinosum (Barb. Rodr.) Cogn. Brasil, Minas Gerais, Carrancas HUEFS/E.C.Smidt EF et al. s.n. Sestochilus B. hamatipes J. J. Sm. Indonesia, Java SZU/OR EF Group 1 (Vermeulen, 1987) B. intertextum Lindl. Grand Comore, Haboho, Forêt de Bahani P/P EF Sestochilus B. lobbii Lindl. Asia L/SBGO 740 EF Group 8 (Vermeulen, 1987) B. lupulinum Lindl. Africa SZU/OR EF Sestochilus B. macranthum Lindl. Philippines, Luzon SZU/OR EF Undetermined B. mayombeense Garay Congo, Mayombe WU/400/96 EF Sestochilus B. membranifolium Hook. f. Malaysia, Cameron Highlands SZU/OR EF Sestochilus B. orectopetalum Garay et al. Thailand SZU/OR EF Group 1 (Vermeulen, 1987) B. oxychilum Schltr. Africa L/s.n. EF EF Sestochilus B. patens King ex Hook. f. unknown SZU/OR EF Cirrhopetalum B. picturatum (Lodd.) Rchb.f. Philippines, Mindanao SZU/OR EF EF EF EF EF Sestochilus B. pileatum Lindl. unknown L/ EF EF Xiphizusa B. plumosum (Barb. Rodr.) Cogn. Brazil, Minas Gerais, Caldas HUEFS/E.C.Smidt et al. 315 Sestochilus B. siamense Rchb. f. Thailand SZU/OR EF Sestochilus B. smitinandii Seidenf. & Thorut Thailand WU/3601 EF Herbarium acronyms are given before the collection numbers. All numbers from Kew refer to Kew DNA Bank numbers. References Ames, O., Resupination as a diagnostic character in the Orchidaceae with special reference to Malaxis monophyllosbotanical Museum Leaflets, vol. 6. Springer, pp Arditti, J., Resupination. In: Nair, H., Arditti, J. (Eds.), Proceedings of the 17th World Orchid Conference. Natural History Publications (Borneo), Kota Kinabalu, Malaysia, pp Bartareau, T., Pollination of Bulbophyllum macphersonii Rupp by a midge fly (Forcipomyia sauteri). The Orchadian 11, Bateman, R.M., Hollingsworth, P.M., Preston, J., Yi-Bo, L., Pridgeon, A.M., Chase, M.W., Molecular phylogenetics and evolution of Orchidinae and selected Habenariinae (Orchidaceae). Bot. J. Linn. Soc. 142, Borba, E.L., Semir, J., Wind-assisted fly pollination in the three Bulbophyllum (Orchidaceae) species orruring in the Brazilian campos rupestris. Lindleyana 13, Bosser, J., Contribution à l étude des Orchidaceae de Madagascar V. Révision de quelques sections du genre Bulbophyllum à Madagascar. Adansonia n.s. 5, Bosser, J., Contribution à l étude des Orchidaceae de Madagascar. VII. Adansonia n.s. 9, Bosser, J., Contribution à l étude des Orchidaceae de Madagascar XVI. Espèces nouvelles du genre Bulbophyllum. Adansonia n.s. 11, Bosser, J., Contribution à l étude des Orchidaceae de Madagascar et des Mascareignes. XXIV. Bull. Mus. Nat. Hist. Nat., Paris, sect. B, Adansonia 11, Bosser, J., Contribution à l étude des Orchidaceae de Madagascar et des Mascareignes. XXIX. Revision de la section Kainochilus du genre Bulbophyllum. Adansonia sér 3 (22), Bosser, J., Contribution à l étude des Orchidaceae de Madagascar, des Comores et des Mascareignes XXXIII. Adansonia sér 3 (26), Cameron, K.M., Utility of plastid psab gene sequences for investigating intrafamilial relationships within Orchidaceae. Mol. Phylogen. Evol. 31, Carlsward, B.S., Whitten, W.M., Williams, N.H., Bytebier, B., Molecular phylogenetics of Vandeae (Orchidaceae) and the evolution of leaflessness. Am. J. Bot. 93, Clark, J.L., Zimmer, E.A., Preliminary phylogeny of Alloplectus (Gesneriaceae): implications for the evolution of flower resupination. Syst. Bot. 28, Demesure, B., Sodzi, N., Petit, R.J., A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, Dolphin, K., Belshaw, R., Orme, C.D.L., Quicke, D.L.J., Noise and incongruence: interpreting results of the incongruence length difference test. Mol. Phylogen. Evol. 17, Doyle, J.J., Doyle, J.L., A rapid DNA isolation procedure for small quantities of fresh leaf material. Phytochem. Bull. 19, Dressler, R.L., The Orchids Natural History and Classification. Harvard University Press, Cambridge, USA. Du Puy, D.J., Cribb, P.J., Bosser, J., Hermans J., Hermans C., The orchids of Madagascar. Royal Botanic Gardens, Kew. Ernst, R., Arditti, J., Resupination. In: Arditti, J. (Ed.), Orchid Biology: Reviews and Perspectives VI. John Wiley and Sons Inc., New York, pp Farris, J.S., Källersjö, M., Kluge, A., Bult, G.C., Constructing a significance test for incongruence. Syst. Biol. 44, Fischer, G.A., Sieder, A., Cribb, P.J., Kiehn, M., Description of two new species and one new section of Bulbophyllum (Orchidaceae) from Madagascar. Adansonia sér. 3, 29 (1), Fischer, G.A., Hermans, J., Sieder, A., Kiehn, M., Gravendeel, B., Cribb, P.J., in. preparation. Taxonomic revision of Bulbophyllum sections Bifalcula, Inversiflora and Lupulina (Orchidaceae) in Madagascar: a new sectional delimitation based on molecular and morphological evidence. Goebel, K., Die Entfaltungsbewegungen der Pflanzen und deren teleologische Deutung. Verlag von Gustav Fischer, Jena.

19 376 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) Gravendeel, B., Fischer, G.A., Smidt, E.C., Schuiteman, A., Sieder,A., Vogel, A., Vermeulen, J.J., in preparation. Molecular phylogeny of the Bulbophyllinae. Hedren, M., Fay, M.F., Chase, M.W., Amplified fragment length polymorphisms (AFLP) reveal details of polyploid evolution in Dactylorhiza (Orchidaceae). Am. J. Bot. 88, Hill, A.W., Resupination studies of flowers and leaves. Ann. Bot. 3, Hodges, S.A., Whittall, J.B., Fulton, J., Yang, J.Y., Genetics of floral traits influencing reproductive isolation between Aquilegia formosa and Aquilegia pubescens. Am. Nat. 159, S51 S60. Huelsenbeck, J.P., Ronquist, F., MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17, Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A., Janzen, D.H., Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. 102, Lavin, M., Wojciechowski, M.F., Gasson, P., Hughes, C., Wheeler, E., Phylogeny of robinioid legumes (Fabaceae) revisited: Coursetia and Gliricidia recircumscribed, and a biogeographical appraisal of the Caribbean endemics. Syst. Bot. 28, Linnaeus, C., Philosophia Botanica 2. D.Johannes Gottlieb Gleditsch, Berolini. Maddison, W.P., Maddison, D.R., MacClade. [4.08]. Sinauer, Sunderland, Massachusetts. Müller, K., 2003a. PRAP parsimony ratchet analysis using PAUP. Program distributed by the author. Nees Institute, University of Bonn Germany. Müller, K., 2003b. SEQSTATE primer design and sequence statistics for phylogenetic DNA data sets. Program distributed by the author. Nees Institute, University of Bonn Germany. Nishida, R., Tan, K.H., Wee, S.L., Hee, A.K.W., Toong, Y.C., Phenylpropanoids in the fragrance of the fruit fly orchid, Bulbophyllum cheiri, and their relationship to the pollinator, Bactrocera papayae. Biochem. Syst. Ecol. 32, Nyman, L.P., Soediono, N., Arditti, J., Opening and resupination in buds and flowers of Dendrobium (Orchidaceae) hybrids. Bot. Gaz. 145, Nyman, L.P., Soediono, N., Arditti, J., Resupination in flowers of two Dendrobium (Orchidaceae) hybrids. Effect of nodal position and removal of floral segments. Bot. Gaz. 146, Norup, M.V., Dransfield, J., Chase, M.W., Barfod, A.S., Fernando, E.S., Baker, W.J., Homoplasious character combinations and generic delimitation: a case study from the Indo-Pacific arecoid palms (Arecaceae: Areceae). Am. J. Bot. 93, Perrier de la Bâthie, H e Famille. Orchidées I & II. In: Humbert, H. (Ed.), Flore de Madagascar. Tananarive, Imprimerie Officielle, Madagascar. Posada, D., Crandall, K.A., Modeltest: testing the model of DNA substitution. Bioinformatics 14, Posada, D., Crandall, K.A., Selecting the best-fit model of nucleotide substitution. Syst. Biol. 50, Prazmo, W., Cytogenetic studies on the genus Aquilegia. IV. Fertility relationships among the Aquilegia species. Acta Soc. Bot. Pol. 34, Pridgeon, A.M., Chase, M.W., A phylogenetic reclassification of Pleurothallidinae (Orchidaceae). Lindleyana 16, Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), Genera Orchidacearum, vol. 1. Oxford University Press, Oxford. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), 2001a. Genera Orchidacearum. Orchidoideae (Part 1), vol. 2. Oxford University Press, Oxford. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), Genera Orchidacearum. Orchidoideae (Part 2), Vanilloideae, vol. 3. Oxford University Press, Oxford. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), Genera Orchidacearum. Epidendroideae (Part 1), vol. 4. Oxford University Press, Oxford. Pridgeon, A.M., Solano, R., Chase, M.W., 2001b. Phylogenetic relationships in Pleurothallidinae (Orchidaceae): combined evidence from nuclear and plastid DNA sequences. Am. J. Bot. 88, Reeves, G., Chase, M.W., Goldblatt, P., Rudall, P., Fay, M.W., Cox, A.V., Lejeune, B., Souza-Chies, T., Molecular systematics of Iridaceae: evidence from four plastid DNA regions. Am. J. Bot. 88, Sang, T., Crawford, D.J., Stuessy, T.F., Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 84, Schlechter, R., Orchidaceae Perrieranae. Ein Beitrag zur Orchideenkunde der Insel Madagaskar. Repertorium Specierum Novarum Regni Vegetabilis 33, Sheahan, M.C., Chase, M.W., Phylogenetic relationships within Zygophyllaceae based on DNA sequences of three plastid regions, with special emphasis on Zygophylloideae. Syst. Bot. 25, Sieder, A., Rainer, H., Kiehn, M., CITES checklist for Bulbophyllum and allied taxa (Orchidaceae). 319p. Botanical Garden of the University of Vienna. Available from: < common/com/nc/tax_ref/bulbophyllum.pdf>. Simmons, M.P., Ochoterena, H., Gaps as characters in sequencebased phylogenetic analyses. Syst. Biol. 49, Smidt, E. C., Borba, E. L., vandenberg, C., Gravendeel, B., Fischer, G.A., in preparation. Molecular phylogeny of Neotropical Bulbophyllum species. Sun, Y.D.Z., Skinner, G.H., Liang, S., Hulbert, H., Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89, Swofford, D.L., PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachussets, USA. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, Tan, K.H., Nishida, R., Toong, Y.C., Floral synomone of a wild orchid, Bulbophyllum cheiri, lures Bactrocera fruit flies for pollination. J. Chem. Ecol. 28, Tate, J.A., Simpson, B.B., Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 28, Teixeira, S.P., Borba, E.L., Semir, J., Lip anatomy and its implications for the pollination mechanisms of Bulbophyllum species (Orchidaceae). Ann. Bot. 93, Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmouguin, F., Higgins, D.G., The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, Van den Berg, C., Goldman, D.H., Freudenstein, J.V., Pridgeon, A.M., Cameron, K.M., Chase, M.W., An overview of the phylogenetic relationships within Epidendroideae inferred from multiple DNA regions and recircumscription of Epidendreae and Arethuseae (Orchidaceae). Am. J. Bot. 92, Vermeulen, J.J., Orchid Monographs 2, a Taxonomic Revision of the Continental African Bulbophyllinae. E.J. Brill, Netherlands, Leiden. Vijverberg, K., Bachmann, K., Molecular evolution of a tandemly repeated trnf(gaa) gene in the chloroplast genomes of Microseris (Asteraceae) and the use of structural mutations in phylogenetic analyses. Mol. Biol. Evol. 16, Wendland, H., Kränzlin, F., Bulbophyllum johannis Wendl. & Kraenzl. Gard. Chron. ii, 592. Went, F.W., On growth-accelerating substances in the coleoptile of Avena sativa. Proc. Kon. Acad. Wettensch. 30, White, T.J., Bruns, T., Lee, S., Taylor, J., Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal RNA genes. In: Innis, M., Gelfand, D., Sninsky, J., White, T. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp Wiens, J.J., Combining data sets with different phylogenetic histories. Syst. Biol. 47, Yoder, A.D., Irwin, J.A., Payseur, B.A., Failure ofthe ILD todetermine data combinability for slow loris phylogeny. Syst. Biol. 50, Zimmermann, W., Beiträge zur Kenntnis der Georeaktionen IV. Blütenbewegungen und andere Umstimmungsbewegungen. Jahrb. f. wiss. Botanik 77.