Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician
|
|
- Cathleen Roberts
- 7 years ago
- Views:
Transcription
1 Next generation sequencing (NGS) Bioinformatics Challenges and strategies Urmi Trivedi Lead Bioinformatician
2 Major Bottlenecks Data volume Data complexity Data noise Overview Solutions Data formats Levels of NGS Bioinformatics Analytical strategies 2
3 Imbalance in genome informatics ecosystem Stein Genome Biology :207 doi: /gb
4 Hierarchy of NGS Data Volume Individual features 1MB Variation Data 4-5 GB Alignment Data 600GB Sequence plus Quality Data 1TB Intensities and Raw Data 5 TB Typical output from a single flowcell of a hiseq run 5
5 Hierarchy of NGS Data Volume Scalable storage Maintenance Clear as you go Individual features 1MB Backup Network Variation Data 4-5 GB Streamed replication of the original data, with copies being stored at multiple location Alignment Data 600GB Deposit data in public data repositories like ENA (European Nucleotide Archive) High Speed Network Sequence plus Quality Data 1TB Intensities and Raw Data 5 TB High performance computing such as Cluster computing or cloud computing Typical output from a single flowcell of a hiseq run Analysis Paralysis 5
6 Large amount of intermediate files Bears no discernable relationship to experiments >5000 intermediate files after image processing 6
7 Multiplexing adds up to it LIMS (Laboratory Information Management System) Automatic pipelines for running Tracking Samples programs Running downstream analysis A flowcell with only 3 bacrodes in 2 lanes produces ~14000 files 7
8 Data Noise Base-pair quality score Adapter contamination Quality Control Uneven Amplification 8
9 Data Formats SFF A binary file containing information about flowgrams, sequences, qualities FASTQ Contains sequence by cycle and respective quality 9
10 Data Formats FASTA Fasta header and the sequence >HWI-EAS222_2093MAAXX GAAATATTAAGTCTTTCAAA QUAL Fasta header and phred scores >HWI-EAS222_2093MAAXX FASTQ Sequence and ASCII coded phred GATTTCTTTGTCATTATTTA + IIIIIIIIIIIIIIIIIIIIIIIIIIIII 10
11 Levels of NGS Bioinformatics Production Bionformatics Advanced Bioinformactics Produce raw sequence reads and QC Map to genome and generate raw genomic features (e.g. SNPs), Assemble a genome de novo with existing tools, Bioinformatics Research Analyze the data; Uncover the biological meaning 11
12 Production Bioinformatics Vendor s pipeline Generation of fastq or similar files QC scripts L I M S >>Per sequence quality scores pass #Quality Count FAIL PASS Offsite backup Further investigation Advanced Bioinformatics 12
13 Advanced Bioinformatics Existing Reference Sequence No Reference Sequence Short Read Alignment De novo Assembly Variant Calling Gene Expression sirna/microrna Analysis De novo Transcriptome Assembly Metagenomics Population Genomics 13
14 Advanced Bioinformatics Software/Tools Open source tools Free for use Mostly Linux based Runs on command line Complicated Installation at times Commercial software Tools for biologists Pretty interface and ease of use CLCBio, Geneious, DNAStar, Partek 14
15 Short Read Alignment: Challenges Speed Using tools like BLAST/BLAT would require 100 CPU hours Memory Read Errors Repetitive regions Sequencer Differences 15
16 ELAND MAQ BWA BOWTIE TOPHAT GSNAP SOAP-2 Novoalign Short Read Alignment: Software 16
17 Variant calling Reads Align Reference Genome SNP 17
18 Variant Calling Misalignment due to Indels 18
19 Variant Calling Indel Realignment GATK MSA 19
20 Variant Calling -Workflow Raw data Alignment (SAM/BAM format) Realignment to correct errors GATK ELAND, MAQ, BWA, BOWTIE, SSAHA2, SOAP-2 PICARD, SAMTOOLS Mark duplicates Validation, Visualization and Bioinformatics Research Annotations SAMTOOLS, GATK, VarScan SNPs/indel calling IGV, Savant, Tablet 20
21 S1 Gene Expression Analysis Reads (cdna fragments) S2 Align Aligned read counts as a measure of gene expression 21
22 Gene Expression Analysis -Workflow Raw data Alignment (SAM/BAM format) Mark duplicates? TOPHAT, GSNAP, STAMPY, BWA, BOWTIE PICARD, SAMTOOLS Validation & Bioinformatics Research Normalization and Differential Gene Expression Raw Counts EdgeR, DeSEQ 22
23 Velvet ABYSS ALLPATHS-2 SOAPDenovo SGA EDENA CLCbio Newbler De novo Genome Assembly Software 23
24 De novo Genome Assembly Workflow Short reads (Typically 100bp paired end) Filter Poor quality data, sequence adapters, etc Assemble and generate contigs QC Long reads (e.g. 454, Sanger) Mate pairs (3-10KB insert) Generate Scaffolds QC Data Visualization (GMOD, Gbrowse,Tablet) Annotation (Gene Prediction, etc.) (MAKER, Augustus) 24
25 Summary Nextgen Sequencing is still very rapidly moving field Plan for change Keeping our infrastructure flexible Keep disk space expandable Keep software agile NEVER proceed with the analysis without data QC Choose the right tool for the right job 25
26 Acknowledgements Professor Mark Blaxter Dr. Karim Gharbi Dr. Stephen Bridgett Timothée Cézard Gaganjot Kaur Stuart Taylor The Darwin Trust of Edinburgh 26
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
More informationData Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
More informationNext generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationTutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
More informationNext Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows
Genes 2012, 3, 545-575; doi:10.3390/genes3030545 Article OPEN ACCESS genes ISSN 2073-4425 www.mdpi.com/journal/genes Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline
More informationChallenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing
More informationAn example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
More informationBuilding Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT
Building Bioinformatics Capacity in Africa Nicky Mulder CBIO Group, UCT Outline What is bioinformatics? Why do we need IT infrastructure? What e-infrastructure does it require? How we are developing this
More informationDeep Sequencing Data Analysis
Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist
More informationRNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012
RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided
More informationBasic processing of next-generation sequencing (NGS) data
Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance
More information8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationPractical Solutions for Big Data Analytics
Practical Solutions for Big Data Analytics Ravi Madduri Computation Institute (madduri@anl.gov) Paul Dave (pdave@uchicago.edu) Dinanath Sulakhe (sulakhe@uchicago.edu) Alex Rodriguez (arodri7@uchicago.edu)
More informationSRA File Formats Guide
SRA File Formats Guide Version 1.1 10 Mar 2010 National Center for Biotechnology Information National Library of Medicine EMBL European Bioinformatics Institute DNA Databank of Japan 1 Contents SRA File
More informationEoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille
Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) stephane.le_crom@upmc.fr Paris November 2013 The Sanger DNA sequencing method Sequencing
More informationUsing Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationCHALLENGES IN NEXT-GENERATION SEQUENCING
CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture
More informationPractical Guideline for Whole Genome Sequencing
Practical Guideline for Whole Genome Sequencing Disclosure Kwangsik Nho Assistant Professor Center for Neuroimaging Department of Radiology and Imaging Sciences Center for Computational Biology and Bioinformatics
More informationDelivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
More informationComparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
More informationData Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
More informationBioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
More informationNECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
More informationNew solutions for Big Data Analysis and Visualization
New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology
More informationLarge-scale Research Data Management and Analysis Using Globus Services. Ravi Madduri Argonne National Lab University of Chicago @madduri
Large-scale Research Data Management and Analysis Using Globus Services Ravi Madduri Argonne National Lab University of Chicago @madduri Outline Who we are Challenges in Big Data Management and Analysis
More informationGo where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
More informationData formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
More informationMiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
More information-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
More informationLifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationDatabases and mapping BWA. Samtools
Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:
More informationVersion 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationUCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production
Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department
More informationGenomic Testing: Actionability, Validation, and Standard of Lab Reports
Genomic Testing: Actionability, Validation, and Standard of Lab Reports emerge: Laura Rasmussen-Torvik Reaction: Heidi Rehm Summary: Dick Weinshilboum Panel: Murray Brilliant, David Carey, John Carpten,
More informationAbout the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster
Cluster Info Sheet About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster Welcome to the PMCBRC cluster! We are happy to provide and manage this compute cluster as a resource
More informationRemoving Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
More informationAnalysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
More informationIssues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing
Issues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing Matthew Trunnell Manager, Research Computing Broad Institute Overview The Broad Institute Major challenges Current data workflow
More informationUGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
More informationGenomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing
More informationHigh Throughput Sequencing Data Analysis using Cloud Computing
High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom (stephane.le_crom@upmc.fr) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationDe Novo Assembly Using Illumina Reads
De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the
More informationBioHPC Web Computing Resources at CBSU
BioHPC Web Computing Resources at CBSU 3CPG workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/biohpc_web_tutorial.pdf BioHPC infrastructure at CBSU BioHPC Web
More informationCopy Number Variation: available tools
Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available
More informationTowards Integrating the Detection of Genetic Variants into an In-Memory Database
Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base
More informationScalable Cloud Computing Solutions for Next Generation Sequencing Data
Scalable Cloud Computing Solutions for Next Generation Sequencing Data Matti Niemenmaa 1, Aleksi Kallio 2, André Schumacher 1, Petri Klemelä 2, Eija Korpelainen 2, and Keijo Heljanko 1 1 Department of
More informationGenotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
More informationLeading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik
Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated
More informationCloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
More informationStorage Solutions for Bioinformatics
Storage Solutions for Bioinformatics Li Yan Director of FlexLab, Bioinformatics core technology laboratory liyan3@genomics.cn http://www.genomics.cn/flexlab/index.html Science and Technology Division,
More information454 Sequencing System Software Manual Version 2.6
454 Sequencing System Software Manual Version 2.6 Part C: May 2011 Instrument / Kit GS Junior / Junior GS FL+ / L+ GS FL+ / LR70 GS FL / LR70 For life science research only. Not for use in diagnostic procedures.
More informationCloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
More informationText file One header line meta information lines One line : variant/position
Software Calling: GATK SAMTOOLS mpileup Varscan SOAP VCF format Text file One header line meta information lines One line : variant/position ##fileformat=vcfv4.1! ##filedate=20090805! ##source=myimputationprogramv3.1!
More informationCloud Ready for Bioinformatics?
IDB acknowledges co-funding by the European Community's Seventh Framework Programme (INFSO-RI-261552) and the French National Research Agency's Arpege Programme (ANR-10-SEGI-001) Cloud Ready for Bioinformatics?
More informationCloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
More informationHadoopizer : a cloud environment for bioinformatics data analysis
Hadoopizer : a cloud environment for bioinformatics data analysis Anthony Bretaudeau (1), Olivier Sallou (2), Olivier Collin (3) (1) anthony.bretaudeau@irisa.fr, INRIA/Irisa, Campus de Beaulieu, 35042,
More informationNGS Data Analysis: An Intro to RNA-Seq
NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental
More informationA Design of Resource Fault Handling Mechanism using Dynamic Resource Reallocation for the Resource and Job Management System
A Design of Resource Fault Handling Mechanism using Dynamic Resource Reallocation for the Resource and Job Management System Young-Ho Kim, Eun-Ji Lim, Gyu-Il Cha, Seung-Jo Bae Electronics and Telecommunications
More informationDevelopment of Bio-Cloud Service for Genomic Analysis Based on Virtual
Development of Bio-Cloud Service for Genomic Analysis Based on Virtual Infrastructure 1 Jung-Ho Um, 2 Sang Bae Park, 3 Hoon Choi, 4 Hanmin Jung 1, First Author Korea Institute of Science and Technology
More informationGeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter florian.halbritter@ed.ac.uk Stem Cell Bioinformatics Group (Simon R. Tomlinson) simon.tomlinson@ed.ac.uk December 10, 2012 Florian Halbritter
More informationThe NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
More informationHow Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
More informationSeqPig: simple and scalable scripting for large sequencing data sets in Hadoop
SeqPig: simple and scalable scripting for large sequencing data sets in Hadoop André Schumacher, Luca Pireddu, Matti Niemenmaa, Aleksi Kallio, Eija Korpelainen, Gianluigi Zanetti and Keijo Heljanko Abstract
More informationHow-To: SNP and INDEL detection
How-To: SNP and INDEL detection April 23, 2014 Lumenogix NGS SNP and INDEL detection Mutation Analysis Identifying known, and discovering novel genomic mutations, has been one of the most popular applications
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationManaging and Conducting Biomedical Research on the Cloud Prasad Patil
Managing and Conducting Biomedical Research on the Cloud Prasad Patil Laboratory for Personalized Medicine Center for Biomedical Informatics Harvard Medical School SaaS & PaaS gmail google docs app engine
More informationUsing Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org
Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview
More informationHADOOP IN THE LIFE SCIENCES:
White Paper HADOOP IN THE LIFE SCIENCES: An Introduction Abstract This introductory white paper reviews the Apache Hadoop TM technology, its components MapReduce and Hadoop Distributed File System (HDFS)
More informationAn Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
More informationWelcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
More informationHigh Performance Compu2ng Facility
High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationInstallation Guide for Windows
Installation Guide for Windows Overview: Getting Ready Installing Sequencher Activating and Installing the License Registering Sequencher GETTING READY Trying Sequencher: Sequencher 5.2 and newer requires
More informationA Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here
A Complete Example of Next- Gen DNA Sequencing Read Alignment Presentation Title Goes Here 1 FASTQ Format: The de- facto file format for sharing sequence read data Sequence and a per- base quality score
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationNazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
More informationAccelerating Data-Intensive Genome Analysis in the Cloud
Accelerating Data-Intensive Genome Analysis in the Cloud Nabeel M Mohamed Heshan Lin Wu-chun Feng Department of Computer Science Virginia Tech Blacksburg, VA 24060 {nabeel, hlin2, wfeng}@vt.edu Abstract
More information454 Sequencing System Software Manual, v 2.5p1
, v 2.5p1 August 2010 For life science research only. Not for use in diagnostic procedures. 454 Sequencing System Software Manual Software v. 2.5p1, August 2010 Table of Contents Preface...4 About this
More informationMass Storage Use Cases April 21, 2011
Mass Storage Use Cases April 21, 2011 Note: These use cases describe possible scenarios. Any association with actual people or events is entirely coincidental. 1. Management and retention of raw data generated
More informationHPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER Veeram Venkata Siva Prasad 1 and Gunisetti Loshma 2 1 M.Tech(CSE), Sri Vasavi Engineering college, Tadepalligudem, West Godavari District, Andhra Pradesh,
More informationDeep Sequencing Data Analysis: Challenges and Solutions
29 Deep Sequencing Data Analysis: Challenges and Solutions Ofer Isakov and Noam Shomron Sackler Faculty of Medicine, Tel Aviv University, Israel 1. Introduction Ultra high throughput sequencing, also known
More informationGlobus Genomics Tutorial GlobusWorld 2014
Globus Genomics Tutorial GlobusWorld 2014 Agenda Overview of Globus Genomics Example Collaborations Demonstration Globus Genomics interface Globus Online integration Scenario 1: Using Globus Genomics for
More informationBIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
More informationIntroduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
More informationCloudMap: A Cloud-based Pipeline for Analysis of Mutant Genome Sequences
Genetics: Advance Online Publication, published on October 10, 2012 as 10.1534/genetics.112.144204 CloudMap: A Cloud-based Pipeline for Analysis of Mutant Genome Sequences Gregory Minevich 1,, Danny S.
More informationComputational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
More informationTGC AT YOUR SERVICE. Taking your research to the next generation
TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina
More informationIntegrated Rule-based Data Management System for Genome Sequencing Data
Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer
More informationAssuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary
More informationAutomating installation, testing and development of bcbio-nextgen pipeline
Automating installation, testing and development of bcbio-nextgen pipeline GUILLERMO CARRASCO HERNÁNDEZ guillermo.carrasco@scilifelab.se June 2013 Final project at Barcelona School of Informatics (FIB)
More informationPartek Flow Installation Guide
Partek Flow Installation Guide Partek Flow is a web based application for genomic data analysis and visualization, which can be installed on a desktop computer, compute cluster or cloud. Users can access
More informationDisease gene identification with exome sequencing
Disease gene identification with exome sequencing Christian Gilissen Dept. of Human Genetics Radboud University Nijmegen Medical Centre c.gilissen@antrg.umcn.nl Contents Infrastructure Exome sequencing
More informationOverview sequence projects
Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory
More information