Czech J. Anim. Sci., 59, 2014 (9):

Transcription

1 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper Effect of dietry eicospentenoic nd docoshexenoic cid on expression of rt liver genes controlling cholesterol homeostsis nd on plsm cholesterol level T. Komprd 1, G. Zorníková 1, A. Knoll 2,3, Z. Vykouklová 2, V. Rozíková 1, O. Škultéty 2, R. Kroot 4 1 Deprtment of Food Technology, Mendel University in Brno, Brno, Czech Repulic 2 Deprtment of Animl Morphology, Physiology nd Genetics, Mendel University in Brno, Brno, Czech Repulic 3 CEITEC MENDELU, Mendel University in Brno, Brno, Czech Repulic 4 Deprtment of Animl Nutrition nd Forge Production, Mendel University in Brno, Brno, Czech Repulic ABSTRACT: A hypothesis tht eicospentenoic cid + docoshexenoic cid (EPA+DHA) lower plsm cholesterol vi incresed expression of the Insig-1 gene with ensuing decrese of expression of genes coding for 3-hydroxy-3-methyl-glutryl-CoA reductse (Hmgcr) nd low density lipoprotein receptor (Ldlr) ws tested in rts fed diet with 3% of fish oil (FO). Expression of the Insig-1 gene in the liver of the FO-fed rts ws 730% (P < 0.05) of the control. However, contrry to the hypothesis, expression of the Hmgcr gene nd Ldlr gene ws 165% nd 210% of the control (P > 0.05). Nevertheless, FO in the diet decresed (P < 0.05) plsm cholesterol of rts y 10% (from 1.19 to 1.07 mmol/l); it ws therefore concluded tht the cholesterol-lowering effect of EPA+DHA is t lest prtly sed on mechnisms other thn tested in the present experiment. Keywords: PPARα; SREBP-2; Insig-1; cholesterol; PUFAn-3; rts INTRODUCTION Effect of the principl components of fish oil (FO), eicospentenoic cid (EPA), nd docoshexenoic cid (DHA) on crdiovsculr diseses risk decrese hs een repetedly reported (Givens nd Gis 2008). The underlying iochemicl nd moleculr mechnisms tht cn explin crdioprotective effects of EPA nd DHA in the rodent models nd humns hve recently een reviewed (Komprd 2012). The effect of EPA/DHA on lood lipid level is sed on the ction of these PUFAs n-3 s lignds of the vrious isoforms of peroxisome prolifertor-ctivted receptor (PPAR), nd on modultion of the signlling pthwy of the trnscription fctor sterol response element-inding protein (SREBP) (Jump 2008). Regrding plsm tricylglycerol (TAG) levels, the protective effect of EPA/DHA is sufficiently explined: PPARα ctivtion nd inhiition of the SREBP-1 signlling pthwy stimultes ftty cid (FA) β-oxidtion nd inhiits FA synthesis with the finl result of decresed serum TAG (Jump 2008). The sitution is much less cler s fr s cholesterol is concerned (Komprd 2012). A principl trnscription fctor inding the promoter region of the genes coding for proteins controlling cholesterol homeostsis (3-hydroxy-3-methyl-glutryl-CoA reductse HMG-CoA-R, low density lipoprotein receptor LDL-R) is SREBP-2 (Nkmur et l. 2004). SREBP-2 relesed from the endoplsmic reticulum nd consequently its ctivtion in the Golgi pprtus is ffected y n mount of protein IIG (insulin-induced gene), product of the Insig Supported y the Internl Grnt Agency of the Mendel University in Brno (Project No. TP 8/2013). 391

2 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): gene (Sto 2010). SREBP-2 is not directly ligted y EPA/DHA; reltionship, still not unequivoclly explined, etween PPARα ligtion nd SREBP-2 ctivtion is presumed (Luci et l. 2007). Konig et l. (2007) suggested presence of PPAR-responsive sequence in the Insig-1 gene promoter. Still not fully explined moleculr mechnisms controlling cholesterol homeostsis re complemented y contrdictory results regrding studies evluting effects of EPA/DHA on plsm totl cholesterol (TC), high density lipoprotein-cholesterol (HDL-C), nd low density lipoprotein-cholesterol (LDL-C) oth in rts nd in humns. Fish oil (FO) in the rt diet decresed plsm TC in most of the recent studies (Lu et l. 2011; Ferrmosc et l. 2012; Xio et l. 2012). On the other hnd, regrding studies in humns, EPA/DHA either reduced TC nd LDL-C (Lopez-Huerts 2009) or incresed oth TC nd LDL-C nd HDL-C (Mki et l. 2003) or no chnge in TC nd slight increses in HDL-C nd LDL-C, respectively were estlished (Eslick et l. 2009). Following hypothesis (sed e.g. on the dt of Konig et l. 2007) ws tested in the present experiment: EPA+DHA (FO constituents), which re nturl lignds of PPARα, ingested y rts in n mount chievle within n ordinry wy of nutrition ctivte this trnscription fctor, which leds to n incresed expression of the Insig-1 gene with consequence of decresed mount of the nucler form of SREBP-2; decresed expression of the Hmgcr nd Ldlr genes ensues, with consequence of decresed cholesterol synthesis nd incresed plsm cholesterol clernce. MATERIAL AND METHODS Animls, diets, nlyzed tissues. Adult (56 dys) mle rts of the lortory strin Wistr Alino (produced y Bio Test Ltd., Konárovice, Czech Repulic) were used. Rts were rndomly divided into three groups with ten nimls ech nd housed in plstic oxes ( cm) per five nimls in room mintined t 23 ± 1 C, humidity 60%, nd 12/12 h light-drk cycle (mximum intensity of 200 lx). The experiments were performed in complince with the Czech Ntionl Council Act No. 246/1992 Coll. to protect nimls ginst cruelty, the mended Act No. 162/1993 Coll., nd were pproved y the Commission to protect nimls ginst cruelty of the Mendel University in Brno. Tle 1. Composition of the diets Composition Component (g/kg) Nutrients (g/kg) Diet C F P sic feed mixture mize strch 67 slmon oil 30 plm oil 30 crude protein ft crude fire nitrogen-free extrctives ME (MJ/kg) C = control diet, F = experimentl diet with fish oil, P = negtive control with plm oil, ME = metolizle energy 1 complete chow for mice nd rts (composition: whet, ot, whet sprouts, soyen mel, extruded soyen, mize, dried milk, dried whey, dried yest, grounded limestone, monoclcium phosphte, feed slt, l-lysine hydrochloride, vitmins, minerls) 2 hexne/2-propnol extrct The sic feed mixture, pelletized complete chow for mice nd rts (Biokron, Blučin, Czech Repulic), ws composed of whet, ot, whet sprouts, soyen mel, extruded soyen, mize, dried milk, dried whey, dried yest, grounded limestone, monoclcium phosphte, feed slt, l-lysine hydrochloride, nd premix of vitmins nd minerls. The experimentl diet ws formed y dmixing of 3% of slmon oil to the chow (F). The chow with 3% of plm oil (P) served s negtive control with presumed cholesterol-incresing effect. The chow with n dequte mount of mize strch to render the diet isocloric ws designted s control (C). Composition of the diets is shown in Tle 1; ftty cid content is presented in Tle 2. The men initil (56 dys) live weight of the C-, F-, nd P-rts ws 368 ± 4, 366 ± 4, nd 373 ± 4 g, respectively. The nimls were fed dily d liitum nd hd free ccess to drinking wter. Feed consumption ws mesured dily; nimls were weighed in weekly intervls. At the end of the experiment lsting 48 dys, fter the 12-h fsting, lood smples were collected y crdic puncture under nesthesi with isoflurne into the heprin-coted test tues nd centrifuged t 200 g t 4 C for 10 min to otin plsm. Liver ws removed nd RNA ws isolted immeditely from n liquot of 1 g. Quntifiction of the gene expression in the liver. Totl RNA ws isolted using RNesy Lipid 392

3 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper Tle 2. Ftty cid content in the diets nd dily intke y rts Ftty cid Content in the diet (% of the sum of ftty cids) Intke (mg per kg of live weight nd dy) (men ± stndrd error of the men) C F P C F P 14: B ± 2 65 c ± 2 30 A ± 1 16: B ± A ± C ± 30 18: B ± 4 73 A ± C ± 4 18:1n A ± B ± C ± 34 18:2n C ± B ± A ± 19 18:3n B ± 2 84 C ± 3 30 A ± 1 20:5n A ± 0 45 B ± 2 0 A ± 0 22:5n A ± 0 26 B ± 1 0 A ± 0 22:6n A ± 0 73 B ± 2 0 A ± 0 C = stndrd chow for mice/rts (control), F = stndrd chow for mice/rts supplemented with 3% of fish oil, P = stndrd chow for mice/rts supplemented with 3% of plm oil A C mens with different superscripts in lines differ t P < 0.05 Tissue Mini Kit (Qigen GmH, Hilden, Germny). The qulity of isoltion ws checked on the 1.2% RNA gel visulized y ethidium romide. Concentrtion of isolted RNA ws mesured on Nno- Drop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Wlthm, USA). Isolted RNA ws stored t 80 C. One μg of the isolted RNA ws reverse trnscried using Omniscript RT Kit (Qigen) nd oligo-dt primers. Otined cdna ws used for quntittive PCR with specific primers for the rt Insig-1 gene (fw TCTTCCCGGACGAGGTGATAG, rev AGCTGCACATTATTGGCGAAAT), Hmgcr gene (fw AAGGGGCGTGCAAAGACAATC, rev ACACGGCACGGAAAGAACCATAGT), Ldlr gene (fw GGACAAGTCGGACGAGGAGAA, rev AGCTGATGCACTCCCCACTGT), PPARα gene (fw GCCTTGTCCCCACATATTCG, rev AGAGGAGAGTTCCGGAAG), SREBP-2 gene (fw ATCCGCCCACACTCACGCTCCTC, rev GGC- CGCATCCCTCGCACTG), nd housekeeping gene Act (fw AGAGGGAAATCGTGCGTGAC, rev GTTTCATGGATGCCACAGGATT). The rection mixture ws s follows: 1 μl of cdna, 0.2 μl of AmpErse Urcyl N-glycosylse (Applied Biosystems, Foster City, USA), 10 μl of Power SYBR Green PCR Mster Mix (Applied Biosystems), 0.2 μl of ech primer (mol/μl), 8.4 μl of H 2 O. All nlyses were crried out on the 7500 Rel-Time PCR System (Applied Biosystems) under the following conditions: 2 min of UNG incution t 50 C, 10 min t 95 C, 40 cycles of 15 s t 95 C, 30 s t specific nneling temperture tht ws either 65 C (expression of the Insig 1 nd Ldlr gene) or 60 C (expression of oth remining genes), nd 30 s t 60 C. Effectivity of ech reverse trnscription rection ws clculted sed on the stndrd curve method using deciml dilution of the input cdna. The specificity of ech PCR frgment ws verified y the sequencing using BigDye Termintor v3.1 Cycle Sequencing Kit nd ABI PRISM 3100-Avnt Genetic Anlyzer (Applied Biosystems). The mesured C T dt were nlyzed y considering the sl condition s the reference vlue for reltive mount of the gene expression determined under ech condition. Chnges in the gene expression were clculted on reltive sis in reltion to the level of expression of given gene in the liver of the control rts. Cholesterol determintion. Totl plsm cholesterol (TC), LDL-cholesterol (LDL-C), HDL-cholesterol (HDL-C), nd plsm tricylglycerol (TAG) were determined y the enzymtic-colourimetric method using n utomted chemicl nlyzer BS- 200 (Mindry, Shenzhen, Chin) nd commercil kits (Greiner Dignostic GmH, Bhlingen, Germny). Ftty cid determintion. Totl lipid extrction from the liver, ftty cid derivtiztion, nd ftty cid determintion were performed strictly ccording to the protocol descried in the pper of Komprd et l. (2013). Sttisticl evlution. One-Wy Anlysis of the Vrince rtio test, including Tukey s post-hoc test (STATISTICA, Version 8, 2007), ws used for evlution of differences etween the dietry 393

4 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): interventions. Reltionships etween tested trits were ssessed using correltion nlysis C F c RESULTS Feed intke, weights. Averge dily feed intke did not differ (P > 0.05) etween dietry groups nd ws 25 ± 2, 23 ± 1, nd 24 ± 2 g/dy in the C-, F-, nd P-rts. Dietry intervention hd no significnt effect (P > 0.05) either on the verge dily weight gin (2.99 ± 0.19, 3.01 ± 0.12, nd 3.25 ± 0.19 g) or on the finl live weight tht reched the vlue of 512 ± 13, 511 ± 9, nd 529 ± 11 g in the C-, F-, nd P-rts, respectively. Gene expression. Reltive expression of the genes coding for PPARα nd SREBP-2 in the liver of the FO-fed rts ws 47% nd 57% s compred to the control; due to the gret vriility of the C T vlues, the differences were insignificnt (P > 0.05). Reltive expression of the Insig-1 gene in the liver of rts fed the diet with 3% of fish oil ws 730% of expression of this gene in the control rts (P < 0.05); however, n ssumption tht n over-expression of the Insig-1 gene leds to down-regultion of the Hmgcr gene nd Ldlr gene, respectively ws not confirmed (Figure 1). Expression of the Hmgcr gene nd Ldlr gene in the liver of the FO-fed rts ws 165% nd Gene expression reltive to control (%) C F P * PPARα SREBP-2 Insig Hmgcr Ldlr Figure 1. Expression of the genes presumly controlling cholesterol homeostsis C = rts fed the control diet (n = 10), F = rts fed the control diet with 3% of fish oil (n = 10), P = rts fed the control diet with 3% of plm oil (n = 10), PPARα = peroxisome prolifertor-ctivted receptor α, SREBP-2 = sterol response element-inding protein 2, Insig-1 = insulin-induced gene-1, Hmgcr = 3-hydroxy-3-methyl-glutryl-CoA reductse, Ldlr = low density lipoprotein receptor *mount of mrna in the smple differed from the control (P < 0.05), mount of mrna in the smple did not differ from the control (P > 0.05) Plsm level (mmol/l) P TC LDLC HDLC TAG Figure 2. Plsm cholesterol nd tricylglycerols (TAG) of rts fed the control diet (C) nd the control diet with either 3% of fish oil (F) or 3% of plm oil (P), respectively (n = 10) TC = totl cholesterol, LDLC = low density lipoprotein cholesterol, HDLC = high density lipoprotein cholesterol c mens with different letters within given trit differ t P < % reltive to the expression of these genes in the liver of the control rts; gin, the differences were insignificnt (P > 0.05) due to the gret vriility of the C T vlues within ech tested group of rts. Plsm cholesterol. Plsm levels of totl cholesterol nd its frctions in LDL nd HDL re shown in Figure 2 (including TAG; however, this mrker ws not nlyzed in more detil from the resons mentioned in Introduction). FO in the diet decresed (P < 0.05) totl plsm cholesterol nd LDL cholesterol in rts y 10 nd 12%, respectively s compred to the control diet; HDL-C ws not chnged y the dietry intervention. Liver ftty cids: reltionships to plsm cholesterol nd gene expression. Ftty cid content in the rt liver is shown in Tle 3. Reltive level of expression of the Insig-1 gene in the liver ws in positive reltionship (P < 0.05) to EPA nd DPA (docospentenoic cid) content in this tissue (r = in oth cses). EPA content in the liver of the rts fed the diet with fish oil ws 13 times higher (P < 0.05) thn in the liver of the control rts (Tle 3). These dt correspond with the differences (P < 0.05) in the Insig-1 gene expression etween the F- nd C-group of rts. On the other hnd, no reltionship (P > 0.05) etween DHA content in the liver nd the Insig-1 gene expression ws estlished. Negtive correltion (P < 0.05) to the Insig-1 gene expression in the liver ws found in the cse of myristic cid (14:0; r = 0.37) nd oleic cid (18:1n-9; r = 0.37). 394

5 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper Tle 3. Ftty cid content in the liver of rts fed the control diet (C) nd the control diet with either 3% of fish oil (F) or 3% of plm oil (P) (men ± stndrd error of the men) Component Reltive expression of the Hmgcr gene correlted positively (P < 0.05) with the liver content of steric cid (18:0; r = +0.24), linolenic cid (18:2n-6; r = +0.31), nd DHA (r = +0.23). Positive correltion (P < 0.05) with liver steric cid (r = +0.25) nd linolenic cid (r = +0.22) nd negtive correltion with liver myristic cid (r = 0.24) ws found in the cse of the Ldlr gene expression. As fr s plsm cholesterol is concerned, oth totl cholesterol nd LDL cholesterol ws negtively (P < 0.05) correlted with liver content of ll tested PUFAn-3 (r = 0.41 to 0.47) nd lso of linoleic cid (r = 0.26). Regrding the reltionship etween expression of the tested genes nd plsm cholesterol, the only significnt (P < 0.05) correltion found ws tht etween the Insig-1 gene nd LDL cholesterol (r = 0.26). DISCUSSION Diet C F P Totl lipid (%) A ± AB ± B ± 0.1 Ftty cid (mg/100 g) 14:0 21 AB ± A ± 1 23 B ± 1 16:0 687 AB ± A ± B ± 13 18:0 360 A ± A ± B ± 10 18:1n A ± A ± A ± 16 18:2n A ± B ± B ± 13 20:4n B ± A ± B ± 14 18:3n-3 7 A ± B ± 1 9 A ± :5n-3 6 A ± B ± 5 4 A ± :5n-3 24 A ± 1 80 B ± 5 22 A ± :6n A ± B ± A ± 3 1 hexne/2-propnol extrct A, B mens with different superscript in lines differ t P < 0.05; Tukey s post-hoc test Feed intke. No significnt effect of the FO ddition in the diet on dily weight gin or finl live weight of rts found in the present experiment ws reported lso y Ymzki et l. (2011) nd Cmpioli et l. (2012). On the other hnd, FO decresed ody weight of rts in n experiment of Lu et l. (2011). Moreover, FO cn hve n ntioesity effect in oese mice (Ari 2009). Dily FO intke in F-group of rts (1.57 g per kg of live weight nd dy) estlished in the present study ws slightly higher thn in the experiment of Ymzki et l. (2011), 1 g/kg of live weight nd dy, which the uthors lelled s lower-dose FO supplementtion. EPA+DHA intke in the F-group of rts ( = 60 mg/dy) ws sustntilly lower in the present study in comprison with the results of Lu et l (169 mg/dy), ut comprle with n experiment of Popovic et l (75 mg/dy). Gene expression. Act gene ws used s n endogenous control in quntittive rel-time PCR in the present study sed on the results of the similr experiments mesuring n effect of dietry PUFA n-3 on expression of genes controlling cholesterol homeostsis (Densupsoontorn et l. 2007; Fernndez- Alvrez et l. 2011; Lecker et l. 2011; Lu et l. 2011): none of the quoted uthors reported ny chnge of this housekeeping gene due to the ddition of n-3 PUFA. The fct tht, similrly to our dt, PPARα gene expression ws not induced in EPA-fed mice in the experiment of Sugiym et l. (2008) ws surprising. PPARα mrna in the n-3 PUFA-fed rts ws similrly unltered in the experiment of Lu et l. (2011). According to Tkhshi (2011), n-3 PUFA re le to directly ind PPARα nd stimulte its ctivity; n increse of the PPARα gene expression is therefore not essentil to stimulte ctivities of the trget enzymes. Nevertheless, Tkhshi (2011) reported higher mount of PPARα mrna in FO-fed rts s compred to plm oil, the results opposite to the present study. Hirko et l. (2010) found PPARα gene expression in FO-fed mice 175% of the control. Regrding SREBP, Cputo et l. (2010), using PPARα ntgonist, rgued tht n effect of EPA/DHA on SREBP-1c expression is not medited through PPARα ction. On the other hnd, Fernndez-Alvrez et l. (2011) reported tht PPAR/RXR heterodimer ctivted SREBP-1c promoter nd PPARα gonist incresed SREBP-1c expression in the rt liver. Though the SREBP-2 mrna in the liver of the FO-fed rts ws less thn 60% of the control in the present study, the differences were not significnt, similrly to n experiment of Hirko et l. (2010), where SREBP-2 expression ws not influenced y FO in mice. On the other hnd, oth Ari et l. (2009) nd Ari et l. (2009) reported decrese of SREBP-2 mrna in EPA/DHA-fed mice. Similrly, SREBP-1c nd SREBP-1 mrna decresed in the liver of the FO-fed rts (Tkhshi 2011) nd n-3 PUFA-fed rts (Lu et l. 2011), respectively. SREBP-2 protein ws not quntified in the present study, similrly to the experiments of Ari et 395

6 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): l. (2009, ) nd Hirko et l. (2010). However, Sugiym et l. (2008), who lso reported no effect of EPA on SREBP-2 gene expression in mice, found highly reduced protein mount of the mture SREBP-2; the uthors (Sugiym et l. 2008) dmitted their unsuccessful identifiction of the key molecules mediting EPA function on SREBP-2 processing, ut suggested post-trnscriptionl suppression of SREBP-2 y EPA in the presence of PPARα. Lu et l. (2011) found decrese of n mount of oth the precursor nd the nucler SREBP-1 protein in their experiment. It is worthy to mention in this context n effect of concentrtion: Cputo et l. (2010) reported decrese of oth SREBP-1 mrna nd SREBP-1 protein in humn heptom treted with EPA/DHA, ut only in concentrtion of 50μM nd not in concentrtion of 25μM. The up-regultion of the Insig-1 gene y FO in the present experiment (Figure 1) grees with the dt of Konig et l. (2007) who found incresed Insig-1 gene expression in the rt heptom cell line fter ctivtion of PPARα. Similrly, Botolin et l. (2006) reported trnsiently induced Insig-1 mrna in rt heptocytes fter DHA tretment. On the other hnd, the recent experiments testing n effect of FO on the gene expression in mice (Ari et l. 2009, ; Hirko et l. 2010) found decresed Insig-1 gene expression. The results of the present experiment regrding rt liver Hmgcr gene (Figure 1) do not gree with the dt found in mice, where Hmgcr gene expression ws decresed y EPA/DHA (Ari et l. 2009), y menhden oil (EPA) (Ari et l. 2009), y FO (Hirko et l. 2010) or y EPA lone (Sugiym et l. 2008). On the other hnd, only tun oil (DHA), ut not menhden oil (EPA) decresed expression of Ldlr in the study of Ari et l. (2009). Plsm cholesterol. Plsm TC level of the FOfed rts in the present experiment (1.07 mmol/l; Figure 2) is pproximtely in the middle of the rnge of the results of similr experiments (FO-fed rts; ll dt reclculted to mmol/l): 3.22 (Lu et l. 2011) 2.45 (Ferrmosc et l. 2012) 2.36 (Xio et l. 2012) 2.04 (Cmpioli et l. 2012) 1.01 (Ymzki et l. 2011) 0.98 (Tkhshi 2011) 0.54 (Popovic et l. 2011). The sme is true regrding plsm LDL-C in the present experiment (0.75 mmol/l; Figure 2): the results of the similr experiments with the FO-fed rts re etween 1.84 mmol/l (Xio et l. 2012) nd 0.23 mmol/l (Popovic et l. 2011), the vlue reported y Cmpioli et l (0.81 mmol/l) eing very similr to our dt. Pulished dt regrding HDL-C lso vry conspicuously etween 1.11 mmol/l (Ferrmosc et l. 2012) nd 0.17 mmol/l (Popovic et l. 2011), with the level found in the present experiment (0.35 mmol/l) pproximtely in the middle. Tking into ccount possile methodicl incomptiilities of the pulished ppers (direct determintion of ll cholesterol frctions using preprtive ultrcentrifugtion or clcultion of the LDL-C frction; reclirtion of the commercil pprtuses usully designed for determintion of humn smples for the rt plsm smples or lck of thereof), more importnt thn the comprison of the solute vlues re likely the differences etween plsm mrkers of the FO-fed rts nd the control rts found within given experiment. Similrly to the present study (Figure 2), FO in the rt diet decresed plsm TC lso in most of the recent studies (Lu et l. 2011; Tkhshi 2011; Cmpioli et l. 2012; Ferrmosc et l. 2012; Xio et l. 2012). However, Ymzki et l. (2011) nd Cmpioli et l. (2012) did not find differences in TC etween the FO-fed rts nd the control rts. A possile reson in the cse of the experiment of Ymzki et l. (2011) ws low FO intke (1 g per kg of live weight nd dy); however, FO intke ws only slightly higher in the present experiment (1.57 g per kg of live weight nd dy). According to Konig et l. (2007), plsm cholesterol in rts is decresed due to the PPARα ctivtion nd ensuing SREBP-2 reduction, which leds to decresed cholesterol synthesis; Sugiym et l. (2008) mention TC decrese in mice only in the presence of PPARα (in the wild-type mice, ut not in the PPARα null mice). Another explntion of the plsm cholesterol reduction in rts y FO is the possiility tht FO fcilittes in the liver cholesterol secretion into ile cids due to the up-regultion of the cholesterol trnsporters (Tkhshi 2011). Sugiym et l. (2008) concluded tht prt from cholesterol iosynthesis, mny other mechnisms prticipte in cholesterol homeostsis (ile cid synthesis, ile secretion) nd the mechnism of the hypocholesterolemic effect of EPA is not fully understood (though it is different from firtes). Moreover, TC decrese in some experiments of this type (n-3 PUFA-fed rts) need not e due to n-3 PUFA t ll, ut e.g. due to different qulities of micronutrients: ddition of the cold-pressed flxseed 396

7 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper oil to rt diet decresed plsm TC in comprison with the control rts fed diet with totlly refined flxseed oil in n experiment of Xio et l. (2012). Conclusions of Rmprsth et l. (2012) tht PUFA-rich diets decrese plsm totl cholesterol (in this cse in humns) independently of chnges in cholesterol sorption or synthesis re in greement with our dt, nmely the FO tendency to up-regulte rt liver Ldlr nd Hmgcr gene, respectively (Figure 1). Becuse the method of LDL-C determintion is not cler from most of other similr ppers, only HDL cholesterol frction is discussed. In summry, the results of experiments evluting n effect of FO on HDL-C in rodents re miguous. Both Ymzki et l. (2011) nd Cmpioli et l. (2012) did not find difference in plsm HDL-C in the FO-fed nd the control rts, similrly to our dt. On the other hnd, Popovic et l. (2011) nd Xio et l. (2012) reported n increse of this mrker in the rt plsm fter FO intke. Contrry to the ove-mentioned results, Tkhshi (2011) found decrese of this prmeter from 1.56 mmol/l (plm oil-fed rts) to 0.58 mmol/l (FO group). Similr conclusions reported lso Kmisko et l. (2012) in mice fed diet with FO in comprison with soyen oil-fed control: FO decresed plsm HDL-C from 1.50 to 0.56 mmol/l. As fr s n interspecies comprison is concerned, n increse of HDL-C due to EPA/DHA intke follows from humn clinicl studies (metnlysis of Jcoson et l. 2012). Zhng et l. (2009) suggest in this context tht hmsters re etter model thn rts for studying plsm cholesterol-lowering effect of functionl foods ecuse they synthesize nd excrete cholesterol (nd ile cids) in mnner similr to humns. CONCLUSION Regrding the hypothesis tested in the present experiment (EPA+DHA increse expression of the Insig-1 gene in the rt liver, which leds to suppression of the Hmgcr gene nd Ldlr gene with consequence of decresed plsm cholesterol), only the first nd the lst step ws confirmed. Therefore, it cn e concluded tht the cholesterol lowering effect of fish oil is t lest prtly sed on mechnisms other thn tested here. However, the inconclusive results of the present study gree with often contrdictory literture dt discussing ll steps of the puttive signlling pthwy from EPA/DHA to plsm cholesterol oth in rodents nd in humns, including the sttement tht mechnism of hypocholesterolemic effect of EPA/DHA in rodents (nd humns) hs still not een fully understood. Acknowledgement. The uthors wish to thnk Dr. Jiří Sochor for technicl ssistnce. REFERENCES Ari T., Kim H.J., Chi H., Mtsumoto A. (2009): Antioesity effect of fish oil nd fish oil-fenofirte comintion in femle KK mice. Journl of Atherosclerosis nd Thromosis, 16, Ari T., Kim H.J., Chi H., Mtsumoto A. (2009): Interction of fenofirte nd fish oil in reltion to lipid metolism in mice. Journl of Atherosclerosis nd Thromosis, 16, Botolin D., Wng Y., Christin B., Jump D.B. (2006): Docoshexenoic cid (22:6, n-3) regultes rt heptocyte SREBP-1 nucler undnce y Erk- nd 26S protesome-dependent pthwys. Journl of Lipid Reserch, 47, Cmpioli E., Rustichelli C., Avllone R. (2012): N-3 dietry supplementtion nd lipid metolism: differences etween vegetle- nd fish-derived oils. Journl of Functionl Foods, 4, Cputo M., Zirpoli H., Torino G., Tecce M. (2010): Selective regultion of UGT1A1 nd SREBP-1c mrna expression y docoshexenoic, eicospentenoic, nd rchidonic cids. Journl of Cellulr Physiology, 226, Densupsoontorn N., Worgll T.S., Seo T., Hmi H., Deckelum J. (2007): Ftty cid supplied s triglyceride regultes SRE-medited gene expression s efficiently s free ftty cids. Lipids, 42, Eslick G.D., Howe P.R.C., Smith C., Priest R., Bensoussn A. (2009): Benefits of fish oil supplementtion in hyperlipidemi: systemtic review nd met-nlysis. Interntionl Journl of Crdiology, 136, Fernndez-Alvrez A., Alvrez M.S., Gonzlez R., Cucrell C., Muntne J., Csdo M. (2011): Humn SREBP1c expression in liver is directly regulted y peroxisome prolifertor-ctivted receptor α (PPARα). Journl of Biologicl Chemistry, 286, Ferrmosc A., Conte L., Zr V. (2012): A krill oil supplemented diet reduces the ctivities of the mitochondril tricroxylte crrier nd of the cytosolic lipogenic enzymes in rts. Journl of Animl Physiology nd Animl Nutrition, 96, Givens D.I., Gis R.A. (2008): Current intkes of EPA nd DHA in Europen popultions nd the potentil of nimlderived foods to increse them. Proceedings of the Nutrition Society, 67,

8 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): Hirko S., Kim H.J., Ari T., Chi H., Mtsumoto A. (2010): Effect of concomitntly used fish oil nd cholesterol on lipid metolism. Journl of Nutritionl Biochemistry, 21, Jcoson T.A., Glickstein S.B., Rowe J.D., Soni P.N. (2012): Effects of eicospentenoic cid nd docoshexenoic cid on low-density lipoprotein cholesterol nd other lipids: review. Journl of Clinicl Lipidology, 6, Jump D.B. (2008): N-3 polyunsturted ftty cid regultion of heptic gene trnscription. Current Opinion in Lipidology, 19, Kmisko T., Tnk Y., Iked T., Ymmoto K., Ogw H. (2012): Dietry fish oil regultes gene expression of cholesterol nd ile cid trnsporters in mice. Heptology Reserch, 42, Komprd T. (2012): Eicospentenoic nd docoshexenoic cids s inflmmtion-modulting nd lipid homeostsis influencing nutrceuticls: review. Journl of Functionl Foods, 4, Komprd T., Zornikov G., Rozikov V., Borkovcov M., Przywrov A. (2013): The effect of dietry Slvi hispnic seed on the content of n-3 long-chin polyunsturted ftty cids in tissues of selected niml species, including edile insects. Journl of Food Composition nd Anlysis, 32, Konig B., Koch A., Spielmnn J., Hilgenfeld C., Stngl G.I., Eder K. (2007): Activtion of PPARα lowers synthesis nd concentrtion of cholesterol y reduction of nucler SREBP-2. Biochemicl Phrmcology, 73, Lecker J., Mtthn N.R., Billheimer J.T., Rder D.J., Lichtenstein A.H. (2011): Chnges in cholesterol homeostsis modify the response of F1B hmsters to dietry very long chin n-3 nd n-6 polyunsturted ftty cids. Lipids in Helth nd Disese, 10:186. Lopez-Huerts E. (2009): Helth effects of oleic cid nd long chin omeg-3 ftty cids (EPA nd DHA) enriched milks. A review of intervention studies. Phrmcologicl Reserch, 61, Lu J., Borthwick F., Hssnli Z., Wng Y., Mngt R., Ruth M., Shi D., Jeschke A., Russel J.C., Field C.J., Proctor S.D., Vine D.F. (2011): Chronic dietry n-3 PUFA intervention improves dislipidemi nd susequent crdiovsculr complictions in the JSR:LA-cp rt model of the metolic syndrome. British Journl of Nutrition, 105, Luci S., Konig B., Giems B., Huer S., Huse G., Kluge H., Stngl G.I., Eder K. (2007): Feeding of deep-fried ft cuses PPARα ctivtion in the liver of pigs s non-proliferting species. British Journl of Nutrition, 97, Mki K.C., Vn Elswyk M.E., McCrthy D., Seeley M.A., Veith P.E., Hess S.P., Ingrm K.A., Hlvorson J.J., Clgus E.M., Dvidson M.H. (2003): Lipid responses in mildly hypertriglyceridemic men nd women to consumption of docoshexenoic cid-enriched eggs. Interntionl Journl for Vitmin nd Nutrition Reserch, 73, Nkmur M.T., Cheon Y., Li Y., Nr T.Y. (2004): Mechnisms of regultion of gene expression y ftty cids. Lipids, 39, Popovic T., Borozn S., Arsic A., Deeljk-Mrtcic J., Vucic V., de Luk S., Milovnovic I., Trovic A., Glietic M. (2011): Effects of n-3 supplementtion on plsm nd liver phospholipid ftty cids profile in ged Wistr rts. Crotic Chemic Act, 84, Rmprsth V.R., Jones P.J.H., Buckley D.D., Woollett L.A., Heui J.E. (2012): Decresed plsm cholesterol concentrtions fter PUFA-rich diets re not due to reduced cholesterol sorption/synthesis. Lipids, 47, Sto R. (2010): Sterol metolism nd SREBP ctivtion. Archives of Biochemistry nd Biophysics, 501, Sugiym E., Ishikw Y., Li Y., Kgi T., Noyshi M., Tnk N., Kmijo Y., Yokoym S., Hr A., Aoym T. (2008): Eicospentenoic cid lowers plsm nd liver cholesterol levels in the presence of peroxisome prolifertors-ctivted receptor lph. Life Sciences, 83, Tkhshi Y. (2011): Soy protein nd fish oil independently decrese serum lipid concentrtions ut interctively reduce heptic enzymtic ctivity nd gene expression involved in ftty cid synthesis in rts. Journl of Nutritionl Science nd Vitminology, 57, Xio Y., Qinchun G., Jiqu X., Fenghong G., Qingde H., Zhihu Y., Jine Y. (2012): Effects of cold-pressed nd vitmin E- enriched flxseed oils on lipid profile nd ntioxidnt sttus in high-ft fed rts. Europen Journl of Lipid Science nd Technology, 114, Ymzki R.K., Brito G.A.P., Coelho I., Pequitto D.C.T., Ymguchi A.A., Borghetti G., Schiessel D.L., Kryczyk M., Mchdo J., Roch R.E.R., Aikw J., Igher F., Nliwko K., Tnhoffer R.A., Nunes N.A., Fernndes L.C. (2011): Low fish oil intke improves insulin sensitivity, lipid profile nd muscle metolism on insulin resistnt MSG-oese rts. Lipids in Helth nd Disese, 10, 66. Zhng Z., Wng H., Jio R., Peng C., Wong Y.M., Yeung V.S.Y., Hung Y., Chen Z.-Y. (2009): Choosing hmsters ut not rts s model for studying plsm cholesterol-lowering ctivity of functionl foods. Moleculr Nutrition nd Food Reserch, 53, Received: Accepted fter corrections: Corresponding Author Prof. MVDr. Ing. Tomáš Komprd, CSc., Mendel University in Brno, Deprtment of Food Technology, Zemědělská 1, Brno, Czech Repulic Phone: , e-mil: komprd@mendelu.cz 398