Peptide synthesis, radiolabelling and radiochemical analysis

Size: px
Start display at page:

Download "Peptide synthesis, radiolabelling and radiochemical analysis"

Transcription

1 SUPPLEMENTAL DATA MATERIALS AND METHODS Peptide synthesis, radiolabelling and radiochemical analysis Solid phase synthesis of peptides was carried out on using ABI 433A peptide synthesizer, on a preloaded Thr(tBu)-Wang resin, using N-Fmoc amino acids and HBTU as the coupling reagent (Merck Chemicals). Amino acids had the following protection groups Arg(Pbf), Lys(Boc) Gln (Trt) Asp(OtBu)and Asn(Trt). In order to biotinylate DTPA-A20FMDV2, biotinyl-lysine was incorporated at position two in place of the usual alanine. Following chain assembly, DTPA-tetra(tBu ester) (4eq) (Macrocyclics) was coupled to the N terminal of the protected peptidyl-resin using HOBT/DIC activation and overnight agitation. Following reaction, and washing of the peptidyl-resin, the peptide was cleaved from the resin and side chain protecting groups removed by treatment with 92.5% trifluoroacetic acid, 2.5% ethanedithiol, 2.5% triisopropyl silane, and 2.5% H 2 O. After 2 h, the resin was removed by filtration and peptides were precipitated with diethyl ether on ice. Peptides were isolated by centrifugation, then dissolved in H 2 O and freeze dried overnight. The crude peptides were analysed by Agilent 1100 reverse phase HPLC and electrospray mass spectroscopy. Peptides were purified by reverse phase HPLC to > 90% purity on an Aquapore ODS 20 micron 250 x 10 mm column and lyophilised. During synthesis and purification, use of glassware was avoided. Peptide stock solutions were prepared in metal-free water and standard concentrations were confirmed spectrophometrically using absorption at 215nm. Briefly, 111 In-InCl 3 (58 µl, MBq in 0.1mM HCl) and ammonium acetate (15 µl, 1 M, ph 5.5) were mixed in a polypropylene vial. The peptide conjugate DTPA-A20FMDV2 or DTPA-A20FMDV2ran (5 µl. 1mg/ml in sterile water) was added, the solution was vortexed

2 briefly and incubated for 30 minutes at 25 o C, after which time the reaction was quenched with ethylenediaminetetraacetic acid ([EDTA] 4 µl, 0.1M). Radiochemical purity was determined by reverse-phase HPLC on LC Module 1 (Waters, Hertfordshire, UK) connected to sodium-iodide detector (5-µm Jupiter 300 column, 250 x 4.6 mm inner diameter, Phenomenex; solvent A, 0.1% trifluoroacetic acid [TFA] in HPLC grade water; solvent B, 0.1% TFA in acetonitrile; flow rate, 1 ml/min; gradient, 5% solvent B for 5 min, then change to 60% solvent B over 20 min, then change to 100% solvent B over 3 min, and change back to 5% solvent B over 5 min). Radiochemical purity was greater than 95% at a specific activity of 16 MBq/nmol with no evidence of fragmentation or aggregation during the labelling process as indicated by sharp single peak (see Supplemental Fig. 1) therefore no further purification was done. Any un-reacted 111 In-InCl 3 formed a complex with EDTA eluting off first with t R of 3 min which formed 3-5% impurity. The RP-HPLC elution time for 111 In-DTPA-A20FMDV2 was min and 111 In-DTPA-A20FMDVran min. Instant thin-layer chromatography was carried out using reverse phase plates (Whatman MKC18 Silica Gel 60 A, 200 mm, 1.0 x 7.0 cm) with mobile phase (25mM EDTA in 0.1 M ammonium acetate, ph 5.5); Rf for both radiolabelled peptides 111 In-DTPA-A20FMDV2 and 111 In-DTPA-A20FMDVran was and 111 In-EDTA was Endotoxin content in the final sample was analysed to be less than 17.5 EU (endotoxin unit) using an Endosafe - Portable Testing System (Charles River Laboratories, L Arbresle Cedex, France) with use of FDA-licensed disposable cartridges for accurate endotoxin testing.

3 Supplemental Table 1 PCR primer sequences Gene Sequence Murine itgb6 Sense 5 - TCTGAGGATGGAGTGCTGTG -3 Antisense 5 - GGCACCAATGGCTTTACACT -3 Murine hprt Sense 5 -TGAAAGACTTGCTGGAGATGTCA-3 Antisense 5 -CCAGCAGGTCAGCAAAGAACT-3 Human ITGB6 Sense 5 -AAACGGGAACCAATCCTCTGT-3 Antisense 5 -GCTTCTCCCTGTGCTTGTAGGT-3 Human β2m Sense 5 -AATCCAAATGCGGCATCT-3 Antisense 5 -GAGTATGCCTGCCGTGTG-3

4 Supplemental Figure 1 HPLC profiles of 111 In-DTPA-A20FMDV (A) and 111 In-DTPA-A20FMDVran (B) peptides showing the retention times at and minutes respectively.

5 Supplemental Figure 2 Kinetics and biodistribution of 111 In-labelled DTPA-A20FMDV2 peptide in mice instilled with saline 28 days prior to imaging. Mice were injected intravenously with the αvβ6-

6 specific 111 In- DTPA-A20FMDV2 peptide and subjected to NanoSPECT-CT analysis 1 hour (1-h) and 3 hours (3-h) later. The bladder is masked in each of the scans. Images of a representative mouse are shown.

7 Supplemental Figure 3 NanoSPECT-CT analysis of 111 In-DTPA-A20FMDV2ran peptide binding in the lungs of mice instilled intratracheally with saline (A) and bleomycin-treated (B) mice 28 days earlier. Mice were injected intravenously with peptide and imaged 1 hour later. Images of a representative mouse are shown.

8 Supplemental Figure 4 Coronal NanoSPECT-CT scans of the upper torso showing binding of 111 In- DTPA-A20FMDV2 in the lungs, oral cavity and submandibular glands of animals instilled intratracheally with bleomycin. Mice received IgG2a isotype control (A) or an αvβ6 blocking antibody (B) (2.5mg/Kg) 24 hours prior to imaging, and binding was assessed one hour after intravenous injection of the radiolabelled peptide. Images of a representative mouse are shown.

9 Supplemental Figure 5 Axial NanoSPECT-CT scans of 111 In- DTPA-A20FMDV2 peptide binding within the lungs of bleomycin (A&B) or saline-treated (C&D) animals. Peptide uptake was assessed in each individual animal at both 2 weeks (A&C) and 4 weeks (B&D) after intratracheal instillation of bleomycin or saline. Images of representative mice are shown.

10 Supplemental Figure 6 Immunohistochemical analysis of lung αvβ6 levels (brown), 28 days after treatment with intratracheal saline (A) or bleomycin (B). Images from representative mice are shown. Scale bar is 20µm.

11 Supplemental Figure 7 Hydroxyproline (A) and itgb6 mrna (B) levels were measured in lungs from mice treated with bleomycin (n=6/group) or saline (n=4/group) for 28 days. ITGB6 mrna expression was assessed in lung samples from IPF patients compared with non-fibrotic lungs (C; n=3/ group). Data are presented as mean ± SEM. (**** P< ; * P<0.05). Correlation of 111 In-DTPA- A20FMDV2 binding within the lungs at 28 days post saline (open circles; n=4) or bleomycin (closed circles; n=6) treatment with itgb6 mrna expression (D).

12 Supplemental Video 1 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDV2 peptide within saline-treated lungs. Mice instilled intratracheally with saline 28 days prior to NanoSPECT-CT imaging were injected intravenously with the αvβ6 binding peptide, 111 In-DTPA-A20FMDV2. NanoSPECT-CT scans were performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 2 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDV2 peptide within bleomycin-treated lungs. Mice instilled intratracheally with bleomycin 28 days prior to NanoSPECT-CT imaging were injected intravenously with the αvβ6 binding peptide, 111 In- DTPA-A20FMDV2. NanoSPECT-CT scans were performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 3 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDVran control peptide within saline-treated lungs. Mice instilled intratracheally with saline 28 days prior to NanoSPECT-CT imaging were injected intravenously with the control peptide, 111 In- DTPA-A20FMDVran. NanoSPECT-CT scans performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 4 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDVran control peptide within bleomycin-treated lungs. Mice instilled intratracheally with bleomycin 28 days prior to NanoSPECT-CT imaging were injected intravenously with the control peptide, 111 In- DTPA-A20FMDVran. NanoSPECT-CT scans were performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 5 3D reconstruction of NanoSPECT/CT images of the upper torso visualizing binding of 111 In- DTPA-A20FMDV2 peptide within bleomycin-treated animals in the presence of isotype control antibody (2.5mg/Kg) 24 hours before peptide administration. NanoSPECT-CT scans were performed 1 hour after the intravenous injection of the radiolabelled peptide. The reconstruction of a representative mouse is shown.

13 Supplemental Video 6 3D reconstruction of NanoSPECT-CT images of the upper torso visualizing binding of 111 In- DTPA-A20FMDV2 peptide within bleomycin-treated animals in the presence of antiαvβ6 blocking antibody (2.5mg/Kg) administered 24 hours prior to imaging, NanoSPECT-CT scans were performed 1 hour after the intravenous injection of the radiolabelled peptide. The reconstruction of a representative mouse is shown.

1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis

1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis 1) Technical informations - a) How does it work? - b) Purification - c) Quality Control 2) Standard synthesis - a) Standard peptides - b) Modified peptides - c) Shipment and Delivery Time - d) How to order?

More information

Supplemental Material: peptide synthesis

Supplemental Material: peptide synthesis Supplemental Material: peptide synthesis Synthesis of MMAE containing ACPPs (Scheme 1) The peptides were synthesized by using regular solid phase Fmoc peptide synthesis. Peptides that were used for fluorescence

More information

Experimental procedures. Solid phase peptide synthesis (SPPS)

Experimental procedures. Solid phase peptide synthesis (SPPS) Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry This journal is The Royal Society of Chemistry 214 Experimental procedures Solid phase peptide synthesis (SPPS) Solid phase

More information

lung cancer targeted photodynamic therapy and imaging

lung cancer targeted photodynamic therapy and imaging 99m Tc-Hematoporphyrin linked albumin nanoparticles for lung cancer targeted photodynamic therapy and imaging Su-Geun Yang, Ji-Eun Chang, Byungchul Shin, Sanghyun Park, Kun Na and Chang-Koo Shim* *Corresponding

More information

Guide to Reverse Phase SpinColumns Chromatography for Sample Prep

Guide to Reverse Phase SpinColumns Chromatography for Sample Prep Guide to Reverse Phase SpinColumns Chromatography for Sample Prep www.harvardapparatus.com Contents Introduction...2-3 Modes of Separation...4-6 Spin Column Efficiency...7-8 Fast Protein Analysis...9 Specifications...10

More information

Novel Method for Solid Phase Peptide Synthesis Using Microwave Energy

Novel Method for Solid Phase Peptide Synthesis Using Microwave Energy Novel Method for Solid Phase Peptide Synthesis Using Microwave Energy Jonathan M. Collins, Michael J. Collins, Rebecca C. Steorts CEM Corporation, Matthews, NC 28106-0200, U.S.A. Presented at American

More information

Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide

Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide Electronic Supplementary Information Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide W. Mei Kok, a,b,c Denis B. Scanlon, b John A. Karas,

More information

TANNIC ACID. SYNONYMS Tannins (food grade), gallotannic acid, INS No. 181 DEFINITION DESCRIPTION

TANNIC ACID. SYNONYMS Tannins (food grade), gallotannic acid, INS No. 181 DEFINITION DESCRIPTION TANNIC ACID Prepared at the 71 st JECFA (2009) and published in FAO JECFA Monographs 7 (2009), superseding specifications prepared at the 39 th JECFA (1992), published in the combined Compendium of Food

More information

9040 S. Rita Road, Suite 1100 Tucson, Arizona T: (520) F: (520)

9040 S. Rita Road, Suite 1100 Tucson, Arizona T: (520) F: (520) ANALYTICAL REPORT DETERMINATION OF CHOLECALCIFEROL (VITAMIN D 3 ) IN XXXXXXXXX 1. Samples: The samples were received on xxxxxxxx, 2009, for Vitamin D3 (cholecalciferol) determination. Sample ID XXXX XXXX

More information

Peptide Synthesis Zheng Miao* and Zhen Cheng

Peptide Synthesis Zheng Miao* and Zhen Cheng Peptide Synthesis Zheng Miao* and Zhen Cheng 1 Department of Radiology, Molecular Imaging Program at Stanford, Stanford University School of Medicine, Stanford, USA *For correspondence: zmiao@stanford.edu

More information

SUCRALOSE. White to off-white, practically odourless crystalline powder

SUCRALOSE. White to off-white, practically odourless crystalline powder SUCRALOSE Prepared at the 41st JECFA (1993), published in FNP 52 Add 2 (1993). Metals and arsenic specifications revised at the 63rd JECFA (2004). An ADI of 0-15 mg/kg bw was established at the 37th JECFA

More information

Automated Fast-Bead Synthesis of Small Peptides

Automated Fast-Bead Synthesis of Small Peptides Automated Fast-Bead Synthesis of Small Peptides Application Note 228 Joan Stevens, Ph.D., Norbert Wodke, Tim Hegeman and Kirby Reed (Gilson, Inc.) Introduction In proteomic research, the synthesis of peptides

More information

Supplemental data. A simple and effective cleavable linker for chemical proteomics applications

Supplemental data. A simple and effective cleavable linker for chemical proteomics applications Supplemental data A simple and effective cleavable linker for chemical proteomics applications Yinliang Yang, annes ahne, Bernhard Kuster, and Steven. L. Verhelst * Figure S1 Figure S2 Figure S3 Table

More information

Standard practices for Fmoc-based solid-phase. peptide synthesis in the Nowick laboratory. (Version 1.6.1)

Standard practices for Fmoc-based solid-phase. peptide synthesis in the Nowick laboratory. (Version 1.6.1) Standard practices for Fmoc-based solid-phase peptide synthesis in the Nowick laboratory (Version 1.6.1) Adam G. Kreutzer and Patrick J. Salveson E-mail: Contents Contributions to this guide 3 General

More information

An In-Gel Digestion Protocol

An In-Gel Digestion Protocol An In-Gel Digestion Protocol This protocol describes the digestion of a protein present in an SDS-PAGE gel band with trypsin. The band can be taken from either a 1D or 2D electrophoresis gel. Reagents

More information

OXYTOCIN : ADOPTED TEXT FOR THE INTERNATIONAL PHARMACOPOEIA Final text for addition to The International Pharmacopoeia (June 2010)

OXYTOCIN : ADOPTED TEXT FOR THE INTERNATIONAL PHARMACOPOEIA Final text for addition to The International Pharmacopoeia (June 2010) June 2010 OXYTOCIN : ADOPTED TEXT FOR THE INTERNATIONAL PHARMACOPOEIA Final text for addition to The International Pharmacopoeia (June 2010) This monograph was adopted at the Forty-fourth WHO Expert Committee

More information

CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY

CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY 9.1 POLICY This test method may be used to confirm the presence of zolpidem (ZOL), with diazepam-d 5 (DZP-d 5 ) internal standard, in

More information

Peptide Library Synthesis

Peptide Library Synthesis Peptide Library Synthesis Jamie M. R. Moore Guy Laboratory UCSF I. verview.. page 2 II. Reagents and Apparatus. page 4 III. Flow Chart. page 6 IV. Protocol. page 7 IV. Tables A. List of Fmoc Amino. page

More information

Prior to release, the following tests are carried out on each batch of the final substances.

Prior to release, the following tests are carried out on each batch of the final substances. Insulin Lispro C 257 H 383 N 65 O 77 S 6 Mol. Wt. 5808 28 B -L-Lysine-29 B -L-proline insulin (human) Insulin Lispro is a 2-chain peptide containing 51 amino acids. The A- chain is composed of 21 amino

More information

Mass-Directed Isolation of a Synthetic Peptide Using the ACQUITY QDa Detector

Mass-Directed Isolation of a Synthetic Peptide Using the ACQUITY QDa Detector Mass-Directed Isolation of a Synthetic Peptide Using the ACQUITY QDa Detector Jo-Ann M. Jablonski and Andrew J. Aubin Waters Corporation, Milford, MA, USA APPLICATION BENEFITS The ACQUITY QDa Detector

More information

Purification of reaction mixtures using flash chromatography.

Purification of reaction mixtures using flash chromatography. Purification of reaction mixtures using flash chromatography. This technical note details the use of ISOLUTE Flash chromatography columns for the purification of reaction mixtures. What is flash chromatography?

More information

MagExtractor-PCR & Gel Clean up-

MagExtractor-PCR & Gel Clean up- Instruction manual MagExtractor-PCR & Gel Clean up-0810 F0986K MagExtractor-PCR & Gel Clean up- NPK-601 200 preparations Store at room temperature Contents [1] Introduction [2] Components [3] Materials

More information

TECHNICAL CHLORPYRIFOS

TECHNICAL CHLORPYRIFOS TECHNICAL WHO/SIT/21.R3 TECHNICAL CHLORPYRIFOS Full specification WHO/SIT/21.R3 Revised 10 December 1999 1. Specification 1.1 Description The material shall consist of chlorpyrifos together with related

More information

Structure-Based Design of Covalent Siah Inhibitors

Structure-Based Design of Covalent Siah Inhibitors Chemistry & Biology, Volume 20 Supplemental Information Structure-Based Design of Covalent Siah Inhibitors John L. Stebbins, Eugenio Santelli, Yongmei Feng, Surya K. De, Angela Purves, Khatereh Motamedchaboki,

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

High-Throughput 3-D Chromatography Through Ion Exchange SPE

High-Throughput 3-D Chromatography Through Ion Exchange SPE High-Throughput 3-D Chromatography Through Ion Exchange SPE Application Note 205 Luke Roenneburg and Alan Hamstra (Gilson, Inc.) Introduction 2-dimensional (2-D) separation is the separation of a sample

More information

Quality. Now Certified to ISO 9001:2008

Quality. Now Certified to ISO 9001:2008 Quality Now Certified to ISO 90012008 Quality Policy It is Peptides International's goal is to achieve complete customer satisfaction by addressing customer needs and delivering what we promise. The company

More information

Protein Purification and Analysis

Protein Purification and Analysis Protein Purification and Analysis Numbers of genes: Humans ~40,000 genes Yeast ~6000 genes Bacteria ~3000 genes Solubility of proteins important for purification: 60-80% soluble, 20-40% membrane Some proteins

More information

PROCEDURE. Analysis of Sulfonamides in Chicken Muscle and Porcine Kidney Using HPLC UV-VIS SULPHONAMIDES METHOD OF DETERMINATION

PROCEDURE. Analysis of Sulfonamides in Chicken Muscle and Porcine Kidney Using HPLC UV-VIS SULPHONAMIDES METHOD OF DETERMINATION SULPHONAMIDES METHOD OF DETERMINATION 1.0 INTRODUCTION 1.1 The sulphonamides are an important class of antibacterial drugs that are widely used in animal production as therapeutic agents and as growth

More information

Peptide Antibody Production

Peptide Antibody Production Peptide Antibody Production A) Peptide BioSynthesis (http://www.biosyn.com, 800-227-0627) B) Conjugation of peptide to KLH (Imject Maleimide Activated KLH, PIERCE=Thermo #77605, 10 mg) C) Peptide affinity

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Synthesis of Leucine Zippers and Leucine Zipper Dendrimers

Synthesis of Leucine Zippers and Leucine Zipper Dendrimers Supplementary Materials Helical Supramolecules and Fibers Utilizing Leucine-Zipper Displaying Dendrimers Min Zhou, David Bentley, Indraneel Ghosh Contribution from the Department of Chemistry, University

More information

Aspects of industrial purification of peptides using large-scale chromatography. Lars Andersson and Jonas Persson

Aspects of industrial purification of peptides using large-scale chromatography. Lars Andersson and Jonas Persson Aspects of industrial purification of peptides using large-scale chromatography Introduction By Lars Andersson and Jonas Persson PolyPeptide Laboratories (Sweden) AB PO Box 30089 SE-200 61 LIMHAMN SWEDEN

More information

Labelling of peptides with CyDye fluors for fluorescent applications on the LEADseeker Homogeneous Imaging System

Labelling of peptides with CyDye fluors for fluorescent applications on the LEADseeker Homogeneous Imaging System Issue No. 7 abelling of peptides with CyDye fluors for fluorescent applications on the EADseeker Homogeneous Imaging System EADseeker TM homogeneous imaging system is a digital imager comprising a chargecoupled

More information

TANNIC ACID. SYNONYMS Tannins (food grade), gallotannic acid, INS No. 181 DEFINITION DESCRIPTION

TANNIC ACID. SYNONYMS Tannins (food grade), gallotannic acid, INS No. 181 DEFINITION DESCRIPTION TANNIC ACID Prepared at the 39th JECFA (1992), published in FNP Add 1 (1992) superseding specifications prepared at the 35th JECFA (1989), published in FNP 49 (1990) and in FNP 52 (1992). Metals and arsenic

More information

High-speed quantitation or purification

High-speed quantitation or purification PRODUCT BULLETIN POROS Affinity Chromatography Columns POROS Affinity Chromatography Columns High-speed quantitation or purification Broad utility POROS A, G, and CaptureSelect affinity ligands address

More information

Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide using Biotage

Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide using Biotage Application ote A098 Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide Page 1 Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide using Biotage Initiator+ Alstra Introduction Labeled

More information

JIS K 8267 JIS K 8372 JIS K 2251 JIS Z

JIS K 8267 JIS K 8372 JIS K 2251 JIS Z Determination of Formic Acid, Acetic Acid and Propionic Acid Contents in FAME - Blended Diesel Fuels (Draft) Water Extraction Ion Chromatography Method (WARNING The use of this standard may involve hazardous

More information

Supplementary Materials and Methods (Metabolomics analysis)

Supplementary Materials and Methods (Metabolomics analysis) Supplementary Materials and Methods (Metabolomics analysis) Metabolite extraction and mass spectrometry analysis. 12 Vldlr-/- knock out and 12 wild type (WT) retinas were separately frozen at -80 ºC in

More information

Materials and Methods. Protocol for Fmoc- based solid- phase peptide synthesis

Materials and Methods. Protocol for Fmoc- based solid- phase peptide synthesis Materials and Methods All commercially available materials (Aldrich, TCI, ovabiochem, Fluka ) were used without further purification. All solvents were reagent grade or PLC grade (Fisher ). Anhydrous TF,

More information

Removal of endotoxin from monoclonal antibodies using Vivapure centrifugal ion exchange membrane devices

Removal of endotoxin from monoclonal antibodies using Vivapure centrifugal ion exchange membrane devices Introduction Endotoxins are lipopolysaccharides present in the cell wall of most Gramnegative bacteria, and are frequently present as contaminants in protein solutions purified in research environments.

More information

High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK

High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK Background Unilabs YBS are a bioanalytical CRO based in York (Uk) Copenhagen

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Supporting Information

Supporting Information Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2013 More than Meets the Eye: Conformational Switching of a Stacked Dialkoxynaphthalene Naphthalenetetracarboxylic diimide

More information

ANALYSIS OF FOOD AND NATURAL PRODUCTS LABORATORY EXERCISE

ANALYSIS OF FOOD AND NATURAL PRODUCTS LABORATORY EXERCISE ANALYSIS OF FOOD AND NATURAL PRODUCTS LABORATORY EXERCISE Determination of vitamins, caffeine and preservatives (method: liquid chromatography with UV detection) Exercise guarantor: Assoc.Prof. Ing.Věra

More information

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on

More information

α-cyclodextrin SYNONYMS α-schardinger dextrin, α-dextrin, cyclohexaamylose, cyclomaltohexaose, α- cycloamylase

α-cyclodextrin SYNONYMS α-schardinger dextrin, α-dextrin, cyclohexaamylose, cyclomaltohexaose, α- cycloamylase α-cyclodextrin New specifications prepared at the 57th JECFA (2001) and published in FNP 52 Add 9 (2001). An ADI not specified was established at the 57th JECFA (2001). SYNONYMS α-schardinger dextrin,

More information

Monoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry

Monoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry Monoclonal ntibody Fragment Separation and haracterization Using Size Exclusion hromatography oupled with Mass Spectrometry uthors Haiying hen Katherine McLaughlin Sepax Technologies, Inc. 5 Innovation

More information

Nanosep & Nanosep MF Centrifugal Devices

Nanosep & Nanosep MF Centrifugal Devices Nanosep & Nanosep MF Centrifugal Devices Description Simple, reliable concentrating and desalting of 50 to 500 µl samples in just 5 to 15 minutes Rapid processing of samples. Typical recoveries are greater

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Guidance for Industry

Guidance for Industry Guidance for Industry for the Submission of Chemistry, Manufacturing, and Controls Information for Synthetic Peptide Substances Center for Drug Evaluation and Research (CDER) Center for Biologics Evaluation

More information

Removal of Beta-Glucuronidase Enzyme from Urine Post-Hydrolysis. and Column Lifetime

Removal of Beta-Glucuronidase Enzyme from Urine Post-Hydrolysis. and Column Lifetime Removal of Beta-Glucuronidase Enzyme from Urine Post-Hydrolysis to Improve Assay Performance and Column Lifetime Shahana Huq, Seyed Sadjadi, and Sky Countryman Phenomenex, Inc., 411 Madrid Ave., Torrance,

More information

Protein Reduction, Alkylation, Digestion

Protein Reduction, Alkylation, Digestion Contents... 1 Reduction / Alkylation (DTT, IAA and UREA), Trypsin digestion... 1 Reagents and Materials (see Table 1)... 1 Reduction / Alkylation (DTT, IAA and UREA)... 1 Trypsin digestion:... 1 Reduction

More information

5-Bromo 2-hydroxy benzonitrile was obtained from Apollo Chemical. Ethyl. bromoacetate and N-methylpiperazine were purchased from Aldrich.

5-Bromo 2-hydroxy benzonitrile was obtained from Apollo Chemical. Ethyl. bromoacetate and N-methylpiperazine were purchased from Aldrich. Supplemental Information Synthesis of Compound A 5-Bromo 2-hydroxy benzonitrile was obtained from Apollo Chemical. Ethyl bromoacetate and N-methylpiperazine were purchased from Aldrich. 5-Bromo-2- fluoropyridine

More information

Materials for Pharmaceutical Manufacturing

Materials for Pharmaceutical Manufacturing Materials for Pharmaceutical Manufacturing GRACE WHITEPAPER Vydac 150HC Purification Media Greater Loading Capacity and Resolution for Improved Productivity in Peptide Purification Technical Development:

More information

Analytical Test Report

Analytical Test Report Analytical Test Report Customer: Address (City, State): Purchase Order: Report Number: Project Number: Date Received: Date of Report: Test Location: Boulder, CO. Assay: Part Number: Amino Acids by HPLC

More information

Overview'of'Solid-Phase'Peptide'Synthesis'(SPPS)'and'Secondary'Structure'Determination'by'FTIR'

Overview'of'Solid-Phase'Peptide'Synthesis'(SPPS)'and'Secondary'Structure'Determination'by'FTIR' verviewofsolid-phasepeptidesynthesis(spps)andsecondarystructuredeterminationbyftir Introduction Proteinsareubiquitousinlivingorganismsandcells,andcanserveavarietyoffunctions.Proteinscanactas enzymes,hormones,antibiotics,receptors,orserveasstructuralsupportsintissuessuchasmuscle,hair,and

More information

LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research

LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research J. Jones, J. Denbigh, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 20581 Key Words SPE, SOLA,

More information

Gel Filtration Standard

Gel Filtration Standard Gel Filtration Standard Instruction Manual Catalog # 151-1901 Table of Contents Section 1 Introduction... 1 1.1 Instructions... 1 1.2 Recommended Volume of Standard... 2 1.3 Shelf Life... 5 1.4 Storage...

More information

LUMEFANTRINE Draft proposal for The International Pharmacopoeia (October 2006)

LUMEFANTRINE Draft proposal for The International Pharmacopoeia (October 2006) October 2006 RESTRICTED LUMEFANTRINE Draft proposal for The International Pharmacopoeia (October 2006) DRAFT FOR DISCUSSION World Health Organization 2006 All rights reserved. This draft is intended for

More information

Affinity Chromatography

Affinity Chromatography PR100-02 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Affinity Chromatography Teacher s Guidebook (Cat. # BE-417) think proteins! think

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

The Use of Micro Flow LC Coupled to MS/MS in Veterinary Drug Residue Analysis

The Use of Micro Flow LC Coupled to MS/MS in Veterinary Drug Residue Analysis The Use of Micro Flow LC Coupled to MS/MS in Veterinary Drug Residue Analysis Stephen Lock AB SCIEX Warrington (UK) Overview A rapid, robust, sensitive and specific LC-MS/MS method has been developed for

More information

NATIONAL STANDARD FOR FOOD SAFETY OF THE PEOPLE S REPUBLIC OF CHINA

NATIONAL STANDARD FOR FOOD SAFETY OF THE PEOPLE S REPUBLIC OF CHINA NATIONAL STANDARD FOR FOOD SAFETY OF THE PEOPLE S REPUBLIC OF CHINA GB 5413.9 2010 National food safety standard Determination of vitamin A, D, E in foods for infants and young children, milk and milk

More information

ACQUITY UPLC ANALYSIS OF SEED OILS (PART 2): OLIVE OIL QUALITY & ADULTERATION

ACQUITY UPLC ANALYSIS OF SEED OILS (PART 2): OLIVE OIL QUALITY & ADULTERATION ACQUITY UPLC ANALYSIS OF SEED OILS (PART 2): OLIVE OIL QUALITY & ADULTERATION Peter J. Lee, Charles H. Phoebe, and Alice J. Di Gioia Waters Corporation, Milford, MA, USA INTRODUCTION Market demand for

More information

Affi-Prep Protein A Matrix Instruction Manual

Affi-Prep Protein A Matrix Instruction Manual Affi-Prep Protein A Matrix Instruction Manual Catalog Numbers 156-0005 156-0006 Bio-Rad Laboratories, 2000 Alfred Nobel Dr., Hercules, CA 94547 LIT-230 Rev B Table of Contents Section 1 Introduction...1

More information

USP Method Transfer of Donepezil Tablets from HPLC to UPLC

USP Method Transfer of Donepezil Tablets from HPLC to UPLC USP Method Transfer of Donepezil Tablets from HPLC to UPLC Mia Summers and Kenneth J. Fountain Waters Corporation, 34 Maple St., Milford, MA, USA APPLICATION BENEFITS Updating USP Methods from HPLC to

More information

DEVELOPMENT AND VALIDATION OF RP-HPLC METHOD FOR THE ESTIMATION OF BENFOTIAMINE IN BULK AND DOSAGE FORM

DEVELOPMENT AND VALIDATION OF RP-HPLC METHOD FOR THE ESTIMATION OF BENFOTIAMINE IN BULK AND DOSAGE FORM INTERNATIONAL JOURNAL OF PHARMACEUTICAL, CHEMICAL AND BIOLOGICAL SCIENCES Available online at www.ijpcbs.com Research Article DEVELOPMENT AND VALIDATION OF RP-HPLC METHOD FOR THE ESTIMATION OF BENFOTIAMINE

More information

Determination of Acrylamide in Food Simulants

Determination of Acrylamide in Food Simulants Determination of Acrylamide in Food Simulants WARNING: Acrylamide monomer is toxic and readily absorbed through the skin. The monomer should be handled in a fume cupboard using gloves. 1 SCOPE This method

More information

Section VII: Separation of DNA in Polyacrylamide Gels. Separation In DNA in. Polyacrylamide Gels

Section VII: Separation of DNA in Polyacrylamide Gels. Separation In DNA in. Polyacrylamide Gels Section VII: Separation In DNA in In This Section Separating DNA in 126 Detecting DNA in 127 Recovery of DNA in 129 References 130 125 Section VII: Separating DNA in Overview Polyacrylamide gels can separate

More information

A prochelator with a modular masking group featuring hydrogen peroxide activation with concurrent fluorescent reporting

A prochelator with a modular masking group featuring hydrogen peroxide activation with concurrent fluorescent reporting Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information A prochelator with a modular masking group featuring hydrogen peroxide activation

More information

A Discovery-Oriented Approach to Solid-Phase Peptide Synthesis

A Discovery-Oriented Approach to Solid-Phase Peptide Synthesis Illinois Wesleyan University From the SelectedWorks of Brian B. Brennan 2012 A Discovery-Oriented Approach to Solid-Phase Peptide Synthesis Brian B. Brennan, Illinois Wesleyan University Matthew R. Bockman,

More information

SIMULTANEOUS DETERMINATION OF NALTREXONE AND 6- -NALTREXOL IN SERUM BY HPLC

SIMULTANEOUS DETERMINATION OF NALTREXONE AND 6- -NALTREXOL IN SERUM BY HPLC SIMULTANEOUS DETERMINATION OF NALTREXONE AND 6- -NALTREXOL IN SERUM BY HPLC Katja SÄRKKÄ, Kari ARINIEMI, Pirjo LILLSUNDE Laboratory of Substance Abuse, National Public Health Institute Manerheimintie,

More information

FAST AND EFFICIENT PURIFICATION OF SYNTHETIC PEPTIDES BY SOLID-PHASE EXTRACTION

FAST AND EFFICIENT PURIFICATION OF SYNTHETIC PEPTIDES BY SOLID-PHASE EXTRACTION ACTA CHROMATOGRAPHICA, NO. 14, 2004 FAST AND EFFICIENT PURIFICATION OF SYNTHETIC PEPTIDES BY SOLID-PHASE EXTRACTION W. Kamysz 1,*, M. Okrój 2, E. Łempicka 3, T. Ossowski 3, and J. Łukasiak 1 1 Faculty

More information

A New Labeling Agent for CE/MS N-Glycans Analysis

A New Labeling Agent for CE/MS N-Glycans Analysis Electronic Supplementary Information (ESI) A New Labeling Agent for CE/MS N-Glycans Analysis Cai Tie a, Xin-Xiang Zhang * a Synthesis Dextran standard were purchased from Sigma Aldrich (St. Louis, MO,

More information

HYDROXYPROPYLCELLULOSE Stage 4, Revision 1, CP: USP BRIEFING NOTE. Compared to the Stage 4, document the following changes are proposed:

HYDROXYPROPYLCELLULOSE Stage 4, Revision 1, CP: USP BRIEFING NOTE. Compared to the Stage 4, document the following changes are proposed: 001-0901PDG.pdf HYDROXYPROPYLCELLULOSE Stage 4, Revision 1, CP: USP BRIEFING NOTE Compared to the Stage 4, document the following changes are proposed: 1. Assay: a determination of the molar substitution

More information

TECHNICAL BULLETIN. FluoroTag FITC Conjugation Kit. Product Number FITC1 Storage Temperature 2 8 C

TECHNICAL BULLETIN. FluoroTag FITC Conjugation Kit. Product Number FITC1 Storage Temperature 2 8 C FluoroTag FITC Conjugation Kit Product Number FITC1 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description The FluoroTag FITC Conjugation Kit is suitable for the conjugation of polyclonal and

More information

Anti-Lemon sole (Microstomus kitt) IgM monoclonal antibody. Product no: F24

Anti-Lemon sole (Microstomus kitt) IgM monoclonal antibody. Product no: F24 Anti-Lemon sole (Microstomus kitt) IgM monoclonal antibody Product no: F24 Product Description This monoclonal antibody (Mab) reacts with Lemon sole (Microstomus kitt) immunoglobulin M (IgM). The Mab is

More information

Guide to Gel Filtration or Size Exclusion Chromatography

Guide to Gel Filtration or Size Exclusion Chromatography Guide to Gel Filtration or Size Exclusion Chromatography www.harvardapparatus.com Table of Contents Introduction...2-4 Size Fractionation...5 Buffer Sample Selection...6-7 Selection of Media and Size...8

More information

--not necessarily a protein! (all proteins are polypeptides, but the converse is not true)

--not necessarily a protein! (all proteins are polypeptides, but the converse is not true) 00Note Set 5b 1 PEPTIDE BONDS AND POLYPEPTIDES OLIGOPEPTIDE: --chain containing only a few amino acids (see tetrapaptide, Fig 5.9) POLYPEPTIDE CHAINS: --many amino acids joined together --not necessarily

More information

Method Development of LC-MS/MS Analysis of Aminoglycoside Drugs: Challenges and Solutions

Method Development of LC-MS/MS Analysis of Aminoglycoside Drugs: Challenges and Solutions Method Development of LC-MS/MS Analysis of Aminoglycoside Drugs: Challenges and Solutions authors Angela (Qi) Shen, Ling Morgan, Marcele L. Barroso, and Xin Zhang; Tandem Labs Tuyen Nguyen; Sepracor Inc.

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

Your partner in immunology

Your partner in immunology Your partner in immunology Expertise Expertise Reactivity Reactivity Quality Quality Advice Advice Who are we? Specialist of antibody engineering Covalab is a French biotechnology company, specialised

More information

Extraction of Epinephrine, Norepinephrine and Dopamine from Human Plasma Using EVOLUTE EXPRESS WCX Prior to LC-MS/MS Analysis

Extraction of Epinephrine, Norepinephrine and Dopamine from Human Plasma Using EVOLUTE EXPRESS WCX Prior to LC-MS/MS Analysis Application Note AN844 Extraction of, and from Human Plasma Using EVOLUTE EXPRESS WCX Page 1 Extraction of, and from Human Plasma Using EVOLUTE EXPRESS WCX Prior to LC-MS/MS Analysis Introduction Catecholamines

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

Custom Polyclonal Anti-Peptide Antibody, Brochure

Custom Polyclonal Anti-Peptide Antibody, Brochure Custom Polyclonal Anti-Peptide Antibody, Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Antibody Services. Best Guarantees in the Industry! Monoclonal Antibody Services. Polyclonal Antibody Services. Express Antibody TM Services

Antibody Services. Best Guarantees in the Industry! Monoclonal Antibody Services. Polyclonal Antibody Services. Express Antibody TM Services Antibody Services Best Guarantees in the Industry! Monoclonal Antibody Services Polyclonal Antibody Services Express Antibody TM Services Guaranteed Antibody Services Antibody Purification Services Your

More information

RESOURCE Q, 1 ml and 6 ml RESOURCE S, 1 ml and 6 ml

RESOURCE Q, 1 ml and 6 ml RESOURCE S, 1 ml and 6 ml GE Healthcare Life Sciences Instructions 71-7146-00 AI Ion Exchange Columns RESOURCE Q, 1 ml and 6 ml RESOURCE S, 1 ml and 6 ml Introduction RESOURCE Q and S are pre-packed columns for separating biomolecules

More information

PrepTip. Reverse Phase PrepTip User Guide

PrepTip. Reverse Phase PrepTip User Guide PrepTip Reverse Phase PrepTip User Guide All text, photographs and illustrations are copyrighted by Harvard Apparatus, Inc. 2004. PrepTip is a trademark of Harvard Apparatus, Inc. Harvard Apparatus 84

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

[Research article] RP-HPLC Assay Method Validation for the estimation of new Antiretroviral drug Lamivudine in Bulk and Tablet dosage form

[Research article] RP-HPLC Assay Method Validation for the estimation of new Antiretroviral drug Lamivudine in Bulk and Tablet dosage form 12 IJPAR Volume 1 Issue 1 Dec_ 2012 Available Online at: www.ijpar.com [Research article] RP-HPLC Assay Method Validation for the estimation of new Antiretroviral drug in Bulk and Tablet dosage form *

More information

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins

POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins APPLICATION NOTE POROS CaptureSelect affinity chromatography columns POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins Introduction POROS columns, containing highperformance

More information

Overview. Purpose. Methods. Results

Overview. Purpose. Methods. Results A ovel Approach to Quantify Unbound Cisplatin, Carboplatin, and xaliplatin in Human Plasma Ultrafiltrate by Measuring Platinum-DDTC Complex Using LC/M/M Min Meng, Ryan Kuntz, Al Fontanet, and Patrick K.

More information

QuickGene DNA whole blood kit L (DB-L)

QuickGene DNA whole blood kit L (DB-L) HANDBOOK QuickGene DNA whole blood kit L (DB-L) For Isolation of Genomic DNA from whole blood Ver.2.0 Contents 1. Introduction... 3 2. Kit components... 3 3. Storage conditions... 3 4. Other required materials,

More information

HiPer Ion Exchange Chromatography Teaching Kit

HiPer Ion Exchange Chromatography Teaching Kit HiPer Ion Exchange Chromatography Teaching Kit Product Code: HTC001 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 5-6 hours Storage Instructions: The kit is stable for

More information

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,

More information