Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Next generation sequencing (NGS) Bioinformatics Challenges and strategies. Urmi Trivedi Lead Bioinformatician"

Transcription

1 Next generation sequencing (NGS) Bioinformatics Challenges and strategies Urmi Trivedi Lead Bioinformatician

2 Major Bottlenecks Data volume Data complexity Data noise Overview Solutions Data formats Levels of NGS Bioinformatics Analytical strategies 2

3 Imbalance in genome informatics ecosystem Stein Genome Biology :207 doi: /gb

4 Hierarchy of NGS Data Volume Individual features 1MB Variation Data 4-5 GB Alignment Data 600GB Sequence plus Quality Data 1TB Intensities and Raw Data 5 TB Typical output from a single flowcell of a hiseq run 5

5 Hierarchy of NGS Data Volume Scalable storage Maintenance Clear as you go Individual features 1MB Backup Network Variation Data 4-5 GB Streamed replication of the original data, with copies being stored at multiple location Alignment Data 600GB Deposit data in public data repositories like ENA (European Nucleotide Archive) High Speed Network Sequence plus Quality Data 1TB Intensities and Raw Data 5 TB High performance computing such as Cluster computing or cloud computing Typical output from a single flowcell of a hiseq run Analysis Paralysis 5

6 Large amount of intermediate files Bears no discernable relationship to experiments >5000 intermediate files after image processing 6

7 Multiplexing adds up to it LIMS (Laboratory Information Management System) Automatic pipelines for running Tracking Samples programs Running downstream analysis A flowcell with only 3 bacrodes in 2 lanes produces ~14000 files 7

8 Data Noise Base-pair quality score Adapter contamination Quality Control Uneven Amplification 8

9 Data Formats SFF A binary file containing information about flowgrams, sequences, qualities FASTQ Contains sequence by cycle and respective quality 9

10 Data Formats FASTA Fasta header and the sequence >HWI-EAS222_2093MAAXX GAAATATTAAGTCTTTCAAA QUAL Fasta header and phred scores >HWI-EAS222_2093MAAXX FASTQ Sequence and ASCII coded phred GATTTCTTTGTCATTATTTA + IIIIIIIIIIIIIIIIIIIIIIIIIIIII 10

11 Levels of NGS Bioinformatics Production Bionformatics Advanced Bioinformactics Produce raw sequence reads and QC Map to genome and generate raw genomic features (e.g. SNPs), Assemble a genome de novo with existing tools, Bioinformatics Research Analyze the data; Uncover the biological meaning 11

12 Production Bioinformatics Vendor s pipeline Generation of fastq or similar files QC scripts L I M S >>Per sequence quality scores pass #Quality Count FAIL PASS Offsite backup Further investigation Advanced Bioinformatics 12

13 Advanced Bioinformatics Existing Reference Sequence No Reference Sequence Short Read Alignment De novo Assembly Variant Calling Gene Expression sirna/microrna Analysis De novo Transcriptome Assembly Metagenomics Population Genomics 13

14 Advanced Bioinformatics Software/Tools Open source tools Free for use Mostly Linux based Runs on command line Complicated Installation at times Commercial software Tools for biologists Pretty interface and ease of use CLCBio, Geneious, DNAStar, Partek 14

15 Short Read Alignment: Challenges Speed Using tools like BLAST/BLAT would require 100 CPU hours Memory Read Errors Repetitive regions Sequencer Differences 15

16 ELAND MAQ BWA BOWTIE TOPHAT GSNAP SOAP-2 Novoalign Short Read Alignment: Software 16

17 Variant calling Reads Align Reference Genome SNP 17

18 Variant Calling Misalignment due to Indels 18

19 Variant Calling Indel Realignment GATK MSA 19

20 Variant Calling -Workflow Raw data Alignment (SAM/BAM format) Realignment to correct errors GATK ELAND, MAQ, BWA, BOWTIE, SSAHA2, SOAP-2 PICARD, SAMTOOLS Mark duplicates Validation, Visualization and Bioinformatics Research Annotations SAMTOOLS, GATK, VarScan SNPs/indel calling IGV, Savant, Tablet 20

21 S1 Gene Expression Analysis Reads (cdna fragments) S2 Align Aligned read counts as a measure of gene expression 21

22 Gene Expression Analysis -Workflow Raw data Alignment (SAM/BAM format) Mark duplicates? TOPHAT, GSNAP, STAMPY, BWA, BOWTIE PICARD, SAMTOOLS Validation & Bioinformatics Research Normalization and Differential Gene Expression Raw Counts EdgeR, DeSEQ 22

23 Velvet ABYSS ALLPATHS-2 SOAPDenovo SGA EDENA CLCbio Newbler De novo Genome Assembly Software 23

24 De novo Genome Assembly Workflow Short reads (Typically 100bp paired end) Filter Poor quality data, sequence adapters, etc Assemble and generate contigs QC Long reads (e.g. 454, Sanger) Mate pairs (3-10KB insert) Generate Scaffolds QC Data Visualization (GMOD, Gbrowse,Tablet) Annotation (Gene Prediction, etc.) (MAKER, Augustus) 24

25 Summary Nextgen Sequencing is still very rapidly moving field Plan for change Keeping our infrastructure flexible Keep disk space expandable Keep software agile NEVER proceed with the analysis without data QC Choose the right tool for the right job 25

26 Acknowledgements Professor Mark Blaxter Dr. Karim Gharbi Dr. Stephen Bridgett Timothée Cézard Gaganjot Kaur Stuart Taylor The Darwin Trust of Edinburgh 26

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

Analysis of NGS Data

Analysis of NGS Data Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS

INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) INTRODUCTION TO NGS VARIANT CALLING ANALYSIS Bioinformàtica

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows

Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows Genes 2012, 3, 545-575; doi:10.3390/genes3030545 Article OPEN ACCESS genes ISSN 2073-4425 www.mdpi.com/journal/genes Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012 RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided

More information

Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT

Building Bioinformatics Capacity in Africa. Nicky Mulder CBIO Group, UCT Building Bioinformatics Capacity in Africa Nicky Mulder CBIO Group, UCT Outline What is bioinformatics? Why do we need IT infrastructure? What e-infrastructure does it require? How we are developing this

More information

Deep Sequencing Data Analysis

Deep Sequencing Data Analysis Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist

More information

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille

Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) stephane.le_crom@upmc.fr Paris November 2013 The Sanger DNA sequencing method Sequencing

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Practical Solutions for Big Data Analytics

Practical Solutions for Big Data Analytics Practical Solutions for Big Data Analytics Ravi Madduri Computation Institute (madduri@anl.gov) Paul Dave (pdave@uchicago.edu) Dinanath Sulakhe (sulakhe@uchicago.edu) Alex Rodriguez (arodri7@uchicago.edu)

More information

SRA File Formats Guide

SRA File Formats Guide SRA File Formats Guide Version 1.1 10 Mar 2010 National Center for Biotechnology Information National Library of Medicine EMBL European Bioinformatics Institute DNA Databank of Japan 1 Contents SRA File

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Practical Guideline for Whole Genome Sequencing

Practical Guideline for Whole Genome Sequencing Practical Guideline for Whole Genome Sequencing Disclosure Kwangsik Nho Assistant Professor Center for Neuroimaging Department of Radiology and Imaging Sciences Center for Computational Biology and Bioinformatics

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

CHALLENGES IN NEXT-GENERATION SEQUENCING

CHALLENGES IN NEXT-GENERATION SEQUENCING CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture

More information

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011

NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky

More information

-> Integration of MAPHiTS in Galaxy

-> Integration of MAPHiTS in Galaxy Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Bioinformatics Unit Department of Biological Services. Get to know us

Bioinformatics Unit Department of Biological Services. Get to know us Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information

Large-scale Research Data Management and Analysis Using Globus Services. Ravi Madduri Argonne National Lab University of Chicago @madduri

Large-scale Research Data Management and Analysis Using Globus Services. Ravi Madduri Argonne National Lab University of Chicago @madduri Large-scale Research Data Management and Analysis Using Globus Services Ravi Madduri Argonne National Lab University of Chicago @madduri Outline Who we are Challenges in Big Data Management and Analysis

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Data formats and file conversions

Data formats and file conversions Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Public Health Laboratory Workforce Development Bioinformatics

Public Health Laboratory Workforce Development Bioinformatics Public Health Laboratory Workforce Development Bioinformatics Templates for Course Development Contents Overview... 1 Going Beyond the Introductory Courses... 1 Course Templates... 3 Template 1: Introduction

More information

Databases and mapping BWA. Samtools

Databases and mapping BWA. Samtools Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline

More information

UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production

UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department

More information

About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster

About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster Cluster Info Sheet About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster Welcome to the PMCBRC cluster! We are happy to provide and manage this compute cluster as a resource

More information

Genomic Testing: Actionability, Validation, and Standard of Lab Reports

Genomic Testing: Actionability, Validation, and Standard of Lab Reports Genomic Testing: Actionability, Validation, and Standard of Lab Reports emerge: Laura Rasmussen-Torvik Reaction: Heidi Rehm Summary: Dick Weinshilboum Panel: Murray Brilliant, David Carey, John Carpten,

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Exome sequencing at the CCG. NGS an der Schnittstelle von Grundlagen- und translationaler Forschung"

Exome sequencing at the CCG. NGS an der Schnittstelle von Grundlagen- und translationaler Forschung Exome sequencing at the CCG NGS an der Schnittstelle von Grundlagen- und translationaler Forschung" Peter Nürnberg TMF-Workshop Berlin, 7.12.2012 University of Cologne The exome sequencing pipeline library

More information

High Throughput Sequencing Data Analysis using Cloud Computing

High Throughput Sequencing Data Analysis using Cloud Computing High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom (stephane.le_crom@upmc.fr) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure

More information

NSilico Life Science Introductory Bioinformatics Course

NSilico Life Science Introductory Bioinformatics Course NSilico Life Science Introductory Bioinformatics Course INTRODUCTORY BIOINFORMATICS COURSE A public course delivered over three days on the fundamentals of bioinformatics and illustrated with lectures,

More information

BioHPC Web Computing Resources at CBSU

BioHPC Web Computing Resources at CBSU BioHPC Web Computing Resources at CBSU 3CPG workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/biohpc_web_tutorial.pdf BioHPC infrastructure at CBSU BioHPC Web

More information

Issues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing

Issues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing Issues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing Matthew Trunnell Manager, Research Computing Broad Institute Overview The Broad Institute Major challenges Current data workflow

More information

Towards Integrating the Detection of Genetic Variants into an In-Memory Database

Towards Integrating the Detection of Genetic Variants into an In-Memory Database Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base

More information

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA

Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

De Novo Assembly Using Illumina Reads

De Novo Assembly Using Illumina Reads De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the

More information

Copy Number Variation: available tools

Copy Number Variation: available tools Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available

More information

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated

More information

454 Sequencing System Software Manual Version 2.6

454 Sequencing System Software Manual Version 2.6 454 Sequencing System Software Manual Version 2.6 Part C: May 2011 Instrument / Kit GS Junior / Junior GS FL+ / L+ GS FL+ / LR70 GS FL / LR70 For life science research only. Not for use in diagnostic procedures.

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Scalable Cloud Computing Solutions for Next Generation Sequencing Data

Scalable Cloud Computing Solutions for Next Generation Sequencing Data Scalable Cloud Computing Solutions for Next Generation Sequencing Data Matti Niemenmaa 1, Aleksi Kallio 2, André Schumacher 1, Petri Klemelä 2, Eija Korpelainen 2, and Keijo Heljanko 1 1 Department of

More information

Text file One header line meta information lines One line : variant/position

Text file One header line meta information lines One line : variant/position Software Calling: GATK SAMTOOLS mpileup Varscan SOAP VCF format Text file One header line meta information lines One line : variant/position ##fileformat=vcfv4.1! ##filedate=20090805! ##source=myimputationprogramv3.1!

More information

Cloud Ready for Bioinformatics?

Cloud Ready for Bioinformatics? IDB acknowledges co-funding by the European Community's Seventh Framework Programme (INFSO-RI-261552) and the French National Research Agency's Arpege Programme (ANR-10-SEGI-001) Cloud Ready for Bioinformatics?

More information

Storage Solutions for Bioinformatics

Storage Solutions for Bioinformatics Storage Solutions for Bioinformatics Li Yan Director of FlexLab, Bioinformatics core technology laboratory liyan3@genomics.cn http://www.genomics.cn/flexlab/index.html Science and Technology Division,

More information

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/

More information

GeneProf and the new GeneProf Web Services

GeneProf and the new GeneProf Web Services GeneProf and the new GeneProf Web Services Florian Halbritter florian.halbritter@ed.ac.uk Stem Cell Bioinformatics Group (Simon R. Tomlinson) simon.tomlinson@ed.ac.uk December 10, 2012 Florian Halbritter

More information

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community

Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/

More information

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/

More information

Development of Bio-Cloud Service for Genomic Analysis Based on Virtual

Development of Bio-Cloud Service for Genomic Analysis Based on Virtual Development of Bio-Cloud Service for Genomic Analysis Based on Virtual Infrastructure 1 Jung-Ho Um, 2 Sang Bae Park, 3 Hoon Choi, 4 Hanmin Jung 1, First Author Korea Institute of Science and Technology

More information

Hadoopizer : a cloud environment for bioinformatics data analysis

Hadoopizer : a cloud environment for bioinformatics data analysis Hadoopizer : a cloud environment for bioinformatics data analysis Anthony Bretaudeau (1), Olivier Sallou (2), Olivier Collin (3) (1) anthony.bretaudeau@irisa.fr, INRIA/Irisa, Campus de Beaulieu, 35042,

More information

SeqPig: simple and scalable scripting for large sequencing data sets in Hadoop

SeqPig: simple and scalable scripting for large sequencing data sets in Hadoop SeqPig: simple and scalable scripting for large sequencing data sets in Hadoop André Schumacher, Luca Pireddu, Matti Niemenmaa, Aleksi Kallio, Eija Korpelainen, Gianluigi Zanetti and Keijo Heljanko Abstract

More information

NGS Data Analysis: An Intro to RNA-Seq

NGS Data Analysis: An Intro to RNA-Seq NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental

More information

A Design of Resource Fault Handling Mechanism using Dynamic Resource Reallocation for the Resource and Job Management System

A Design of Resource Fault Handling Mechanism using Dynamic Resource Reallocation for the Resource and Job Management System A Design of Resource Fault Handling Mechanism using Dynamic Resource Reallocation for the Resource and Job Management System Young-Ho Kim, Eun-Ji Lim, Gyu-Il Cha, Seung-Jo Bae Electronics and Telecommunications

More information

Buyer s Guide: Next-Generation Sequencing Systems

Buyer s Guide: Next-Generation Sequencing Systems Buyer s Guide: Next-Generation Sequencing Systems Covering All the Bases: What to Consider Before Making Your NGS System Purchase. This is an exciting time for biological research. Meaningful discovery

More information

Genomics for Dummies. Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013

Genomics for Dummies. Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013 Genomics for Dummies Bio informatics and Comparative Genomes Analysis: Jean Michel Claverie 6 18 mai 2013 Do I need to know more than just this telephone number? Introduction Try to learn/understand things

More information

The NGS IT notes. George Magklaras PhD RHCE

The NGS IT notes. George Magklaras PhD RHCE The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

HADOOP IN THE LIFE SCIENCES:

HADOOP IN THE LIFE SCIENCES: White Paper HADOOP IN THE LIFE SCIENCES: An Introduction Abstract This introductory white paper reviews the Apache Hadoop TM technology, its components MapReduce and Hadoop Distributed File System (HDFS)

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

Introduction to NGS Technologies

Introduction to NGS Technologies Introduction to NGS Technologies Ignacio Medina im411@cam.ac.uk Head of Computational Biology Lab HPC Service, University of Cambridge, UK EMBL-EBI Scientific collaborator Genome Campus, Hinxton, Cambridge,

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models

Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Megan Bowman Childs Lab Bioinformatics Seminar 22 April 2015 Outline GC content in plant genomes Codon usage

More information

A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here

A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here A Complete Example of Next- Gen DNA Sequencing Read Alignment Presentation Title Goes Here 1 FASTQ Format: The de- facto file format for sharing sequence read data Sequence and a per- base quality score

More information

Managing and Conducting Biomedical Research on the Cloud Prasad Patil

Managing and Conducting Biomedical Research on the Cloud Prasad Patil Managing and Conducting Biomedical Research on the Cloud Prasad Patil Laboratory for Personalized Medicine Center for Biomedical Informatics Harvard Medical School SaaS & PaaS gmail google docs app engine

More information

Globus Genomics Tutorial GlobusWorld 2014

Globus Genomics Tutorial GlobusWorld 2014 Globus Genomics Tutorial GlobusWorld 2014 Agenda Overview of Globus Genomics Example Collaborations Demonstration Globus Genomics interface Globus Online integration Scenario 1: Using Globus Genomics for

More information

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview

More information

454 Sequencing System Software Manual, v 2.5p1

454 Sequencing System Software Manual, v 2.5p1 , v 2.5p1 August 2010 For life science research only. Not for use in diagnostic procedures. 454 Sequencing System Software Manual Software v. 2.5p1, August 2010 Table of Contents Preface...4 About this

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

High Performance Compu2ng Facility

High Performance Compu2ng Facility High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Partek Flow Installation Guide

Partek Flow Installation Guide Partek Flow Installation Guide Partek Flow is a web based application for genomic data analysis and visualization, which can be installed on a desktop computer, compute cluster or cloud. Users can access

More information

Deep Sequencing Data Analysis: Challenges and Solutions

Deep Sequencing Data Analysis: Challenges and Solutions 29 Deep Sequencing Data Analysis: Challenges and Solutions Ofer Isakov and Noam Shomron Sackler Faculty of Medicine, Tel Aviv University, Israel 1. Introduction Ultra high throughput sequencing, also known

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

How-To: SNP and INDEL detection

How-To: SNP and INDEL detection How-To: SNP and INDEL detection April 23, 2014 Lumenogix NGS SNP and INDEL detection Mutation Analysis Identifying known, and discovering novel genomic mutations, has been one of the most popular applications

More information

TGC AT YOUR SERVICE. Taking your research to the next generation

TGC AT YOUR SERVICE. Taking your research to the next generation TGC AT YOUR SERVICE Taking your research to the next generation 1. TGC At your service 2. Applications of Next Generation Sequencing 3. Experimental design 4. TGC workflow 5. Sample preparation 6. Illumina

More information

Installation Guide for Windows

Installation Guide for Windows Installation Guide for Windows Overview: Getting Ready Installing Sequencher Activating and Installing the License Registering Sequencher GETTING READY Trying Sequencher: Sequencher 5.2 and newer requires

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information