gl - 1,MgSO gl - 1, FeSO gl - 1, KH 2 PO 4

Transcription

1 44 1 Vol144,No ACTA PEDOLOGICA SINICA Jan., g (, ),, (SBR) Pseudomonas fluorescens dn13,, NH 3 2N ; NO - 3 2N, NO - 3 2N NH 3 2N,, ( ), ; ; ; X172 A / (SND) (ANAMONOX) (CANON),, [1,2 ],,, Pseudomonas denitrificanes [3 ] Arthrobacter sp. [4 ] Nitrosomonas europea [5 ] Thiosphaera pantotropha ( Paracoccus denitrifi2 cations) [6 ],,,, (SBR), dn13,, dn [7] BIOLOG 16S rdna BIOLOG (MicroStation) DNA DNA, BSF8/ 20 :5 2AGAGTTTGATCCTGGCTCAG23 BSR1407/ 16 : 5 2GACGGGCGGTGTGTRC23, 16S rdna,pcr (50 l) : 1 l,10 PCR 5 l,mgcl 2 4 l,dntp 1 l, Taq 015 l, DNA 1 l, 3615 l PCR 55, PCR TaKaRa pmd - 18T ( TaKaRa ), NaCl 013 gl - 1,MgSO gl - 1, FeSO gl - 1, KH 2 PO gl - 1, 014 mll - 1 (Mn 22 gl - 1,B 21 gl - 1,Cu 17 gl - 1,Zn 16 gl - 1,Co 14 gl - 1 ) 3 (BK ) g,,e2mail com ; : : (1982 ),,,, : ; :

2 1 : LB 10 gl - 1, 5 gl - 1, NaCl 10 gl LB,, (10 7 ml - 1 ) 114 dn13, (NH 4 ) 2 SO 4, NaHCO 3 ;, (NH 4 ) 2 SO 4, 2 gl %, 28, 150 rmin - 1, NH 3 2N NO2-2N NO3-2N ph, ph, dn13, NaNO 2 (013 gl - 1 ) NaNO 3 (0136 gl - 1 ), (2 gl - 1 ), 4 5 %,, 28, NH 3 2N NO2-2N NO3-2 N ph, ph, 710, 116 dn %, 28, 150 rmin - 1, NH 3 2N NO2-2N NO3-2N ph, ph, NH 3 2N NO2-2N NO3-2N N2 ( 12 ) 2 [8 ] 660nm,pH PHS23C ph ( ), ( DO ) J PB ( ) 6890, : ; 3 mm, 2 m, GDX2401 ( ) dn13 dn13 [7 ] BIOLOG (MicroStation) dn13 Pseu2 domonas ;16S rdna, dn13 Pseudomonas fluorescens % dn13 ( Pseudomonas fluorescens) 212 Pseudomonas fluorescens dn13 ( DO > 7mgL - 1 ), (NH 4 ) 2 SO 4, 1 A. NaHCO 3 ; B. Sodium acetate ; C. Malic acid ; D. Glucose 1 (NH 4 ) 2 SO 4, dn13 Fig11 Effect of carbon source on aerobic NH 32N oxidation of strain dn13 using (NH 4 ) 2SO 4 as the sole nitrogen resource

3 ,, Pseudomonas fluorescens dn13 NH 3 2N NO - 2 2N, NO - 3 2N NH 3 2N CO 2-3 ( 1A), NH 3 2N, NH 3 2N, NH 3 2N ; ( 1D),, NH 3 2N, ( 1C),, NH 3 2N, NO - 2 2N ( 1B),,, NH 3 2N, NO 2-2N : > > > NaHCO 3,, ( DO > 7 mgl - 1 ),, 2 A. Ethanamide ; B. Urea ; C. Glycine ; D. (NH 4 ) 2 SO 4 2, dn13 Fig12 Effect of nitrogen source on aerobic NH 32N oxidation of strain dn13 using sodium acetate as the sole carbon resource 2A 2B 2C,, NH 3 2N ;, NH 3 2N, NH 3 2N NH 3 2N, NH 3 2N NO - 2 2N, NH 3 2N, NH 3 2N NO - 2 2N 410 mmoll - 1, NO - 2 2N,, [9 ] 2D 2,, ; 213 Pseudomonas fluorescens dn13, NaNO 2, NaNO 3,pH 710, (DO = 0 mgl - 1 ), 3,, 1

4 1 : 147 A. Glucose and sodium nitrite ; B. Sodium acetate and sodium nitrite ; C. Glucose and sodium nitrate ; D. Sodium acetate and sodium nitrate 3 Fig13 Nitrite and nitrate reduction of strain dn13 under anaerobic condition 1 Table 1 Content of gaseous nitrogen produced in reaction system N 2 N 2 O Amount of N 2 Amount of N 2 O No. Carbon source Nitrogen source produced produced (mmoll - 1 ) (mmoll - 1 ) A Glucose Sodium nitrite B Sodium acetate Sodium nitrite C Glucose Sodium nitrate D Sodium acetate Sodium nitrate , NO - 3 2N 410 mmoll - 1,, N 2 N 2 O, ( 3A),, (NADH),NO - 2 2N NH 3 2N ; ( 3B, 3D),,NO - 2 2N NH 3 2N, NO 2-2N 3, NO - 2 2N ( 3A, 3B), NO - 2 2N NO - 3 2N ( 3C, 3D), NO - 3 2N NO - 2 2N, NO - 2 2N, ( 3C), NH 3 2N ;4 NO - 2 2N dn13,, 214 Pseudomonas fluorescens dn13 ( DO > 7 mgl - 1 ),, NaNO 2 NaNO 3, ph 710,, 4

5 A. Glucose and sodium nitrite ; B. Sodium acetate and sodium nitrite ; C. Glucose and sodium nitrate ; D. Sodium acetate and sodium nitrate 4 Fig14 Nitrite and nitrate reduction of strain dn13 under aerobic condition 4, NO - 2 2N ( 4A, 4B) NO - 3 2N ( 4C, 4D) 4. 0 mmoll - 1 ( 1 dn13 ), NO - 3 2N NH 3 2N ( 4A, 4C), NADH, NH 3 2N ( 4B, 4D),, [6 ] ; NH 3 2N,, 410 mmoll - 1, 1 4,,dN13 NH 3 2N, NO - 2 2N,NO - 3 2N 3, SBR Pseudomonas flu2 orescens dn13,, NH 3 2N ; NH 3 2N ; NO - 3 2N 410 mmoll - 1, NO - 3 2N NH 3 2N dn13 Pseudomonas fluo2 rescens dn13,, [ 1 ] Schmidt I, Sliekers O, Schmid M, et al. New conception of micro2 bial treatment process for the nitrogen removal in wastewater. FEMS Microbiology Reviews, 2003, 27 : [ 2 ] Khin Than, Annachhatre Ajit P. Novel microbial nitrogen removal processes. Biotechnology Advances, 2004, 22 : [ 3 ] Lesley A Robertson, Tage Dalsgaard,Niels2Peter Revsbech et al. Confirmation of aerobic denitrification in batch cultures, using gas chromatography and 15 N mass spectrometry, FEMS Microbiology Ecol2 ogy, 1995, 18 : [ 4 ] Brierley E D R, Wood M. Heterotrophic nitrification in an acid forest soil isolation and characterisation of a nitrifying bacterium. Soil Biol2 ogy &Biochemistry, 2001, 33 : [ 5 ] Christine Helmer, Sabine Kunst. Simultaneous nitrification denitrifi2 cation in an aerobic biofilm system. Water Science Technology, 1998, 37 (4/ 5) : [ 6 ] Lukow T, Diekmann H. Aerobic denitrification by a newly isolated heterotrophic bacterium strain TL1. Biotechnology Letters, 1997, 11 (19) : [ 7 ],,.., 2004,2 (1) : Shen J Q, Fang P, Fan W P. Four strains are isolated and primarily identified for nitrification (In Chinese). Chinese Journal of Bioprocess Engineering, 2004, 2(1) :30 34 [ 8 ]. ( ). :, State Environ2

6 1 : 149 mental Protection Administration. The Measurement of Determination and Analysis of Water and Wastewater (4th Ed. In Chinese). Bei2 jing : China Environmental Science Press, [ 9 ],,,.., 2003,43 (2) : Zhang G Y, Chen M C, Han R Y, et al. Isolation, identification and phyloge2 netic analysis of a heterotrophic nitrifie ( In Chinese). Acta Microbio2 logica Sinica, 2003, 43 (2) : A STRAIN OF PS EUDOMONAS FLUORESCENS WITH MUL TI2PATHS OF NITRO GEN METABOL ISM Wang Jinyu Fan Weiping g Li Shuang Shen Jiaqi ( College of Life Science and Pharmaceutical Engineering, Nanjing University of Technology, Nanjing , China) Abstract To study on autotrophic removal of nitrogen from wastewater containing a high concentration of NH 3 2N, a strain of Pseudomonas fluorescens dn13 was isolated, by means of incubation in Skerman s medium for Nitrosomona, from the se2 quence batch reactor system( SBR) of a wastewater treatment plant in Nanjing. Under aerobic condition, this strain could oxidize NH 3 2N into NO - 2 2N and grow without organic carbon source ; and reduce NO - 2 2N and NO - 3 2N into NH 3 2N with organic carbon source and adequate concentration of NO - 2 2N and NO - 3 2N, while under anaerobic condition, strain dn13 could still reduce NO - 2 2N and NO - 3 2N into NH 3 2N with sodium acetate as the sole carbon source. In the cells of strain dn13 with such multi2paths of nitrogen metabolism, coupling of nitrification and denitrification is feasible. metabolism Key words Pseudomonas fluorescens ; Aerobic oxidation of ammonia ; Reduction of nitrite and nitrate ; Multi2path nitrogen