MOL.911 HNL Expression

Size: px
Start display at page:

Download "MOL.911 HNL Expression"

Transcription

1 1 W I S S E N T E C H N I K L E I D E N S C H A F T MOL.911 HNL Expression

2 2 Hydroxynitrile lyase (Hnl) R 1 HCN R 1 OH R 2 C O R 2 C * CN S selective: Hevea brasiliensis R selective: Prunus spp.

3 3 (S) Hnl of Hevea brasiliensis and (R) Hnl of Prunus amygdalus Hb_Hnl Type II Hnl intracellular protein 29.2 kda homodimer / hydrolase fold protein catalytic triad (S) selektive Pam_Hnl Type I Hnl secretory protein 61 kda ( 57.9 kda) Homology to oxidases FAD N glycosylated isoenzymes (R) selektive

4 4 3 D structure of Hb_HNL C81 K236 S80 H235 D207

5 5 Intracellular Hnl Expression in Escherichia coli Translational Coupling ATG...AATAAGGAGAATAAACCATGGCATTC Met...AsnLysGluGlu * MetAlaPhe mini-cistron SD NcoI Hnl ORF P trc HbHnl ORF T rrnb pse420 phnl-200

6 6 Soluble

7 7 Intracellular Hnl Expression in Saccharomyces cerevisiae and Pichia pastoris ATTATTCGAACGAGGCCATGGCATTC EcoRI MetAlaPhe Hnl ORF AAAGATCCCCCGGGCTGCAGGAATTCCATGGCATTC Hnl ORF BamHI/BglI MetAlaPhe P AOX PGK Hnl ORF T PGK AOX phild2 pma91 phnl-400 phnl-300

8 8 Secretory Hnl Expression in Saccharomyces cerevisiae and Pichia pastoris XbaI MF 1-leader GGGGTATCTCTCGAGAAAAGAGAGGCATTC GlyValSerLeuGluLysArgGluAlaPhe Hnl ORF P AOX PGK P.pastoris AOX1 Promoter Hnl ORF phnl-401 T PGK AOX phild2 pma91 Vector basis S.cerevisiae PGK Promoter phnl-309

9 9 Secretion targeted Hb_Hnl accumulates in the cell periphery intracellular secretory Direction of a naturally intracellularly expressed protein into the secretory pathway leads to accumolation in the cell membrane

10 10 Hb Hnl expression in filamentous fungi P gpd Hnl ORF T trpc panhnl P gla Hnl ORF T trpc pglahnl P uce aox Hnl ORF T pucehnl trpc paoxhnl P gla SS gla24 Hnl ORF T trpc pglass1hnl P gpd P gla P P aox gla SS gla24 Hnl ORF T trpc p***hnl pyrg pyrg gpd: A.niger glyceraldehydephosphate dehydrogenase gla: A.awamori glucoamylase uce: unknown constitutively expressed gene, P.chrysogenum aox: P.chrysogenum alcohol oxidase

11 11 Intracellular Hnl Expression in Penicillium chrysogenum under control of P AOX P AOX Termination Problem AOX: Penicillium chrysogenum Alcohol Oxidase Hnl ORF T paoxhnl TrpC P AOX Hnl ORF T AOX paoxhnl Ta paoxhnl TaT P AOX Hnl ORF T AOX T TrpC

12 12 Southern analysis of Penicillium chrysogenum P AOX transformants paoxhnl TaT B Multiple ectopic integration paoxhnl Ta

13 13 Northern blot analysis of Penicillium chrysogenum P AOX transformants paoxhnl TaT C Hnl probe C Actin probe

14 14 Western blot analysis of Penicillium chrysogenum P AOX transformants Protease Problems Total cellular proteins SDS PAGE Western blot with Hnl Antibody B 97 kd 66 kd 45 kd paoxhnl TaT 97 kd 66 kd 45 kd A 31 kd 21 kd 14 kd 66 kd 45 kd 31 kd 21 kd 14 kd A 31 kd 21 kd 14 kd Hnl paoxhnl Ta 97 kd 66 kd 45 kd 31 kd 21 kd 14 kd Degradation!

15 15 Expression analysis of Penicillium chrysogenum P AOX transformants AOX Promoter Activity Test uida: Reporter gene, ß glucuronidase paoxhnl TaT Hnl Expression negative control AOX::uidA fusion 2% lactose ph 8 Blue colour = cleavage of X Glucose by ß glucuronidase v.i purified HNL

16 16 Gene replacement in Pichia pastoris at AOX1 NotI AOX1 promoter HIS4 selection marker AOX1 transcription termination signal 3 AOX1 region Amp R F1 ori ColE1 replicon NotI 5 P AOX1 Gene o.i. TT HIS4 3 AOX1 Mut s 5 AOX1 TT 3

17 17 Pichia pastoris Hb_Hnl expression strain 1 17 Fed batch fermentation Cell density [OD600] Cell density Methanol Hnl-activity time [h] specific Hnl-activity [U/mg]

18 18 Pichia pastoris Hb_Hnl expression strain 1 17 Fed batch fermentation Fermentation time (hours after induction) ST ST Soluble proteins in cell extracts

19 19 Heterologous Hnl Expression (shake flask experiments) Construct Host cytosol (U/mg) purified enzyme (U/mg) total per culture Hevea brasiliensis phnl 200 E. coli phnl 300 S. cerevisiae phnl 400 P. pastoris panhnl A. niger U/g (leaves) U/ml OD= U/ml OD= U/ml OD=4 0.6 ~ 0.1 U/ml nd

20 20 Production of Hb_Hnl with Pichia pastoris Expression System ( Fed Batch Fermentation) Cell wet weight Cell dry weight Total protein Hnl protein Hnl units 400 g / l 100 g / l 56 g / l 23 g / l 1.4 x 10 6 / l

21 21 (S) Hnl of Hevea brasiliensis and (R) Hnl of Prunus amygdalus Hb_Hnl Type II Hnl intracellular protein 29.2 kda homodimer / hydrolase fold protein catalytic triad (S) selektive Pam_Hnl Type I Hnl secretory protein 61 kda ( 57.9 kda) Homology to oxidases FAD N glycosylated isoenzymes (R) selektive

22 22 Pam_Hnl5: Secretory Expression of Prunus amygdalus (R) Hnl in Pichia pastoris P AOX1 SS Hnl ORF TT HIS4 3 AOX1 Host: Pichia pastoris GS115 Endo H d n u EndoF u Endo F n d Alpha factor signal sequence 97 kda Mut s and Mut + Transformants 66 kda 39 kda Functional secretory expression 27 kda highly glycosylated 21 kda 14 kda

23 23 High level Expression Clone D1 17??? Super expression strain D1 17 Standard expression clone Hnl wt great success with expression Engineered Hnl Proteins do it the same way! High expression levels were Not Reproducible!!

24 24 High level Expression Clone D1 17??? ATTATTCGAACGAGGCCATGGCATTC MetAlaPhe EcoRI Hnl ORF phnl 400 P AOX Hnl ORF T AOX phild2 Intracellular Hnl Expression in Pichia pastoris Hasslacher et al., Prot.Expr.Purif., 1997 Not the Problem!

25 25 Molecular Analysis of Expression Strain Southern blotting HNL probe Strange Fragments AOX1 Probe More than one Copy Integrated How??

26 26 Molecular Analysis of Expression Strain ~ 400 bp Deletion Hnl Δ 383 bp Δ 29 bp Hnl Tandem Integration head to head (divergent) P AOX1 P AOX1 3 copies of Hnl, 1 standard Integration in AOX1 Locus 2 truncated, in a head to head oriented AOX1 Promoter Fragments

27 27 phhaox561( HbHNLwt) Expression analysis Expression phhaox915( HbHNLwt) paoxgrazlang( HbHNLwt) paoxgrazshort( HbHNLwt) paoxgraztotal( HbHNLwt) single copy D1.17

28 28 Specific genomic setup Hartner et al., Nucleic Acids Research, 2008, Vol. 36, Specific complex?? Concerted action of activators?? Repression active site deleted??

29 29 CYC1 transcription termination TEF1 promoter Zeocin EM7 promoter EcoRV (6610) 3 AOX1 XmnI (6164) EcoRV (7578) EheI (5801) BglI (7445) EheI (5687) EheI (5666) XmnI (5160) hh Expression vector ColE1 ori phhaox 561-HbHNL wt 8568 bp HIS4 BglII (2) paox1- hh SalI (4211) HindIII (74) BglI (3622) XmnI (3728) EheI (3766) KpnI (3837) 1.17 hhaox1 long BglI (676) 1.17 hhaox1 short KpnI (3225) HindIII (1413) EcoRI (1484) NdeI (1527) HbHNL wt NotI (2269) XmnI (2280) 3 AOX transcription termina HindIII (2615) HindIII (2627) EcoRV (2785) GOI

30 30 Expression of Hb_Hnl mutants in Pichia pastoris Super expression strain D1 17 Standard expression clone Novel expression clones Modified hh AOX1 based promoter System Intracellular Expression Hnl

31 31 Screening for High level Expression Screening systems based on principle of translational coupling Well known in Prokayotes Does it work in Eukaryotes??? P AOX1 Hb_HNL Sh_ble 3 AOX1 Zeocin R 5 Cap 3 Poly A ATG Stop Hb_Hnl Veeresh Juturu, PhD Thesis Stop Start NNNUGAATGNNN. Bicistronic system 1 mrna, 2 Proteins Sh_Ble

32 32 Correlating Hnl expression to zeocin resistance Veeresh Juturu, PhD Thesis Increasing Zeocin Concentration MD 4.9x10 4 BMMS 4.9x10 4 BMMS 4.9x µg/ml BMMS 4.9x µg/ml BMMS 4.9x10 4, 150 µg/ml

33 33 Hnl expression Screen for High Resistance Check for Expression Level A B C D E F mg/l Zeocin 150 mg/l Zeocin Controls + ++ Single copy D1 17 Row A Clones from BMMS 50 µg/ml Zeo Row C Clones from BMMS 150 µg/ml Zeo Lane 1D 1F GFP expressing strain ( control) Lane 4D 4F P. pastoris HNL single copy strain (+ control) Lane 8D 8F P. pastoris HNL multi copy strain (+ control)

Hydroxynitrile lyase (Hnl)

Hydroxynitrile lyase (Hnl) Hydroxynitrile lyase (Hnl) R 1 HCN R 1 OH R 2 C O R 2 C * CN S-selective: Hevea brasiliensis R-selective: Prunus spp. (S)-Hnl of Hevea brasiliensis and (R)-Hnl of Prunus amygdalus Hb_Hnl Type II Hnl intracellular

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Expression Systems for Peptide Production

Expression Systems for Peptide Production Expression Systems for Peptide Production Susanna Leong School of Chemical and Biomedical Engineering, Nanyang Technological University, Singapore CBAS, 17-19 July 2007 (Source: Lonza Ltd., Basel, Switzerland)

More information

STOP. Before using this product, please read the Limited Use License statement below:

STOP. Before using this product, please read the Limited Use License statement below: STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-rgfap The purchase of the pdrive5lucia-rgfap vector conveys

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Before opening this package, please read the Limited Use License statement below:

Before opening this package, please read the Limited Use License statement below: STOP Before opening this package, please read the Limited Use License statement below: Important Limited Use License information for pcpgfree-ova The purchase of the pcpgfree-ova vector conveys to the

More information

How To Understand How Gene Expression Is Regulated

How To Understand How Gene Expression Is Regulated What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

Bacillus Subtilis Expression Vectors. Product Information and Instructions November 2005

Bacillus Subtilis Expression Vectors. Product Information and Instructions November 2005 Bacillus Subtilis Expression Vectors Product Information and Instructions November 2005 1 Content 1. Introduction... 3 2. The pht Vectors...4 2.1. Vector Map pht01...4 2.2. Vector Map pht43...5 2.3. Location

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

pfusen-hg1e2fc Plasmid designed for the fusion of an Fc domain to the N-terminus of a protein of interest Catalog # pfcn-hg1e2

pfusen-hg1e2fc Plasmid designed for the fusion of an Fc domain to the N-terminus of a protein of interest Catalog # pfcn-hg1e2 pfusen-hg1e2fc Plasmid designed for the fusion of an Fc domain to the N-terminus of a protein of interest Catalog # pfcn-hg1e2 For research use only Version # 13H28-JC-35 ProduCt information Content: -

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM

pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM PrOduct information content: - 20 mg of lyophilized pmod2-puro plasmid

More information

Chlamydomonas adapted Green Fluorescent Protein (CrGFP)

Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Plasmid pfcrgfp for fusion proteins Sequence of the CrGFP In the sequence below, all amino acids which have been altered from the wildtype GFP from

More information

Anti-ATF6 α antibody, mouse monoclonal (1-7)

Anti-ATF6 α antibody, mouse monoclonal (1-7) Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

PROTEIN EXPRESSION & PURIFICATION. library prep for next gen sequencing Protein Expression & Analysis

PROTEIN EXPRESSION & PURIFICATION. library prep for next gen sequencing Protein Expression & Analysis PROTEIN EXPRESSION & PURIFICATION DNA Cloning DNA AMPLIFICATION & PCR epigenetics RNA ANALYSIS library prep for next gen sequencing Expression & Analysis Cellular Analysis Update 2013 PROTEIN EXPRESSION

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Induction of Enzyme Activity in Bacteria:The Lac Operon. Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions

Induction of Enzyme Activity in Bacteria:The Lac Operon. Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions Induction of Enzyme Activity in Bacteria:The Lac Operon Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions I. Background: For the last week you explored the functioning of the enzyme

More information

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Bacterial Transformation and Plasmid Purification. Chapter 5: Background Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production

More information

from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of:

from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of: 9 Production of Proteins from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of: the reasons for producing proteins from cloned genes some of the more common

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Methods for Protein Analysis

Methods for Protein Analysis Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Question 4 /29 points. Total /100 points

Question 4 /29 points. Total /100 points MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question

More information

Molecular Biology. Yeast Transformation. Yeast Plasmids. Gene Disruption, tagging. Cloning by Complementation. Epistasis

Molecular Biology. Yeast Transformation. Yeast Plasmids. Gene Disruption, tagging. Cloning by Complementation. Epistasis Molecular Biology Yeast Transformation Yeast Plasmids Gene Disruption, tagging Cloning by Complementation Epistasis Transformation Transformation: introduction of DNA 1978, ca 1000x less efficient than

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH

Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies

More information

Introduction to Bioprocessing

Introduction to Bioprocessing Introduction to Bioprocessing Cambridge Healthtech Institute Peptalk Palm Springs, CA Presented by Susan Dana Jones and Sheila Magil BioProcess Technology Consultants www.bptc.com BioProcess Technology

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Approaches that can be used to study expression of specific proteins

Approaches that can be used to study expression of specific proteins Approaches that can be used to study expression of specific proteins Receptors and transporters Homogenate binding studies Receptor autoradiography Radiochemical Western blotting Immunohistochemistry/cytochemistry

More information

Using chromosomal laci Q1 to control. high copy number plasmids in Escherichia coli. Weickert; Gene 223; 1998 : 221 231

Using chromosomal laci Q1 to control. high copy number plasmids in Escherichia coli. Weickert; Gene 223; 1998 : 221 231 Using chromosomal laci Q1 to control expression of genes on high copy number plasmids in Escherichia coli Christopher B Glascock Michael J Christopher B. Glascock, Michael J. Weickert; Gene 223; 1998 :

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Production of Recombinant Proteins

Production of Recombinant Proteins Production of Recombinant Proteins Novel Microbial and Eukaryotic Expression Systems Edited by Cerd Gellissen ibiiothsk Bioiogio } k»v-nr ^ ^»>* IXI» i,,niii;i, WILEY- VCH WILEY-VCH Verlag GmbH & Co. KGaA

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein

More information

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1 SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5

More information

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western).

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Western Blot SOP Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Date: 8/16/05, 10/31/05, 2/6/06 Author: N.Oganesyan, R. Kim Edited by: R. Kim Summary:

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,

More information

Bernard R.GIick Jack J. Pasternak Department of Biology, University of Waterloo Waterloo, Ontario, Canada

Bernard R.GIick Jack J. Pasternak Department of Biology, University of Waterloo Waterloo, Ontario, Canada THIRD EDITION Bernard R.GIick Jack J. Pasternak Department of Biology, University of Waterloo Waterloo, Ontario, Canada ASM PRESS WASHINGTON, D.C. Contents Preface xix Preface to the First Edition xxi

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Pure-IP Western Blot Detection Kit

Pure-IP Western Blot Detection Kit Product Manual Pure-IP Western Blot Detection Kit Catalog Number PRB-5002 20 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The technique of immunoprecipitation (IP) is used

More information

R. Landstorfer et al. BMC Genomics, 2014. Audrey Segura

R. Landstorfer et al. BMC Genomics, 2014. Audrey Segura Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 under eleven different environmental conditions including radish sprouts and cattle feces R. Landstorfer

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Zeocin Selection Reagent

Zeocin Selection Reagent USER GUIDE Zeocin Selection Reagent Catalog nos. R250-01, R250-05 Revision date 19 January 2012 Publication Part number 25-0078 MAN0000019 For Research Use Only. Not intended for any animal or human therapeutic

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Plasmid DNA, Gel Extraction & PCR Products Purification Kits. Code Description Size. BS363 EZ-10 Spin Column PCR Products Purification Kit 50 preps

Plasmid DNA, Gel Extraction & PCR Products Purification Kits. Code Description Size. BS363 EZ-10 Spin Column PCR Products Purification Kit 50 preps Plasmid DNA, Gel Extraction & PCR Products Purification Kits Code Description Size BS363 EZ-10 Spin Column PCR Products Purification Kit BS364 EZ-10 Spin Column PCR Products Purification Kit 100 preps

More information

INDUSTRIAL BIOTECHNOLOGY. Production hosts for real-life feedstock utilization

INDUSTRIAL BIOTECHNOLOGY. Production hosts for real-life feedstock utilization Selection of production hosts for real-life feedstock utilization Karl Rumbold ([email protected]) INDUSTRIAL BIOTECHNOLOGY Industrial Biotechnology is the application of biotechnology for the processing

More information

Luca Romagnoli, Ph.D. Business Development Manager

Luca Romagnoli, Ph.D. Business Development Manager Modelli innovativi di produzione per lo sviluppo di un processo altamente qualitativo di farmaci biologici Luca Romagnoli, Ph.D. Business Development Manager BIOLOGICAL DRUGS - SOURCES Monoclonal antibodies

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question. Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists

More information

Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD

Design high specificity CRISPR-Cas9 grnas: principles and tools. Heidi Huang, PhD Design high specificity CRISPR-Cas9 grnas: principles and tools Heidi Huang, PhD Webinar Agenda 1 2 3 4 Introduction of CRISPR-Cas9 grna Design Resources and Services Q&A 2 What is CRISPR? CRISPR Clustered

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

Pharmacology Curriculum Transition. 1990-Present

Pharmacology Curriculum Transition. 1990-Present Pharmacology Curriculum Transition 1990-Present Curriculum ~1990 Introductory Biochemistry Biology of Bacteria and Mammalian Cells Human Physiology General and Special Pharmacology Advanced Pharmacology

More information

Chapter 3. Protein Structure and Function

Chapter 3. Protein Structure and Function Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2012 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation

More information

Molecular Cloning, Product Brochure

Molecular Cloning, Product Brochure , Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

www.biochemj.org/bj/330/0581/bj3300581.htm

www.biochemj.org/bj/330/0581/bj3300581.htm Ribosomes as Antibiotic Targets www.biochemj.org/bj/330/0581/bj3300581.htm Ware, Bioscience in the 21 st Century, 2009 PERSPECTIVE Widespread use of antibiotics after WWII improved human health globally

More information

WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE

WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TIPS FOR SUCCESSFUL WESTERB BLOTS TROUBLESHOOTING GUIDE 1. Suboptimal protein transfer. This is the most common complaint with western blotting and could

More information

Proteomics Research with BIOCHAIN

Proteomics Research with BIOCHAIN Proteomics Research with IOCHIN Protein Extraction CNMCS Compartmental Protein Extraction Kit Cytoplasmic, Nuclear, Membrane, and Cytoskeleton Protein One kit isolates four different proteins sequentially

More information

pselect-gfp-lc3 A mammalian expression plasmid containing the human LC3B gene fused at 5 end to the GFP gene

pselect-gfp-lc3 A mammalian expression plasmid containing the human LC3B gene fused at 5 end to the GFP gene pselect-gfp-lc3 A mammalian expression plasmid containing the human LC3B gene fused at 5 end to the GFP gene Catalog # psetz-gfplc3 For research use only Version # 10K02-MM ProduCt information Content:

More information

Protein Synthesis and Purification: Microbial Versus Mammalian Systems

Protein Synthesis and Purification: Microbial Versus Mammalian Systems STREAMLINING RECOMBINANT PROTEIN PRODUCTION The pharmaceutical industry is undergoing a deep transformation from small molecule drugs to biologics. Over the last decade, the percentage share of biologic-based

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Assembly of Restriction Enzyme Digestions

Assembly of Restriction Enzyme Digestions TECHNICAL MANUAL Assembly of Restriction Enzyme Digestions 12/11 TM367 Assembly of Restriction Enzyme Digestions All technical literature is available at: www.promega.com/protocols/ Visit the web site

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

A. 'Hypersensitive' peptide bonds and autodegradation of proteins

A. 'Hypersensitive' peptide bonds and autodegradation of proteins ABSTRACT A. 'Hypersensitive' peptide bonds and autodegradation of proteins Several pure proteins, which gave a single band on electrophoretic analysis, when stored for a long time, were found to be partially

More information

Shop! VWRBiosciences,more than just a helping hand

Shop! VWRBiosciences,more than just a helping hand section line 2 BioSciences section line 1 VWRBiosciences,more than just a helping hand Proteomics round-up What can we offer? In today s world of discovery, technology is critical to a better understanding

More information

Cell Biology Questions and Learning Objectives

Cell Biology Questions and Learning Objectives Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate

More information