hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1

Size: px
Start display at page:

Download "hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1"

Transcription

1 SUPPLEMENTARY METHODS Cells HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1 were produced in our laboratory (Abrami et al., 2008). Anti-MEK2 (Santa Cruz BT), anti-tubulin (Roche), anti-actin (Millipore), protein G-agarose conjugated beads (GE Healthcare). Anti-MKK3 (Santa Cruz Biotechnology), HRP secondary antibodies (Pierce) were purchased. Anti-LBPA (used at 100 µg/ml for 24 hrs in complete medium), anti-alix, anti-tsg101 antibodies were a gift from J. Gruenberg (Univ. Geneva, Switzerland). Radiolabeling experiments For metabolic labeling, RPE1 cells were washed with methionine /cysteine free medium, incubated different times of pulse at 37 C with 70 µci/ml 35 S-methionine/cysteine (Hartman Analytic), washed and further incubated for different times at 37 C in complete medium with a 10-fold excess of non-radioactive methionine and cysteine. MKK3 were immunoprecipitated with anti MKK3-C antibodies and analyzed by SDS-PAGE. LEGENDS FOR SUPPLEMENTARY FIGURES 1

2 Figure S1: Nocodazole and SNX3 sensitivity of LF degradation. Related to Figure 2. RPE1 cells were transfected with sirna against SNX3 or VSVG as a control (Ctrl) for 3 days before the addition of 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for several hours. Some cells were pretreated with 10 µm nocodazle for 2 hours before and during experiment. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal LF. LF levels were quantified using the Fusion Imager and normalized to the level of LF at 100% at 1 h post toxin treatment. Figure S2: Persistence of MAPKK cleavage over time. Related to Figure 3. A. RPE1 cells were incubated for 1 hour at 37 C with 500 ng/ml PA 83 and increasing concentrations of LF, as indicated, followed by toxin-free medium for 3, 5 and 7 days. PNS extracted from the samples (40µg) were analyzed by SDS-PAGE and Western blotting to reveal the N-terminal part of MEK1 (MEK1-N). B. HUVECs cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1 hour (day 0) or different days, as indicated. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal N-terminal part of MEK1 (MEK1-N), C-terminal part of MKK3 (MKK3-C), LF, and tubulin as an equal loading control. HUVEC (Human Umbilical Vein Endothelial Cells) were grown in complete Medium 199 (Gibco) supplemented with glutamax, 10% foetal calf serum, BBE (9 mg/ml), hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). 2

3 C. Western blot showing cleavage of MEK1 N-terminus in mouse heart at various times post PA + LF treatment (45 µg, intravenous). Figure S3: MAPKK synthesis and cleavage. Related to Figure 3. A. RPE1 cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1, 5, or 7 days. Levels of MEK1 or MKK3 RNA were analyzed by real time PCR and normalized to RNA levels of nontreated cells. B. RPE1 cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 4 days. MKK3 were immunoprecipitated after 20min 35 S-methionine/cysteine pulse and radioactivity was analyzed with Typhoon Imager. C-E. RPE1 cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1 day (C) or 5 days (D and E). Cells were washed with methionine /cysteine free medium, incubated different times of pulse at 37 C with 70 µci/ml 35 S-methionine/cysteine (Hartman Analytic), washed and further incubated for different times at 37 C in complete medium with a 10-fold excess of non-radioactive methionine and cysteine. MKK3 were immunoprecipitated after 1 or 2 hours with anti MKK3-C antibodies and analyzed by SDS-PAGE. Radioactivity was analyzed with Typhoon Imager or revealed by Western blotting with anti-mkk3-c antibodies. In E, the amount of radioactivity of cleaved MKK3 was quantified with Typhoon Imager and compared to the levels of full-length form of MKK3. Mean ± SD of 4 experiments. 3

4 In these experiments, we compared 35 S-labeled MKK3 at day 1, when LF is still detectable by western blotting, to day 5, when LF is undetectable (Fig. 3A and S3CD). In the absence of toxin, immunoprecipitation against MKK3 brings down two isoforms, MKK3a (36 kda) and MKK3b (39 kda) (Vitale et al., 2000) (Fig. S3CD). Only MKK3b is sensitive to LF-mediated proteolysis because MKK3a does not contain the required N- terminal cleavage site. Exposure to LT during the pulse led to an increase in the level of the lower-molecular-weight 36-kDa band, which combines cleaved MKK3b and full length MMK3a (Fig. S3E) (Vitale et al., 2000). A very similar change in profile in control vs. toxin treated cells was observed at day 5 (Fig. S3DE) indicating that MKK3 underwent LF-mediated cleavage, and thus that LF is present in these cells at day 5, even though LF was undetectable by western blotting. Figure S4: Related to figures 3 and 6 A. RPE1 cells were exposed or not to 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C and then incubated in toxin-free medium. At day3 post toxin treatment (left panel), cells were transfected or not with sirna against Dynamin 1 and 2 or VSVG as a control (Ctrl). At day 5, PNSs were extracted and analyzed by SDS-PAGE (40 µg of protein per lane), followed by Western blotting against MEK1-N, MKK3-C, and actin as an equal loading control. In the right panel, RPE1 cells were transfected with sirna against dynamin 1 and 2 or VSVG as a control (Ctrl) for 3 days before the addition of 500 ng/ml of PA 83 and 25 ng/ml of LF for 75 minutes. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal MEK1-N, MKK3-C, and actin as an equal loading control. In the bottom panel, RPE1 cells were transfected with sirna against 4

5 Dynamin 1 and 2 or VSVG as a control (-). After 1 day, non-treated RPE1 cells were incubated with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 1 day. After 1 day, the Conditioned Medium (CM) from RPE1 cells was collected and incubated on different days dynamin sirna transfected RPE1 cells. After 1 day of incubation, PNS extracted from the samples (40 µg) were analyzed by SDS-PAGE and Western blotting against MEK1-N and MKK3-C. B. RPE1 cells were incubated or not (-) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for an additional 0, 6, or 8 hours. Some RPE1 cells were pretreated 2 hours before toxin addition with 100 nm Bafilomycin A (Baf A). After toxin treatment, some cells were incubated at room temperature for 5 min with acid buffer at ph 4.5 to allow toxin entry from the plasma membrane (acid). PNS extracted from the samples (40 µg) were analyzed by SDS-PAGE and Western blotting against LF, MEK1-N, and actin as an equal loading control. MEK1-N levels were quantified using the Typhoon scanner and normalized to 100% with non-treated cells. Figure S5: Effect of bafilomycin A treatment on MAPKK recovery. Related to Figure 4B HUVECs cells were incubated or not (Ctrl) with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for 4 days. At day 4, 100 nm of Bafilomycin A was added to the cells in complete medium, and cell extracts were prepared after 18 hours. PNS extracted from the samples (40 µg) were analyzed by SDS- 5

6 PAGE and Western blotting against MEK1-N, MKK3-C, and tubulin as an equal loading control. Figure S6: Rab GTPase silencing and effects on cellular LF levels. Related to Figure 6. A.B. RPE1 cells were transfected with sirna against Rab11, Rab27a, Rab35, or VSVG as a control (Ctrl) for 3 days before the addition of 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium for several hours. A. The levels of mrna for Rab11, Rab27s, or Rab 35 were analyzed by real-time qpcr. B. The isolated PNSs (40 µg) were analyzed by SDS-PAGE and Western blotting to reveal LF. LF levels were quantified using the Fusion Imager and normalized to the level of LF at 100% at 1h post toxin treatment. C. Based on the data in Figure 1B, the % of LF that was rescued by MG132 treatment was calculated at different time points. D. The levels of LF between control cells and cells silenced for rab35 (n=2) or rab11 (n=1) were compared by western blotting at different time points and the % of LF retained in cells by Rab silencing was determined. Figure S7. Cell division during the time courses of the experiments described inthis study. Related to the discussion. At day 1, RPE1 cells were incubated with 500 ng/ml of PA 83 and 25 ng/ml of LF for 1 hour at 37 C, followed by toxin-free medium. The number of RPE1 cells was counted on the indicated days, N=3. 6

7 Table S1: Target sequences of the sirnais presented inthis study. Related to Figures 2, 3, 4 and 6. Gene Name Target sequence (5-3 ) Alix Dynamin 1 Dynamin 2 p14 Rab11 Rab27a Rab27b Rab35 SNX3 Tsg101 VSVG Tsg101 p14 aagagcctgtgtgttgttcaat gaaggatatcacagccgccta cccggccatattaaccacaca aaggagaccgtgggctttgga taggcattgtagagatctgaa cccattagacctacgaataaa accgaatcttcagggaa agggtgtgcttgcaaattcaa aacaagggctggagcagttta cagtttatcattcaagtgtaa attgaacaaacgaaacaagga cagtttatcattcaagtgtaa aaggagaccgtgggctttgga REFERENCES Abrami, L., Kunz, B., Iacovache, I., and van der Goot, F.G. (2008). Palmitoylation and ubiquitination regulate exit of the Wnt signaling protein LRP6 from the endoplasmic reticulum. Proceedings of the National Academy of Sciences of the United States of America 105, Vitale, G., Bernardi, L., Napolitani, G., Mock, M., and Montecucco, C. (2000). Susceptibility of mitogen-activated protein kinase kinase family members to proteolysis by anthrax lethal factor. Biochem J 352 Pt 3,

8 % of t=1hr! Abrami et al. Figure S1!

9 Abrami et al. Figure S2! A! LF! 0! 1! 5! 10! 25! ng/ml! Day 3! Day 5! Day 7! B! Time (days) p.t.t.! Ctrl! 0! 1! 2! 5! 6! 7! 8! days! LF! MKK3-C! RPE1 Cells! Tubulin! HUVECs! C! PA+LF! LF! NT 24h 48h 76h 24h 48h 76h! Mouse heart!

10 Abrami et al. Figure S3! A! MEK1! MKK3! B! Full length MKK3! MKK3 synthesis (a.u.)! Ctrl! +Toxin! C! day 1 p.t.t.! Ctrl! +Tox! Hrs pulse! Hrs pulse! 1! 2! 1! 2! Autoradio.! Autoradio.! IP: MKK3! day 5 p.t.t.! Ctrl! +Tox.! 1! 2! 1! 2! IP: MKK3! day 5 p.t.t.!

11 Abrami et al. Figure S4! A! Dynamin 1&2 sirna! days! 1! 1! 4! 5! 6! 7! 8! 8! Toxin! -! +! +! +! +! +! +! -! MKK3-C! Actin! days 1and 4 p.t.t.! MKK3-C! Actin! +Tox! +Tox! Ctrl! +sirna! 3 days before toxin! + Conditioned medium! sirna! Dynam.1&2! days! 1! 1! 1! 4! 5! 6! 7! 8! -! -! +! +! +! +! +! +! MKK3-C! +sirna in naïve cells 3 days! before addition of CM! B! BafA! Acid! hrs! -! 1! 7! 9! -! 1! 7! 9! LF! Actin! % of MEK1! -! 1! 7! 9! -! 1! 7! 9! Time (hrs)!

12 Abrami et al. Figure S5! Toxin! Ctrl! + 18hrs BafA! -! +! -! +! MKK3-C! Tubulin! day 4 p.t.t!

13 Abrami et al. Figure S6! A! C! B! % of t=1hr! % of LF retained by Rab sirna! % of LF rescued by MG132! D!

14 A! Abrami et al. Figure S7!

Anti-ATF6 α antibody, mouse monoclonal (1-7)

Anti-ATF6 α antibody, mouse monoclonal (1-7) Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.

More information

Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1

Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1 Supporting Online Material for Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1 Birgit Schulze, Tobias Mentzel, Anna Jehle,

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Pure-IP Western Blot Detection Kit

Pure-IP Western Blot Detection Kit Product Manual Pure-IP Western Blot Detection Kit Catalog Number PRB-5002 20 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The technique of immunoprecipitation (IP) is used

More information

Figure S1. SDS-PAGE of purified rtmd proteins Figure S2. rtmd1 interferes with chemotaxis of HUVECs induced by rtmd23

Figure S1. SDS-PAGE of purified rtmd proteins Figure S2. rtmd1 interferes with chemotaxis of HUVECs induced by rtmd23 Figure S1. SDS-PAGE of purified rtmd proteins SDS-polyacrylamide gel electrophoresis was performed using a 10% separation gel. One microgram of each rtmd protein was applied. Detection was performed with

More information

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western).

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Western Blot SOP Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Date: 8/16/05, 10/31/05, 2/6/06 Author: N.Oganesyan, R. Kim Edited by: R. Kim Summary:

More information

General western blot protocol. Guidance for running an efficient and accurate experiment

General western blot protocol. Guidance for running an efficient and accurate experiment blot protocol Guidance for running an efficient and accurate experiment Contents Introduction Solution and reagents Sample lysis Sample preparation Loading and running the gel Antibody staining Useful

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN

EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN DATA SUPPLEMENT EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN EARLY SQUAMOUS CELL CARCINOMA OF THE LUNG María J. Pajares et al. PATIENTS

More information

Methods for Protein Analysis

Methods for Protein Analysis Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates

More information

About the Kits...2 Description 2 Components 2

About the Kits...2 Description 2 Components 2 Table of Contents About the Kits...2 Description 2 Components 2 Thrombin Cleavage...3 Small scale optimization 3 Scale-up 4 Factors that affect thrombin activity 4 Monitoring cleavage 5 Biotinylated Thrombin

More information

The Journal of Experimental Medicine

The Journal of Experimental Medicine [ID]FIGS1[/ID] [ID]FIGS2[/ID] [ID]FIGS3[/ID] [ID]FIGS4[/ID] [ID]FIGS5[/ID] [ID]FIGS6[/ID] [ID]TBLS1[/ID] [ID]TBLS2[/ID] SUPPLEMENTAL MATERIAL Wolf et al., http://www.jem.org/cgi/content/full/jem.20101470/dc1

More information

Angelo Peschiaroli, N. Valerio Dorrello, Daniele Guardavaccaro, Monica Venere, Thanos Halazonetis, Nicholas E. Sherman, and Michele Pagano

Angelo Peschiaroli, N. Valerio Dorrello, Daniele Guardavaccaro, Monica Venere, Thanos Halazonetis, Nicholas E. Sherman, and Michele Pagano Molecular Cell, Volume 23 Supplemental Data SCF βtrcp -Mediated Degradation of Claspin Regulates Recovery from the DNA Replication Checkpoint Response Angelo Peschiaroli, N. Valerio Dorrello, Daniele Guardavaccaro,

More information

APPLICATION FOCUS. Application Solutions for Western Blotting

APPLICATION FOCUS. Application Solutions for Western Blotting APPLICATION FOCUS Application Solutions for Western Blotting WESTERN BLOTTING Companion Products Solutions for consistently better blotting. Companion products from Cell Signaling Technology (CST) are

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE

WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TIPS FOR SUCCESSFUL WESTERB BLOTS TROUBLESHOOTING GUIDE 1. Suboptimal protein transfer. This is the most common complaint with western blotting and could

More information

THE JOURNAL OF CELL BIOLOGY

THE JOURNAL OF CELL BIOLOGY Supplemental Material Goldoni et al., http://www.jcb.org/cgi/content/full/jcb.200901129/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Specific high affinity interaction between decorin and Met-Fc. (A) Ligand-binding

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Service and Price Mouse Monoclonal Antibody Service Package Number Description Package Contents Time Price Customer provides antigen protein $6,174 Monoclonal package1 (From protein

More information

ab185915 Protein Sumoylation Assay Ultra Kit

ab185915 Protein Sumoylation Assay Ultra Kit ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic

More information

Supplemental Material. Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks

Supplemental Material. Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks Supplemental Material Paradoxical association of enhanced cholesterol efflux with increased incident cardiovascular risks Xin-Min Li, PhD 1, W. H. Wilson Tang, MD 1,2, Marian K. Mosior, PhD 3, Ying Huang,

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

Protocol for Western Blotting

Protocol for Western Blotting Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol

More information

P4 Distribution of Cetuximab in Models of Human Lung Cancer

P4 Distribution of Cetuximab in Models of Human Lung Cancer Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, University of Tübingen, Robert Bosch Foundation Stuttgart, Germany FORSYS Partner Project Predictive Cancer Therapy Project Meeting 14.10.09

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. is involved at each stage of your project Mabsolus-2015-UK:Mise en page 1 03/07/15 14:13 Page1 Services provider Department of MABSolys from conception to validation MAB Solut is involved at each stage of your project Creation of antibodies Production

More information

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical

More information

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation

CUSTOM ANTIBODIES. Fully customised services: rat and murine monoclonals, rat and rabbit polyclonals, antibody characterisation, antigen preparation CUSTOM ANTIBODIES Highly competitive pricing without compromising quality. Rat monoclonal antibodies for the study of gene expression and proteomics in mice and in mouse models of human diseases available.

More information

The F Box Protein Fbx6 Regulates Chk1 Stability and Cellular Sensitivity to Replication Stress

The F Box Protein Fbx6 Regulates Chk1 Stability and Cellular Sensitivity to Replication Stress Molecular Cell, Volume 35 Supplemental Data The F Box Protein Fbx6 Regulates Chk1 Stability and Cellular Sensitivity to Replication Stress You-Wei Zhang, John Brognard, Chris Coughlin, Zhongsheng You,

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 www.mitosciences.com

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 www.mitosciences.com PROTOCOL Western Blotting Transfer and Detection Procedure 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 02-11 DESCRIPTION Western Blotting Transfer and Detection Procedure ADDITIONAL MATERIALS REQUIRED

More information

TITLE: Treatment of Prostate Cancer with a DBP-MAF-Vitamin D Complex to Target Angiogenesis and Tumorigenesis

TITLE: Treatment of Prostate Cancer with a DBP-MAF-Vitamin D Complex to Target Angiogenesis and Tumorigenesis AD AWARD NUMBER: W81XWH-04-1-0010 TITLE: Treatment of Prostate Cancer with a DBP-MAF-Vitamin D Complex to Target Angiogenesis and Tumorigenesis PRINCIPAL INVESTIGATOR: Michael W. Fannon, Ph.D. CONTRACTING

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

Antibody Production Price List

Antibody Production Price List Antibody Production Price List Presenting Insight Biotechnology s price list for custom polyclonal and monoclonal antibody production services. We are happy to tailor individual packages towards the specific

More information

A. 'Hypersensitive' peptide bonds and autodegradation of proteins

A. 'Hypersensitive' peptide bonds and autodegradation of proteins ABSTRACT A. 'Hypersensitive' peptide bonds and autodegradation of proteins Several pure proteins, which gave a single band on electrophoretic analysis, when stored for a long time, were found to be partially

More information

ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015.

ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. Technical Manual ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. PRINTED IN USA. 6/09 ECL Western Blotting Substrate All technical literature is available on the Internet

More information

SUPPLEMENTARY DATA 1

SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut

More information

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Product Datasheet DARC Antibody NB100-2421 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb100-2421

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

Protein Purification and Analysis

Protein Purification and Analysis Protein Purification and Analysis Numbers of genes: Humans ~40,000 genes Yeast ~6000 genes Bacteria ~3000 genes Solubility of proteins important for purification: 60-80% soluble, 20-40% membrane Some proteins

More information

Methionine Sulfoxide Immunoblotting Kit

Methionine Sulfoxide Immunoblotting Kit Methionine Sulfoxide Immunoblotting Kit Item No. 600160 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

Supporting Information

Supporting Information Supporting Information Kondo et al. 1.173/pnas.787415 SI Methods Conventional and Quantitative RT-PCR. Total RNA was extracted from cultured ES cells or ES-derived cells using the RNeasy Minikit (Qiagen).

More information

Huntingtin Antibody AbVantage Pack

Huntingtin Antibody AbVantage Pack Huntingtin Antibody AbVantage Pack Produced in Rabbit Catalog No. A3-034A NP_00202.4 CONTENTS Rabbit anti-huntingtin A302-82A Rabbit anti-huntingtin A302-83A WB, IP REACTIVITY STORAGE / SHELF LIFE 2-8

More information

Western BLoT Immuno Booster

Western BLoT Immuno Booster Cat. # T7111A For Research Use Western BLoT Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Materials Required but Not Provided... 3 V. Precautions... 3 VI.

More information

MEF Starter Nucleofector Kit

MEF Starter Nucleofector Kit page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated

More information

Western Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com

Western Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com Western Blotting All steps are carried out at room temperature unless otherwise indicated. Recipes for all solutions highlighted bold are included at the end of the protocol. SDS-PAGE 1. Construct an SDS-PAGE

More information

Fluorescein Isothiocyanate (FITC)- conjugated Antibodies

Fluorescein Isothiocyanate (FITC)- conjugated Antibodies USER GUIDE Fluorescein Isothiocyanate (FITC)- conjugated Antibodies Catalog Numbers R933-25, R953-25, R963-25 Document Part Number 25-0376 Publication Number MAN0000194 Revision 2.0 For Research Use Only.

More information

INSTRUCTION MANUAL riboxx FECT

INSTRUCTION MANUAL riboxx FECT INSTRUCTION MANUAL sirna, mirna, and RNA Transfection Reagent Version 1.0 CONTENTS A. DESCRIPTION 1 B. SPECIFICATIONS 1 C. PROTOCOL 2 C.1 TRANSFECTION PROTOCOL FOR ADHERENT CELLS 2 C.2 TRANSFECTION PROTOCOL

More information

INSTRUCTION Probemaker

INSTRUCTION Probemaker INSTRUCTION Probemaker Instructions for Duolink In Situ Probemaker PLUS (Art. no. 92009-0020) and Duolink In Situ Probemaker MINUS (Art. no. 92010-0020) Table of content 1. Introduction 4 2. Applications

More information

sirna Duplexes & RNAi Explorer

sirna Duplexes & RNAi Explorer P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01

More information

Aviva Systems Biology

Aviva Systems Biology Aviva Custom Antibody Services and Prices Rabbit Polyclonal Antibody Service Package Number Description Package Contents Time Price Polyclonal package 1 (From protein to antiserum) Polyclonal package 2

More information

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating

More information

GASTRIC ORGANOID CULTURE PROTOCOL

GASTRIC ORGANOID CULTURE PROTOCOL GASTRIC ORGANOID CULTURE PROTOCOL THIS PROTOCOL PROVIDES THE PROCEDURE FOR SUBCULTURING NORMAL HUMAN GASTRIC ORGANOIDS WHICH WAS DERIVED FROM THE SUBMERGED METHOD AS DESCRIBED IN BARKER N, ET AL. LGR5+VE

More information

SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and

SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Supplemental Material: Western blot: SDS gel electrophoresis was performed using a 4% by 20% gradient gel 8. Quantification of Western blots was performed using Image J Processing and Analysis (NIH). Quantitative

More information

STANDARD OPERATING PROCEDURE

STANDARD OPERATING PROCEDURE STANDARD OPERATING PROCEDURE Title: Antibody Production at Strategic Diagnostics Inc. SOP#: M-119 Version #: 1 Date Approved: August 6, 2009 Author: Strategic Diagnostic Inc. Date Modified: 1. PURPOSE

More information

A Novel Bioconjugation Technology

A Novel Bioconjugation Technology A Novel Bioconjugation Technology for Assay Development and More! Presentation overview Who we are Solutions we provide for our customers Solulink s technology Linking system The Solulink advantage Applications

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Microarray Technology

Microarray Technology Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except

More information

About the Kits...2 Description 2 Components 2. Factor Xa Cleavage...3 Small scale optimization 3 Scale-up 3 Monitoring cleavage 4

About the Kits...2 Description 2 Components 2. Factor Xa Cleavage...3 Small scale optimization 3 Scale-up 3 Monitoring cleavage 4 Table of Contents About the Kits...2 Description 2 Components 2 Factor Xa Cleavage...3 Small scale optimization 3 Scale-up 3 Monitoring cleavage 4 Factor Xa Capture...5 Capture buffer considerations 5

More information

WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB)

WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB) WESTERN BLOT PROTOCOL FOR LICOR ODYSSEY SCANNER (HAKE S LAB) WESTERN BLOT FOR ANALYSIS ON LICOR ODYSSEY SCANNER. 1) The Licor Odyssey protein marker is optimal as it is visible on channel 700 (2ul is enough

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

Chem 405 Biochemistry Lab I Experiment 2 Quantitation of an unknown protein solution.

Chem 405 Biochemistry Lab I Experiment 2 Quantitation of an unknown protein solution. Chem 405 Biochemistry Lab I Experiment 2 Quantitation of an unknown protein solution. Introduction: The determination of protein concentration is frequently required in biochemical work. Several methods

More information

Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the

Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the Supplemental Data 1 Online supplemental information Statistical analysis Cell viability assays were represented as mean ± S.E. (n=3). Comparisons between the groups were performed using repeated measures

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know Actions of Hormones on Target Cells Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com) Page 1. Actions of Hormones on Target Cells Hormones

More information

Anti-ACTIVE MAPK, p38 and JNK Polyclonal Antibodies and Anti-ACTIVE Qualified Secondary Antibody Conjugate

Anti-ACTIVE MAPK, p38 and JNK Polyclonal Antibodies and Anti-ACTIVE Qualified Secondary Antibody Conjugate Technical Bulletin Anti-ACTIVE MAPK, p38 and JNK Polyclonal Antibodies and Anti-ACTIVE Qualified Secondary Antibody Conjugate INSTRUCTIONS FOR USE OF PRODUCTS V1211, V8031, V7931, V7932 AND V7951. PRINTED

More information

Molecular Cloning, Product Brochure

Molecular Cloning, Product Brochure , Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE

More information

Supplemental Figure legends Supplemental Figure 1. Smc3 depleted cells enter mitosis despite unrepaired DNA DSBs. HeLa cells were synchronised by double thymidine arrest and were transfected with sirnas

More information

Peak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion

Peak intensity Trypsin. Protein Sequence Before trypsin digestion After digestion with trypsin for 24 h digestion Supplemental table 1. The completeness of trypsin digestion of the signature peptides with native flanking sequence. The signature peptides with native flanking sequence were digested with trypsin as described

More information

Protease Peptide Microarrays Ready-to-use microarrays for protease profiling

Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Protocol Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Contact us: InfoLine: +49-30-97893-117 Order per fax: +49-30-97893-299 Or e-mail: peptide@jpt.com www: www.jpt.com

More information

Easy, Precise, Reliable Gel Electrophoresis Markers. Blocking Buffers. Ordering Information. Ordering Information

Easy, Precise, Reliable Gel Electrophoresis Markers. Blocking Buffers. Ordering Information. Ordering Information Easy, Precise, Reliable Gel Electrophoresis Markers Rockland s G.E.M. product line offers a variety of prestained protein standards and DNA ladders for electrophoresis applications. Protein standards suitable

More information

SCIENCE WHERE YOU ARE

SCIENCE WHERE YOU ARE Newsletter. November 2013 SCIENCE WHERE YOU ARE Dealing with BioNordika includes a number of first class benefits: Next day delivery.... and some times even faster! Free delivery. Focus on your application.

More information

ELITE Custom Antibody Services

ELITE Custom Antibody Services ELITE Custom Antibody Services ELITE Custom Antibody Services Experience, confidence, and understanding As a manufacturer and service provider, we have the experience, confidence, and understanding to

More information

Peptide synthesis, radiolabelling and radiochemical analysis

Peptide synthesis, radiolabelling and radiochemical analysis SUPPLEMENTAL DATA MATERIALS AND METHODS Peptide synthesis, radiolabelling and radiochemical analysis Solid phase synthesis of peptides was carried out on using ABI 433A peptide synthesizer, on a preloaded

More information

Benchtop Mitochondria Isolation Protocol

Benchtop Mitochondria Isolation Protocol Benchtop Mitochondria Isolation Protocol Note: Specific protocols are available for the following products: MS850 Mitochondria Isolation Kit for Rodent Tissue MS851 Mitochondria Isolation Kit for Rodent

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages

1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages 1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly

More information

PRODUCT INFORMATION...

PRODUCT INFORMATION... VIROMER RED In vitro plasmid DNA and mrna Standard Transfection PRODUCT INFORMATION... 2 GENERAL... 2 RED OR YELLOW?... 3 PROTOCOL GUIDELINES... 4 GENERAL REMARKS... 4 CELL CULTURE AND PLATING... 4 FORWARD/REVERSE

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

Geniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody

Geniron. Custom Antibody Services. Serum services Antibody Monoclonal. Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Custom Antibody Services Serum services Antibody Monoclonal Purification Antibody Mono Y Genetic Immunization Genbody Polyclonal Antibody Geniron Poly Y WE PROVIDE OUR SERVICES TO With Expertise

More information

Western Blot Protocol (updated on 05/20/14)

Western Blot Protocol (updated on 05/20/14) Western Blot Protocol (updated on 05/20/14) Required Solutions 10x PBS (1L) 80 g NaCl 2 g KCl 14.4 g Na 2 HPO 4 or 22 g Na 2 HPO 4 7H 2 O 2.4 g KH 2 PO 4 or 2 g KH 2 PO4 Adjust ph to 7.4 Autoclave PBST

More information

Inorganic salts for solution making, common compounds and organic solvents were

Inorganic salts for solution making, common compounds and organic solvents were Supplementary Material to Vara et al. Autocrine amplification of integrin αiibβ3 activation and platelet adhesive responses by deoxyribose-1-phosphate (Thromb Haemost 2013; 109.5) Materials Inorganic salts

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2 INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in

More information

Modulating Glucose Uptake in Skeletal Myotubes:

Modulating Glucose Uptake in Skeletal Myotubes: icell Skeletal Myoblasts Application Protocol Introduction Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis The skeletal muscle is one of the

More information

Northern blot analysis for microrna. (Narry Kim s lab)

Northern blot analysis for microrna. (Narry Kim s lab) Northern blot analysis for microrna (Narry Kim s lab) Materials 1. 10~50 μg of total RNA extracted from HeLa cells treated with sirna 2. RNA loading buffer 3. Probe: DNA oligonucleotide complementary to

More information

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%)

Predict Reactivity Note Chicken (100%), Sheep (100%), Rhesus Monkey (100%), Chimpanzee (100%), Bovine (100%), Guinea pig (100%) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Production of proteins for medical use in TG silkworms

Production of proteins for medical use in TG silkworms Production of proteins for medical use in TG silkworms Development of animal therapeutic drugs Collaborative development of influenza vaccines with Institute of Biological Resource Collaborative development

More information

Primary Antibody-polyHRP Labeling Western Blot Kit. Cat. No. A

Primary Antibody-polyHRP Labeling Western Blot Kit. Cat. No. A Primary Antibody-polyHRP Labeling Western Blot Kit Cat. No. A-9402-001 April 2011 I. Introduction Western Blot Detection Development of western blots with secondary antibody/hrp conjugates while simple

More information

Qualification Study CHO 360-HCP ELISA (Type A to D)

Qualification Study CHO 360-HCP ELISA (Type A to D) Short Report Qualification Study CHO 360-HCP ELISA (Type A to D) Presented by: http://www.biogenes.de Version 01 Issue date: 27.11.2013 Version 01 Page 1 of 8 Table of Content TABLE OF CONTENT... 2 1 INTRODUCTION...

More information

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all

More information

jetpei in vitro DNA Transfection Protocol

jetpei in vitro DNA Transfection Protocol jetpei DNA Transfection Reagent 1 jetpei in vitro DNA Transfection Protocol DESCRIPTION jetpei is a powerful reagent that ensures robust, effective and reproducible DNA transfection into mammalian cells

More information

Mechanical stretch via transforming growth factor- beta1 activates microrna-208a to regulate hypertrophy in cultured rat cardiac myocytes

Mechanical stretch via transforming growth factor- beta1 activates microrna-208a to regulate hypertrophy in cultured rat cardiac myocytes Mechanical stretch via transforming growth factor- beta1 activates microrna-208a to regulate hypertrophy in cultured rat cardiac myocytes Kou-Gi Shyu Bao-Wei Wang, Shin Kong Wu Ho-Su Memorial Hospital,

More information

MagExtractor -Genome-

MagExtractor -Genome- Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification

More information

Recombinant Enterokinase Kits

Recombinant Enterokinase Kits Table of Contents About the Kits...2 Description 2 Components 2 rek Cleavage...3 Small scale optimization 3 Scale-up 4 Monitoring cleavage 4 rek Capture...5 Capture buffer considerations 5 Monitoring rek

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information