hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1

Transcription

1 SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1 were produced in our laboratory (Abrami et al., 2008). Anti-MEK2 (Santa Cruz BT), anti-tubulin (Roche), anti-actin (Millipore), protein G-agarose conjugated beads (GE Healthcare). Anti-MKK3 (Santa Cruz Biotechnology), HRP secondary antibodies (Pierce) were purchased. Anti-LBPA (used at 100 µg/ml for 24 hrs in complete medium), anti-alix, anti-tsg101 antibodies were a gift from J. Gruenberg (Univ. Geneva, Switzerland). Radiolabeling experiments For metabolic labeling, RPE1 cells were washed with methionine /cysteine free medium, incubated different times of pulse at 37 C with 70 µci/ml 35 S-methionine/cysteine (Hartman Analytic), washed and further incubated for different times at 37 C in complete medium with a 10-fold excess of non-radioactive methionine and cysteine. MKK3 were immunoprecipitated with anti MKK3-C antibodies and analyzed by SDS-PAGE. LEGENDS FOR SUPPLEMENTARY FIGURES 1

2 Figure S1: Nocodazole and SNX3 sensitivity of LF degradation. Related to Figure 2. RPE1 cells were transfected with sirna against SNX3 or VSVG as a control (Ctrl) for 3 days before the addition of 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for several hours. Some cells were pretreated with 10 µm nocodazle for 2 hours before and during experiment. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal LF. LF levels were quantified using the Fusion Imager and normalized to the level of LF at 100% at 1 h post toxin treatment. Figure S2: Persistence of MAPKK cleavage over time. Related to Figure 3. A. RPE1 cells were incubated for 1 hour at 37 C with 500 ng/ml PA 83 and increasing concentrations of LF, as indicated, followed by toxin-free medium for 3, 5 and 7 days. PNS extracted from the samples (40µg) were analyzed by SDS-PAGE and Western blotting to reveal the N-terminal part of MEK1 (MEK1-N). B. HUVECs cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1 hour (day 0) or different days, as indicated. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal N-terminal part of MEK1 (MEK1-N), C-terminal part of MKK3 (MKK3-C), LF, and tubulin as an equal loading control. HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). 2

3 C. Western blot showing cleavage of MEK1 N-terminus in mouse heart at various times post PA + LF treatment (45 µg, intravenous). Figure S3: MAPKK synthesis and cleavage. Related to Figure 3. A. RPE1 cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1, 5, or 7 days. Levels of MEK1 or MKK3 RNA were analyzed by real time PCR and normalized to RNA levels of nontreated cells. B. RPE1 cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 4 days. MKK3 were immunoprecipitated after 20min 35 S-methionine/cysteine pulse and radioactivity was analyzed with Typhoon Imager. C-E. RPE1 cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1 day (C) or 5 days (D and E). Cells were washed with methionine /cysteine free medium, incubated different times of pulse at 37 C with 70 µci/ml 35 S-methionine/cysteine (Hartman Analytic), washed and further incubated for different times at 37 C in complete medium with a 10-fold excess of non-radioactive methionine and cysteine. MKK3 were immunoprecipitated after 1 or 2 hours with anti MKK3-C antibodies and analyzed by SDS-PAGE. Radioactivity was analyzed with Typhoon Imager or revealed by Western blotting with anti-mkk3-c antibodies. In E, the amount of radioactivity of cleaved MKK3 was quantified with Typhoon Imager and compared to the levels of full-length form of MKK3. Mean ± SD of 4 experiments. 3

4 In these experiments, we compared 35 S-labeled MKK3 at day 1, when LF is still detectable by western blotting, to day 5, when LF is undetectable (Fig. 3A and S3CD). In the absence of toxin, immunoprecipitation against MKK3 brings down two isoforms, MKK3a (36 kda) and MKK3b (39 kda) (Vitale et al., 2000) (Fig. S3CD). Only MKK3b is sensitive to LF-mediated proteolysis because MKK3a does not contain the required N- terminal cleavage site. Exposure to LT during the pulse led to an increase in the level of the lower-molecular-weight 36-kDa band, which combines cleaved MKK3b and full length MMK3a (Fig. S3E) (Vitale et al., 2000). A very similar change in profile in control vs. toxin treated cells was observed at day 5 (Fig. S3DE) indicating that MKK3 underwent LF-mediated cleavage, and thus that LF is present in these cells at day 5, even though LF was undetectable by western blotting. Figure S4: Related to figures 3 and 6 A. RPE1 cells were exposed or not to 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C and then incubated in toxin-free medium. At day3 post toxin treatment (left panel), cells were transfected or not with sirna against Dynamin 1 and 2 or VSVG as a control (Ctrl). At day 5, PNSs were extracted and analyzed by SDS-PAGE (40 µg of protein per lane), followed by Western blotting against MEK1-N, MKK3-C, and actin as an equal loading control. In the right panel, RPE1 cells were transfected with sirna against dynamin 1 and 2 or VSVG as a control (Ctrl) for 3 days before the addition of 500 ng/ml of PA 83 and 25 ng/ml of LF for 75 minutes. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal MEK1-N, MKK3-C, and actin as an equal loading control. In the bottom panel, RPE1 cells were transfected with sirna against 4

5 Dynamin 1 and 2 or VSVG as a control (-). After 1 day, non-treated RPE1 cells were incubated with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1 day. After 1 day, the Conditioned Medium (CM) from RPE1 cells was collected and incubated on different days dynamin sirna transfected RPE1 cells. After 1 day of incubation, PNS extracted from the samples (40 µg) were analyzed by SDS-PAGE and Western blotting against MEK1-N and MKK3-C. B. RPE1 cells were incubated or not (-) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for an additional 0, 6, or 8 hours. Some RPE1 cells were pretreated 2 hours before toxin addition with 100 nm Bafilomycin A (Baf A). After toxin treatment, some cells were incubated at room temperature for 5 min with acid buffer at ph 4.5 to allow toxin entry from the plasma membrane (acid). PNS extracted from the samples (40 µg) were analyzed by SDS-PAGE and Western blotting against LF, MEK1-N, and actin as an equal loading control. MEK1-N levels were quantified using the Typhoon scanner and normalized to 100% with non-treated cells. Figure S5: Effect of bafilomycin A treatment on MAPKK recovery. Related to Figure 4B HUVECs cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 4 days. At day 4, 100 nm of Bafilomycin A was added to the cells in complete medium, and cell extracts were prepared after 18 hours. PNS extracted from the samples (40 µg) were analyzed by SDS- 5

6 PAGE and Western blotting against MEK1-N, MKK3-C, and tubulin as an equal loading control. Figure S6: Rab GTPase silencing and effects on cellular LF levels. Related to Figure 6. A.B. RPE1 cells were transfected with sirna against Rab11, Rab27a, Rab35, or VSVG as a control (Ctrl) for 3 days before the addition of 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for several hours. A. The levels of mrna for Rab11, Rab27s, or Rab 35 were analyzed by real-time qpcr. B. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal LF. LF levels were quantified using the Fusion Imager and normalized to the level of LF at 100% at 1h post toxin treatment. C. Based on the data in Figure 1B, the % of LF that was rescued by MG132 treatment was calculated at different time points. D. The levels of LF between control cells and cells silenced for rab35 (n=2) or rab11 (n=1) were compared by western blotting at different time points and the % of LF retained in cells by Rab silencing was determined. Figure S7. Cell division during the time courses of the experiments described inthis study. Related to the discussion. At day 1, RPE1 cells were incubated with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium. The number of RPE1 cells was counted on the indicated days, N=3. 6

7 Table S1: Target sequences of the sirnais presented inthis study. Related to Figures 2, 3, 4 and 6. Gene Name Target sequence (5-3 ) Alix Dynamin 1 Dynamin 2 p14 Rab11 Rab27a Rab27b Rab35 SNX3 Tsg101 VSVG Tsg101 p14 aagagcctgtgtgttgttcaat gaaggatatcacagccgccta cccggccatattaaccacaca aaggagaccgtgggctttgga taggcattgtagagatctgaa cccattagacctacgaataaa accgaatcttcagggaa agggtgtgcttgcaaattcaa aacaagggctggagcagttta cagtttatcattcaagtgtaa attgaacaaacgaaacaagga cagtttatcattcaagtgtaa aaggagaccgtgggctttgga REFERENCES Abrami, L., Kunz, B., Iacovache, I., and van der Goot, F.G. (2008). Palmitoylation and ubiquitination regulate exit of the Wnt signaling protein LRP6 from the endoplasmic reticulum. Proceedings of the National Academy of Sciences of the United States of America 105, Vitale, G., Bernardi, L., Napolitani, G., Mock, M., and Montecucco, C. (2000). Susceptibility of mitogen-activated protein kinase kinase family members to proteolysis by anthrax lethal factor. Biochem J 352 Pt 3,

8 % of t=1hr! Abrami et al. Figure S1!

9 Abrami et al. Figure S2! A! LF! 0! 1! 5! 10! 25! ng/ml! Day 3! Day 5! Day 7! B! Time (days) p.t.t.! Ctrl! 0! 1! 2! 5! 6! 7! 8! days! LF! MKK3-C! RPE1 Cells! Tubulin! HUVECs! C! PA+LF! LF! NT 24h 48h 76h 24h 48h 76h! Mouse heart!

10 Abrami et al. Figure S3! A! MEK1! MKK3! B! Full length MKK3! MKK3 synthesis (a.u.)! Ctrl! +Toxin! C! day 1 p.t.t.! Ctrl! +Tox! Hrs pulse! Hrs pulse! 1! 2! 1! 2! Autoradio.! Autoradio.! IP: MKK3! day 5 p.t.t.! Ctrl! +Tox.! 1! 2! 1! 2! IP: MKK3! day 5 p.t.t.!

11 Abrami et al. Figure S4! A! Dynamin 1&2 sirna! days! 1! 1! 4! 5! 6! 7! 8! 8! Toxin! -! +! +! +! +! +! +! -! MKK3-C! Actin! days 1and 4 p.t.t.! MKK3-C! Actin! +Tox! +Tox! Ctrl! +sirna! 3 days before toxin! + Conditioned medium! sirna! Dynam.1&2! days! 1! 1! 1! 4! 5! 6! 7! 8! -! -! +! +! +! +! +! +! MKK3-C! +sirna in naïve cells 3 days! before addition of CM! B! BafA! Acid! hrs! -! 1! 7! 9! -! 1! 7! 9! LF! Actin! % of MEK1! -! 1! 7! 9! -! 1! 7! 9! Time (hrs)!

12 Abrami et al. Figure S5! Toxin! Ctrl! + 18hrs BafA! -! +! -! +! MKK3-C! Tubulin! day 4 p.t.t!

13 Abrami et al. Figure S6! A! C! B! % of t=1hr! % of LF retained by Rab sirna! % of LF rescued by MG132! D!

14 A! Abrami et al. Figure S7!