Bio 6 Polymerase Chain Reaction (PCR) Lab

Transcription

1 Bio 6 Polymerase Chain Reaction (PCR) Lab Objectives In this laboratory you will plan and carry out the Polymerase Chain Reaction (PCR) technique to amplify a specific DNA sequence within a larger DNA molecule. You will then analyze the resulting PCR products by agarose gel electrophoresis. Introduction The Polymerase Chain Reaction (PCR) technique is essentially DNA replication in vitro targeted to a very specific region of a DNA sample. As a result, the DNA in the target region is amplified exponentially due to repeated rounds of DNA replication. For example, consider that the human genome consists of ~3 billion base pairs of DNA. PCR makes it possible to take a sample of human DNA and selectively amplify any desired portion of it provided it is no larger than several thousand base pairs. The remaining DNA is more or less ignored by the replication machinery. The importance of PCR cannot be overstated. It has completely reutionized biological research, forensics, diagnostic testing, and any other field that inves DNA analysis. So how does PCR accomplish the selective amplification of a relatively small portion a complex DNA sample? To answer this question you need to understand how DNA replication works. Recall that DNA replication in bacteria requires the following components: DNA template* deoxyribonucleotide triphosphates (dntps)* origin of replication helicase DNA gyrase (topoisomerase) RNA primase DNA polymerase III* DNA polymerase I DNA ligase * all that is required for PCR All of these components and more are required for a bacterial cell to completely copy a very large piece of DNA, the bacterial chromosome which in E. coli is ~4 million base pairs. The replication of a relatively small region of DNA in vitro via PCR, however, requires only three of these components: template DNA, dntps and a DNA polymerase. An origin of replication and RNA primase are not necessary since a sequence-specific pair of DNA primers produced synthetically are added to the reaction. The sequence specificity of the primers is what limits DNA replication to the desired region of DNA and nowhere else. Helicase and topoisomerase are not needed to unwind and release tension in DNA, their jobs are not necessary due to a combination of high temperature and the short length of the DNA being amplified. The equivalent of DNA polymerase I and DNA ligase are also unnecessary due to the absence of RNA primers and Okazaki fragments during the process of PCR.

2 Since PCR requires very high temperatures as you will see, a typical DNA polymerase cannot be used since it will be denatured by the intense heat. A DNA polymerase that can function at very high temperatures is essential, and lucky for us, there are organisms that have just such a polymerase: hyperthermophilic bacteria. One such bacterial species is Thermus aquaticus, discovered around 1970 in the hot springs of Yellowstone National Park. Thermus aquaticus thrives at 70 o C and can survive temperatures as high as 80 o C. This means that its version of DNA polymerase III, an enzyme called Taq polymerase, can remain functional up to at least 80 o C. As it turns out, Taq polymerase retains its enzyme activity even after almost one hour at 95 o C! Thus Taq polymerase would prove ideal for the PCR technique. DNA polymerases from other hyperthermophilic microbes have since been discovered and are used in PCR, however Taq polymerase is still used routinely and is the enzyme you will use in your PCR reactions. In addition to the components already identified, DNA replication in a PCR reaction also requires specific ph conditions and concentrations of chloride, potassium and magnesium ions. These components are contained in a 10X buffer supplied by the manufacturer of the Taq polymerase. The components you will need to assemble a PCR reaction are listed below: DNA template dntps Primer 1 Primer 2 10X buffer H 2O Taq polymerase Once assembled, a PCR reaction must then be placed in a device called an automated thermocycler (aka PCR machine ). An automated thermocycler is a machine that is programmed to cycle through various temperatures for specific periods of time to allow the PCR amplification of DNA to occur. Let s look at a typical PCR program below and then consider the purpose for each step: 95 o C 95 o C 60 o C x o C 68 o C The initial 5 minute treatment at 95 o C will completely denature the DNA template, i.e., separate complementary DNA strands from each other. What follows is 30 cycles of: 30 seconds at 95 o C to denature DNA, 30 seconds at 60 o C to allow the primers to hybridize (i.e., form base pairs) with complementary sequences in the DNA template, and 1 minute at 68 o C to allow Taq polymerase to carry out DNA replication at its optimal temperature. DNA replication will occur because the synthetic DNA primers base-pair to complementary sequences in the DNA template. This provides 3 ends for the Taq polymerase to add to and thus synthesize a new complementary strand of DNA. Each time this cycle is repeated, copies of the desired DNA sequence increase by a factor of two. The final 5 minutes at 68 o C allows any unfinished DNA strands to be synthesized to completion. After the program is complete (about 2 hours), the desired DNA sequence will have been amplified by a factor of 2 30, or over 1 billion times! To help visualize what is happening in during repeated cycles of PCR, let s look at the diagram below: 2

3 As this illustration shows, it is only the region of DNA between the two primers that gets amplified. The key to targeting PCR amplification to your desired DNA sequence is to design a pair of primers that flank the region you want to amplify and direct DNA replication in converging directions. As long as you know the DNA sequence where you want primers to hybridize, you can simply submit an order to a biotech company for complementary primers and they will synthesize them for you for a relatively inexpensive fee (less than $20 a piece!). 3

4 Part 1: PCR AMPLIFICATION OF A DNA SAMPLE Planning your PCR reactions Just like the restriction enzyme digests you did previously, it is essential that you plan your PCR reactions on paper and pool together all common ingredients before you begin to actually put the reactions together. If you do not do this, you will be prone to making mistakes and wasting expensive materials. Since there are quite a few components that go into a PCR reaction, it is useful to construct a table such as the one below to account for all components in each reaction. Once the table is completed, it is easy to identify and add up the common ingredients to include in your pool: DNA tube # template 1 plasmid 1 l DNA 2 1 l 3 1 l 10-2 forward reverse 10X 10 mm Taq total ng primer conc primer conc buffer dntps units H2O 1 l 1 l 5 l 1 l 0.4 l 40.6 l 50 l 1 primer 1 10 M primer 2 10 M l l 6 none l This table illustrates the plan for 6 PCR reactions that vary only in the amount of template DNA, much like the PCR reactions you will carry out. Tube #6 will serve as a negative control. This is very important to confirm that no contaminating DNA ended up in your reactions. Notice that, despite differences in the amount of template DNA in each reaction, the total ume of template DNA added to all but the control is still 1 l. This is easily accomplished by creating a 10-fold dilution series (serial dilution) of the template DNA, something you will also do. All other components are the same for each reaction and thus can be included in your pool (for the control reaction, the extra 1 l of water can be added later). Keep in mind that the final concentrations of the primers and dntps are very important. This is why both the concentrations and umes of these components are indicated. Do the math and you will see that the final concentration of each primer is 0.2 M, and the final concentration of dntps is 0.2 mm. If the final concentrations of these components are significantly off, your PCR reactions will not work. Now that we have identified all the common components in this set of reactions, let s plan a pool for 6 reactions plus one extra: ultrapure H 2O 10X buffer primer 1 primer 2 dntps Taq pol. TOTAL l 35 l 7 l 7 l 7 l 2.8 l 343 l (divided by 7 = 49 l ea) 4

5 As you can see, the amounts of each component in the pool have been verified since it will result in 49 l of the pool per PCR reaction 50 l minus the 1 l of template DNA (or water) which will be added separately. Before you move on and prepare your own PCR reactions, let s take a look at how you will prepare a serial dilution of the template DNA. Stock DNA solutions are typically 1 g/ l, so let s assume this is what you start with. What is needed for the PCR reactions are samples of the plasmid DNA at 1ng/ l, 0.1 ng/ l and so forth down to 10-4 ng/ l. This can be accomplished by diluting some of the stock DNA sample by a factor of 1000 and then carrying out a 10-fold serial dilution from there as shown below: 1 l 100 l 100 l 100 l 100 l 1 g/ l stock 1/1000 1/10 1/10 1/10 1/10 (final concentration) 999 l H 2 O 900 l H 2 O 900 l H 2 O 900 l H 2 O 900 l H 2 O 1 ng/ l 0.1 ng/ l 10-2 ng/ l 10-3 ng/ l 10-4 ng/ l By adding the appropriate amount of diluent (what you are diluting with, ultrapure water in this case) to each tube first, the dilution series can be accomplished very quickly and easily. When setting up serial dilutions, keep in mind that the dilution factor is the ume added/total ume. This is why a 10-fold dilution for example requires 1 part sample and 9 parts diluent (i.e., 1 divided by = 1/10). Once the appropriate amount of diluent has been added to each tube, you simply measure 1 l from the original stock DNA solution, transfer it to a tube with 999 l of water and mix to create a 1/1000 dilution (1 ng/ l). The next step would be to transfer 100 l of this dilution to a tube with 900 l of water and mix to dilute the sample 10-fold more (0.1 ng/ l), and so on down the line. If you measure accurately and mix thoroughly before each transfer (e.g., by vortexing), you will end up with a very accurate dilution series derived from a single l of original stock DNA solution. You are now ready to plan your PCR reactions and prepare a serial dilution of your template DNA 5

6 Exercise 1A Planning a set of PCR reactions For the remainder of this lab you will work in groups of 3 or 4, though all planning on paper should be recorded individually and included in your notebook: 1. Use the table at the end of this lab to plan a set of 5 PCR reactions based on the following: each reaction should have one of the following amounts of plasmid DNA as template: 1 ng, 10-3 ng (1 picogram), 10-6 ng (1 femtogram), 10-9 ng (1 attogram), no template DNA (negative control) M13 forward and M13 reverse primers are at a stock concentration of 10 M and should be used at a final concentration of 0.2 M each reaction should contain 0.2 mm dntps (from 10 mm stock) and 2 units of Taq polymerase in a total of 25 l 2. Plan a pool of all components that will be common to each reaction, making sure you will have enough for one extra reaction. 3. Gather all necessary components for your PCR reactions and place them on ice. 4. Prepare your template DNA by serial dilution as described on the previous page. Running your PCR reactions Now that you have your plan in order, all you need to do is assemble your PCR reactions and run them in the automated thermocycler at your table. Before you can run your reactions, though, you need to know what parameters to use (i.e., temperatures, times, number of cycles, etc) which are indicated below. Exercise 1B Assembling and running PCR reactions 1. Use your plan from the previous exercise to put together your pool and assemble your PCR reactions into labeled PCR tubes. 2. Place your tubes in the thermocycler at your table and close the lid. Program the thermocycler with the following parameters with the aid of your instructor: 95 o C 95 o C 50 o C x o C 68 o C 4 o C 3. Start the thermocycler and allow the program to run overnight. 6

7 Part 2: ANALYSIS OF PCR PRODUCTS The standard way to analyze PCR products is by agarose gel electrophoresis which is no different than what you have done in previous laboratories. Exercise 2 Agarose gel electrophoresis of PCR reactions 1. Prepare and pour 60 ml of a 1% agarose gel in 1X TAE as described in previous labs. 2. Add 1/10 ume of gel loading dye to each of your PCR reactions, mix and quick spin. 3. Load each PCR reaction on your gel along with 10 l of 1 kb ladder. 4. Run the gel at ts for ~1 ½ hours. 5. Stain the gel with an InstaStain Ethidium Bromide card as described in previous labs. 6. Photographic your gel and place a copy in your notebook. 7. Determine the length of each PCR product and compare the amount of PCR product in each reaction. You should also identify what concentrations of DNA template, if any, resulted in no observable PCR product. NOTE: For this laboratory you will turn in a formal lab report. 7

8 8

9 tube # 1 DNA template ng forward primer conc reverse primer conc 10X buffer 10 mm dntps Taq units H2O total

10 10

11 PCR Lab Study Questions 1. You plan to test PCR amplification using 1 ng (10-9 g), 0.01 ng (10-11 g), 0.1 picograms (10-13 g) and 1 femtogram (10-15 g) of template DNA. Diagram how you would create a serial dilution of the DNA template to produce these amounts assuming the stock DNA concentration is 1 g/ l. 2. Indicate your plan for a set of PCR reactions in which you will amplify 1 ng of human DNA template obtained from 3 different suspects in a crime and a sample from the crime scene. Assume each DNA sample is at a stock concentration of 1 ng/ l, each primer is 10 M, the Taq polymerase is 5 units/ l and you want to use 2 units of enzyme in a total ume of 50 l per reaction. tube # 1 DNA template ng forward primer conc reverse primer conc 10X buffer 10 mm dntps Taq units H2O total Indicate your pool below: 11

12 3. Explain what happens in a PCR reaction at 95 o C, 55 o C and 68 o C, and why the process is repeated 30 times. 4. PCR amplification of human DNA samples (such as those collected at a crime scene) is vulnerable to contamination. Considering how PCR works, what sort of contamination is the main concern and why would this be a problem? 5. You want to PCR amplify the highlighted region in the DNA sequence shown below. Design a pair of primers that are each 15 nucleotides long which will target PCR amplification to the desired sequence. Be sure to indicate the 5 and 3 ends of each primer sequence. 5 GCTCGATTCGAAGTCTCGATTCGAATCGGGTTGAACCCTCGTGGGTAGCGACACATGCGACTTCGACTAC 3 3 CGAGCTAAGCTTCAGAGCTAAGCTTAGCCCAACTTGGGAGCACCCATCGCTGTGTACGCTGAAGCTGATG 5 6. One of your PCR reactions contained 1 femtogram (10-15 g) of plasmid DNA template. Given the plasmid is 3342 bp and the average molecular weight of a base pair is 660 g/mol, calculate how many molecules of plasmid DNA were in that PCR reaction. How many molecules of plasmid are in 1 attogram? (NOTE: 1 mole = 6.02 x ) 12