Czech J. Anim. Sci., 59, 2014 (9):

Size: px
Start display at page:

Download "Czech J. Anim. Sci., 59, 2014 (9): 391 398"


1 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper Effect of dietry eicospentenoic nd docoshexenoic cid on expression of rt liver genes controlling cholesterol homeostsis nd on plsm cholesterol level T. Komprd 1, G. Zorníková 1, A. Knoll 2,3, Z. Vykouklová 2, V. Rozíková 1, O. Škultéty 2, R. Kroot 4 1 Deprtment of Food Technology, Mendel University in Brno, Brno, Czech Repulic 2 Deprtment of Animl Morphology, Physiology nd Genetics, Mendel University in Brno, Brno, Czech Repulic 3 CEITEC MENDELU, Mendel University in Brno, Brno, Czech Repulic 4 Deprtment of Animl Nutrition nd Forge Production, Mendel University in Brno, Brno, Czech Repulic ABSTRACT: A hypothesis tht eicospentenoic cid + docoshexenoic cid (EPA+DHA) lower plsm cholesterol vi incresed expression of the Insig-1 gene with ensuing decrese of expression of genes coding for 3-hydroxy-3-methyl-glutryl-CoA reductse (Hmgcr) nd low density lipoprotein receptor (Ldlr) ws tested in rts fed diet with 3% of fish oil (FO). Expression of the Insig-1 gene in the liver of the FO-fed rts ws 730% (P < 0.05) of the control. However, contrry to the hypothesis, expression of the Hmgcr gene nd Ldlr gene ws 165% nd 210% of the control (P > 0.05). Nevertheless, FO in the diet decresed (P < 0.05) plsm cholesterol of rts y 10% (from 1.19 to 1.07 mmol/l); it ws therefore concluded tht the cholesterol-lowering effect of EPA+DHA is t lest prtly sed on mechnisms other thn tested in the present experiment. Keywords: PPARα; SREBP-2; Insig-1; cholesterol; PUFAn-3; rts INTRODUCTION Effect of the principl components of fish oil (FO), eicospentenoic cid (EPA), nd docoshexenoic cid (DHA) on crdiovsculr diseses risk decrese hs een repetedly reported (Givens nd Gis 2008). The underlying iochemicl nd moleculr mechnisms tht cn explin crdioprotective effects of EPA nd DHA in the rodent models nd humns hve recently een reviewed (Komprd 2012). The effect of EPA/DHA on lood lipid level is sed on the ction of these PUFAs n-3 s lignds of the vrious isoforms of peroxisome prolifertor-ctivted receptor (PPAR), nd on modultion of the signlling pthwy of the trnscription fctor sterol response element-inding protein (SREBP) (Jump 2008). Regrding plsm tricylglycerol (TAG) levels, the protective effect of EPA/DHA is sufficiently explined: PPARα ctivtion nd inhiition of the SREBP-1 signlling pthwy stimultes ftty cid (FA) β-oxidtion nd inhiits FA synthesis with the finl result of decresed serum TAG (Jump 2008). The sitution is much less cler s fr s cholesterol is concerned (Komprd 2012). A principl trnscription fctor inding the promoter region of the genes coding for proteins controlling cholesterol homeostsis (3-hydroxy-3-methyl-glutryl-CoA reductse HMG-CoA-R, low density lipoprotein receptor LDL-R) is SREBP-2 (Nkmur et l. 2004). SREBP-2 relesed from the endoplsmic reticulum nd consequently its ctivtion in the Golgi pprtus is ffected y n mount of protein IIG (insulin-induced gene), product of the Insig Supported y the Internl Grnt Agency of the Mendel University in Brno (Project No. TP 8/2013). 391

2 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): gene (Sto 2010). SREBP-2 is not directly ligted y EPA/DHA; reltionship, still not unequivoclly explined, etween PPARα ligtion nd SREBP-2 ctivtion is presumed (Luci et l. 2007). Konig et l. (2007) suggested presence of PPAR-responsive sequence in the Insig-1 gene promoter. Still not fully explined moleculr mechnisms controlling cholesterol homeostsis re complemented y contrdictory results regrding studies evluting effects of EPA/DHA on plsm totl cholesterol (TC), high density lipoprotein-cholesterol (HDL-C), nd low density lipoprotein-cholesterol (LDL-C) oth in rts nd in humns. Fish oil (FO) in the rt diet decresed plsm TC in most of the recent studies (Lu et l. 2011; Ferrmosc et l. 2012; Xio et l. 2012). On the other hnd, regrding studies in humns, EPA/DHA either reduced TC nd LDL-C (Lopez-Huerts 2009) or incresed oth TC nd LDL-C nd HDL-C (Mki et l. 2003) or no chnge in TC nd slight increses in HDL-C nd LDL-C, respectively were estlished (Eslick et l. 2009). Following hypothesis (sed e.g. on the dt of Konig et l. 2007) ws tested in the present experiment: EPA+DHA (FO constituents), which re nturl lignds of PPARα, ingested y rts in n mount chievle within n ordinry wy of nutrition ctivte this trnscription fctor, which leds to n incresed expression of the Insig-1 gene with consequence of decresed mount of the nucler form of SREBP-2; decresed expression of the Hmgcr nd Ldlr genes ensues, with consequence of decresed cholesterol synthesis nd incresed plsm cholesterol clernce. MATERIAL AND METHODS Animls, diets, nlyzed tissues. Adult (56 dys) mle rts of the lortory strin Wistr Alino (produced y Bio Test Ltd., Konárovice, Czech Repulic) were used. Rts were rndomly divided into three groups with ten nimls ech nd housed in plstic oxes ( cm) per five nimls in room mintined t 23 ± 1 C, humidity 60%, nd 12/12 h light-drk cycle (mximum intensity of 200 lx). The experiments were performed in complince with the Czech Ntionl Council Act No. 246/1992 Coll. to protect nimls ginst cruelty, the mended Act No. 162/1993 Coll., nd were pproved y the Commission to protect nimls ginst cruelty of the Mendel University in Brno. Tle 1. Composition of the diets Composition Component (g/kg) Nutrients (g/kg) Diet C F P sic feed mixture mize strch 67 slmon oil 30 plm oil 30 crude protein ft crude fire nitrogen-free extrctives ME (MJ/kg) C = control diet, F = experimentl diet with fish oil, P = negtive control with plm oil, ME = metolizle energy 1 complete chow for mice nd rts (composition: whet, ot, whet sprouts, soyen mel, extruded soyen, mize, dried milk, dried whey, dried yest, grounded limestone, monoclcium phosphte, feed slt, l-lysine hydrochloride, vitmins, minerls) 2 hexne/2-propnol extrct The sic feed mixture, pelletized complete chow for mice nd rts (Biokron, Blučin, Czech Repulic), ws composed of whet, ot, whet sprouts, soyen mel, extruded soyen, mize, dried milk, dried whey, dried yest, grounded limestone, monoclcium phosphte, feed slt, l-lysine hydrochloride, nd premix of vitmins nd minerls. The experimentl diet ws formed y dmixing of 3% of slmon oil to the chow (F). The chow with 3% of plm oil (P) served s negtive control with presumed cholesterol-incresing effect. The chow with n dequte mount of mize strch to render the diet isocloric ws designted s control (C). Composition of the diets is shown in Tle 1; ftty cid content is presented in Tle 2. The men initil (56 dys) live weight of the C-, F-, nd P-rts ws 368 ± 4, 366 ± 4, nd 373 ± 4 g, respectively. The nimls were fed dily d liitum nd hd free ccess to drinking wter. Feed consumption ws mesured dily; nimls were weighed in weekly intervls. At the end of the experiment lsting 48 dys, fter the 12-h fsting, lood smples were collected y crdic puncture under nesthesi with isoflurne into the heprin-coted test tues nd centrifuged t 200 g t 4 C for 10 min to otin plsm. Liver ws removed nd RNA ws isolted immeditely from n liquot of 1 g. Quntifiction of the gene expression in the liver. Totl RNA ws isolted using RNesy Lipid 392

3 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper Tle 2. Ftty cid content in the diets nd dily intke y rts Ftty cid Content in the diet (% of the sum of ftty cids) Intke (mg per kg of live weight nd dy) (men ± stndrd error of the men) C F P C F P 14: B ± 2 65 c ± 2 30 A ± 1 16: B ± A ± C ± 30 18: B ± 4 73 A ± C ± 4 18:1n A ± B ± C ± 34 18:2n C ± B ± A ± 19 18:3n B ± 2 84 C ± 3 30 A ± 1 20:5n A ± 0 45 B ± 2 0 A ± 0 22:5n A ± 0 26 B ± 1 0 A ± 0 22:6n A ± 0 73 B ± 2 0 A ± 0 C = stndrd chow for mice/rts (control), F = stndrd chow for mice/rts supplemented with 3% of fish oil, P = stndrd chow for mice/rts supplemented with 3% of plm oil A C mens with different superscripts in lines differ t P < 0.05 Tissue Mini Kit (Qigen GmH, Hilden, Germny). The qulity of isoltion ws checked on the 1.2% RNA gel visulized y ethidium romide. Concentrtion of isolted RNA ws mesured on Nno- Drop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Wlthm, USA). Isolted RNA ws stored t 80 C. One μg of the isolted RNA ws reverse trnscried using Omniscript RT Kit (Qigen) nd oligo-dt primers. Otined cdna ws used for quntittive PCR with specific primers for the rt Insig-1 gene (fw TCTTCCCGGACGAGGTGATAG, rev AGCTGCACATTATTGGCGAAAT), Hmgcr gene (fw AAGGGGCGTGCAAAGACAATC, rev ACACGGCACGGAAAGAACCATAGT), Ldlr gene (fw GGACAAGTCGGACGAGGAGAA, rev AGCTGATGCACTCCCCACTGT), PPARα gene (fw GCCTTGTCCCCACATATTCG, rev AGAGGAGAGTTCCGGAAG), SREBP-2 gene (fw ATCCGCCCACACTCACGCTCCTC, rev GGC- CGCATCCCTCGCACTG), nd housekeeping gene Act (fw AGAGGGAAATCGTGCGTGAC, rev GTTTCATGGATGCCACAGGATT). The rection mixture ws s follows: 1 μl of cdna, 0.2 μl of AmpErse Urcyl N-glycosylse (Applied Biosystems, Foster City, USA), 10 μl of Power SYBR Green PCR Mster Mix (Applied Biosystems), 0.2 μl of ech primer (mol/μl), 8.4 μl of H 2 O. All nlyses were crried out on the 7500 Rel-Time PCR System (Applied Biosystems) under the following conditions: 2 min of UNG incution t 50 C, 10 min t 95 C, 40 cycles of 15 s t 95 C, 30 s t specific nneling temperture tht ws either 65 C (expression of the Insig 1 nd Ldlr gene) or 60 C (expression of oth remining genes), nd 30 s t 60 C. Effectivity of ech reverse trnscription rection ws clculted sed on the stndrd curve method using deciml dilution of the input cdna. The specificity of ech PCR frgment ws verified y the sequencing using BigDye Termintor v3.1 Cycle Sequencing Kit nd ABI PRISM 3100-Avnt Genetic Anlyzer (Applied Biosystems). The mesured C T dt were nlyzed y considering the sl condition s the reference vlue for reltive mount of the gene expression determined under ech condition. Chnges in the gene expression were clculted on reltive sis in reltion to the level of expression of given gene in the liver of the control rts. Cholesterol determintion. Totl plsm cholesterol (TC), LDL-cholesterol (LDL-C), HDL-cholesterol (HDL-C), nd plsm tricylglycerol (TAG) were determined y the enzymtic-colourimetric method using n utomted chemicl nlyzer BS- 200 (Mindry, Shenzhen, Chin) nd commercil kits (Greiner Dignostic GmH, Bhlingen, Germny). Ftty cid determintion. Totl lipid extrction from the liver, ftty cid derivtiztion, nd ftty cid determintion were performed strictly ccording to the protocol descried in the pper of Komprd et l. (2013). Sttisticl evlution. One-Wy Anlysis of the Vrince rtio test, including Tukey s post-hoc test (STATISTICA, Version 8, 2007), ws used for evlution of differences etween the dietry 393

4 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): interventions. Reltionships etween tested trits were ssessed using correltion nlysis C F c RESULTS Feed intke, weights. Averge dily feed intke did not differ (P > 0.05) etween dietry groups nd ws 25 ± 2, 23 ± 1, nd 24 ± 2 g/dy in the C-, F-, nd P-rts. Dietry intervention hd no significnt effect (P > 0.05) either on the verge dily weight gin (2.99 ± 0.19, 3.01 ± 0.12, nd 3.25 ± 0.19 g) or on the finl live weight tht reched the vlue of 512 ± 13, 511 ± 9, nd 529 ± 11 g in the C-, F-, nd P-rts, respectively. Gene expression. Reltive expression of the genes coding for PPARα nd SREBP-2 in the liver of the FO-fed rts ws 47% nd 57% s compred to the control; due to the gret vriility of the C T vlues, the differences were insignificnt (P > 0.05). Reltive expression of the Insig-1 gene in the liver of rts fed the diet with 3% of fish oil ws 730% of expression of this gene in the control rts (P < 0.05); however, n ssumption tht n over-expression of the Insig-1 gene leds to down-regultion of the Hmgcr gene nd Ldlr gene, respectively ws not confirmed (Figure 1). Expression of the Hmgcr gene nd Ldlr gene in the liver of the FO-fed rts ws 165% nd Gene expression reltive to control (%) C F P * PPARα SREBP-2 Insig Hmgcr Ldlr Figure 1. Expression of the genes presumly controlling cholesterol homeostsis C = rts fed the control diet (n = 10), F = rts fed the control diet with 3% of fish oil (n = 10), P = rts fed the control diet with 3% of plm oil (n = 10), PPARα = peroxisome prolifertor-ctivted receptor α, SREBP-2 = sterol response element-inding protein 2, Insig-1 = insulin-induced gene-1, Hmgcr = 3-hydroxy-3-methyl-glutryl-CoA reductse, Ldlr = low density lipoprotein receptor *mount of mrna in the smple differed from the control (P < 0.05), mount of mrna in the smple did not differ from the control (P > 0.05) Plsm level (mmol/l) P TC LDLC HDLC TAG Figure 2. Plsm cholesterol nd tricylglycerols (TAG) of rts fed the control diet (C) nd the control diet with either 3% of fish oil (F) or 3% of plm oil (P), respectively (n = 10) TC = totl cholesterol, LDLC = low density lipoprotein cholesterol, HDLC = high density lipoprotein cholesterol c mens with different letters within given trit differ t P < % reltive to the expression of these genes in the liver of the control rts; gin, the differences were insignificnt (P > 0.05) due to the gret vriility of the C T vlues within ech tested group of rts. Plsm cholesterol. Plsm levels of totl cholesterol nd its frctions in LDL nd HDL re shown in Figure 2 (including TAG; however, this mrker ws not nlyzed in more detil from the resons mentioned in Introduction). FO in the diet decresed (P < 0.05) totl plsm cholesterol nd LDL cholesterol in rts y 10 nd 12%, respectively s compred to the control diet; HDL-C ws not chnged y the dietry intervention. Liver ftty cids: reltionships to plsm cholesterol nd gene expression. Ftty cid content in the rt liver is shown in Tle 3. Reltive level of expression of the Insig-1 gene in the liver ws in positive reltionship (P < 0.05) to EPA nd DPA (docospentenoic cid) content in this tissue (r = in oth cses). EPA content in the liver of the rts fed the diet with fish oil ws 13 times higher (P < 0.05) thn in the liver of the control rts (Tle 3). These dt correspond with the differences (P < 0.05) in the Insig-1 gene expression etween the F- nd C-group of rts. On the other hnd, no reltionship (P > 0.05) etween DHA content in the liver nd the Insig-1 gene expression ws estlished. Negtive correltion (P < 0.05) to the Insig-1 gene expression in the liver ws found in the cse of myristic cid (14:0; r = 0.37) nd oleic cid (18:1n-9; r = 0.37). 394

5 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper Tle 3. Ftty cid content in the liver of rts fed the control diet (C) nd the control diet with either 3% of fish oil (F) or 3% of plm oil (P) (men ± stndrd error of the men) Component Reltive expression of the Hmgcr gene correlted positively (P < 0.05) with the liver content of steric cid (18:0; r = +0.24), linolenic cid (18:2n-6; r = +0.31), nd DHA (r = +0.23). Positive correltion (P < 0.05) with liver steric cid (r = +0.25) nd linolenic cid (r = +0.22) nd negtive correltion with liver myristic cid (r = 0.24) ws found in the cse of the Ldlr gene expression. As fr s plsm cholesterol is concerned, oth totl cholesterol nd LDL cholesterol ws negtively (P < 0.05) correlted with liver content of ll tested PUFAn-3 (r = 0.41 to 0.47) nd lso of linoleic cid (r = 0.26). Regrding the reltionship etween expression of the tested genes nd plsm cholesterol, the only significnt (P < 0.05) correltion found ws tht etween the Insig-1 gene nd LDL cholesterol (r = 0.26). DISCUSSION Diet C F P Totl lipid (%) A ± AB ± B ± 0.1 Ftty cid (mg/100 g) 14:0 21 AB ± A ± 1 23 B ± 1 16:0 687 AB ± A ± B ± 13 18:0 360 A ± A ± B ± 10 18:1n A ± A ± A ± 16 18:2n A ± B ± B ± 13 20:4n B ± A ± B ± 14 18:3n-3 7 A ± B ± 1 9 A ± :5n-3 6 A ± B ± 5 4 A ± :5n-3 24 A ± 1 80 B ± 5 22 A ± :6n A ± B ± A ± 3 1 hexne/2-propnol extrct A, B mens with different superscript in lines differ t P < 0.05; Tukey s post-hoc test Feed intke. No significnt effect of the FO ddition in the diet on dily weight gin or finl live weight of rts found in the present experiment ws reported lso y Ymzki et l. (2011) nd Cmpioli et l. (2012). On the other hnd, FO decresed ody weight of rts in n experiment of Lu et l. (2011). Moreover, FO cn hve n ntioesity effect in oese mice (Ari 2009). Dily FO intke in F-group of rts (1.57 g per kg of live weight nd dy) estlished in the present study ws slightly higher thn in the experiment of Ymzki et l. (2011), 1 g/kg of live weight nd dy, which the uthors lelled s lower-dose FO supplementtion. EPA+DHA intke in the F-group of rts ( = 60 mg/dy) ws sustntilly lower in the present study in comprison with the results of Lu et l (169 mg/dy), ut comprle with n experiment of Popovic et l (75 mg/dy). Gene expression. Act gene ws used s n endogenous control in quntittive rel-time PCR in the present study sed on the results of the similr experiments mesuring n effect of dietry PUFA n-3 on expression of genes controlling cholesterol homeostsis (Densupsoontorn et l. 2007; Fernndez- Alvrez et l. 2011; Lecker et l. 2011; Lu et l. 2011): none of the quoted uthors reported ny chnge of this housekeeping gene due to the ddition of n-3 PUFA. The fct tht, similrly to our dt, PPARα gene expression ws not induced in EPA-fed mice in the experiment of Sugiym et l. (2008) ws surprising. PPARα mrna in the n-3 PUFA-fed rts ws similrly unltered in the experiment of Lu et l. (2011). According to Tkhshi (2011), n-3 PUFA re le to directly ind PPARα nd stimulte its ctivity; n increse of the PPARα gene expression is therefore not essentil to stimulte ctivities of the trget enzymes. Nevertheless, Tkhshi (2011) reported higher mount of PPARα mrna in FO-fed rts s compred to plm oil, the results opposite to the present study. Hirko et l. (2010) found PPARα gene expression in FO-fed mice 175% of the control. Regrding SREBP, Cputo et l. (2010), using PPARα ntgonist, rgued tht n effect of EPA/DHA on SREBP-1c expression is not medited through PPARα ction. On the other hnd, Fernndez-Alvrez et l. (2011) reported tht PPAR/RXR heterodimer ctivted SREBP-1c promoter nd PPARα gonist incresed SREBP-1c expression in the rt liver. Though the SREBP-2 mrna in the liver of the FO-fed rts ws less thn 60% of the control in the present study, the differences were not significnt, similrly to n experiment of Hirko et l. (2010), where SREBP-2 expression ws not influenced y FO in mice. On the other hnd, oth Ari et l. (2009) nd Ari et l. (2009) reported decrese of SREBP-2 mrna in EPA/DHA-fed mice. Similrly, SREBP-1c nd SREBP-1 mrna decresed in the liver of the FO-fed rts (Tkhshi 2011) nd n-3 PUFA-fed rts (Lu et l. 2011), respectively. SREBP-2 protein ws not quntified in the present study, similrly to the experiments of Ari et 395

6 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): l. (2009, ) nd Hirko et l. (2010). However, Sugiym et l. (2008), who lso reported no effect of EPA on SREBP-2 gene expression in mice, found highly reduced protein mount of the mture SREBP-2; the uthors (Sugiym et l. 2008) dmitted their unsuccessful identifiction of the key molecules mediting EPA function on SREBP-2 processing, ut suggested post-trnscriptionl suppression of SREBP-2 y EPA in the presence of PPARα. Lu et l. (2011) found decrese of n mount of oth the precursor nd the nucler SREBP-1 protein in their experiment. It is worthy to mention in this context n effect of concentrtion: Cputo et l. (2010) reported decrese of oth SREBP-1 mrna nd SREBP-1 protein in humn heptom treted with EPA/DHA, ut only in concentrtion of 50μM nd not in concentrtion of 25μM. The up-regultion of the Insig-1 gene y FO in the present experiment (Figure 1) grees with the dt of Konig et l. (2007) who found incresed Insig-1 gene expression in the rt heptom cell line fter ctivtion of PPARα. Similrly, Botolin et l. (2006) reported trnsiently induced Insig-1 mrna in rt heptocytes fter DHA tretment. On the other hnd, the recent experiments testing n effect of FO on the gene expression in mice (Ari et l. 2009, ; Hirko et l. 2010) found decresed Insig-1 gene expression. The results of the present experiment regrding rt liver Hmgcr gene (Figure 1) do not gree with the dt found in mice, where Hmgcr gene expression ws decresed y EPA/DHA (Ari et l. 2009), y menhden oil (EPA) (Ari et l. 2009), y FO (Hirko et l. 2010) or y EPA lone (Sugiym et l. 2008). On the other hnd, only tun oil (DHA), ut not menhden oil (EPA) decresed expression of Ldlr in the study of Ari et l. (2009). Plsm cholesterol. Plsm TC level of the FOfed rts in the present experiment (1.07 mmol/l; Figure 2) is pproximtely in the middle of the rnge of the results of similr experiments (FO-fed rts; ll dt reclculted to mmol/l): 3.22 (Lu et l. 2011) 2.45 (Ferrmosc et l. 2012) 2.36 (Xio et l. 2012) 2.04 (Cmpioli et l. 2012) 1.01 (Ymzki et l. 2011) 0.98 (Tkhshi 2011) 0.54 (Popovic et l. 2011). The sme is true regrding plsm LDL-C in the present experiment (0.75 mmol/l; Figure 2): the results of the similr experiments with the FO-fed rts re etween 1.84 mmol/l (Xio et l. 2012) nd 0.23 mmol/l (Popovic et l. 2011), the vlue reported y Cmpioli et l (0.81 mmol/l) eing very similr to our dt. Pulished dt regrding HDL-C lso vry conspicuously etween 1.11 mmol/l (Ferrmosc et l. 2012) nd 0.17 mmol/l (Popovic et l. 2011), with the level found in the present experiment (0.35 mmol/l) pproximtely in the middle. Tking into ccount possile methodicl incomptiilities of the pulished ppers (direct determintion of ll cholesterol frctions using preprtive ultrcentrifugtion or clcultion of the LDL-C frction; reclirtion of the commercil pprtuses usully designed for determintion of humn smples for the rt plsm smples or lck of thereof), more importnt thn the comprison of the solute vlues re likely the differences etween plsm mrkers of the FO-fed rts nd the control rts found within given experiment. Similrly to the present study (Figure 2), FO in the rt diet decresed plsm TC lso in most of the recent studies (Lu et l. 2011; Tkhshi 2011; Cmpioli et l. 2012; Ferrmosc et l. 2012; Xio et l. 2012). However, Ymzki et l. (2011) nd Cmpioli et l. (2012) did not find differences in TC etween the FO-fed rts nd the control rts. A possile reson in the cse of the experiment of Ymzki et l. (2011) ws low FO intke (1 g per kg of live weight nd dy); however, FO intke ws only slightly higher in the present experiment (1.57 g per kg of live weight nd dy). According to Konig et l. (2007), plsm cholesterol in rts is decresed due to the PPARα ctivtion nd ensuing SREBP-2 reduction, which leds to decresed cholesterol synthesis; Sugiym et l. (2008) mention TC decrese in mice only in the presence of PPARα (in the wild-type mice, ut not in the PPARα null mice). Another explntion of the plsm cholesterol reduction in rts y FO is the possiility tht FO fcilittes in the liver cholesterol secretion into ile cids due to the up-regultion of the cholesterol trnsporters (Tkhshi 2011). Sugiym et l. (2008) concluded tht prt from cholesterol iosynthesis, mny other mechnisms prticipte in cholesterol homeostsis (ile cid synthesis, ile secretion) nd the mechnism of the hypocholesterolemic effect of EPA is not fully understood (though it is different from firtes). Moreover, TC decrese in some experiments of this type (n-3 PUFA-fed rts) need not e due to n-3 PUFA t ll, ut e.g. due to different qulities of micronutrients: ddition of the cold-pressed flxseed 396

7 Czech J. Anim. Sci., 59, 2014 (9): Originl Pper oil to rt diet decresed plsm TC in comprison with the control rts fed diet with totlly refined flxseed oil in n experiment of Xio et l. (2012). Conclusions of Rmprsth et l. (2012) tht PUFA-rich diets decrese plsm totl cholesterol (in this cse in humns) independently of chnges in cholesterol sorption or synthesis re in greement with our dt, nmely the FO tendency to up-regulte rt liver Ldlr nd Hmgcr gene, respectively (Figure 1). Becuse the method of LDL-C determintion is not cler from most of other similr ppers, only HDL cholesterol frction is discussed. In summry, the results of experiments evluting n effect of FO on HDL-C in rodents re miguous. Both Ymzki et l. (2011) nd Cmpioli et l. (2012) did not find difference in plsm HDL-C in the FO-fed nd the control rts, similrly to our dt. On the other hnd, Popovic et l. (2011) nd Xio et l. (2012) reported n increse of this mrker in the rt plsm fter FO intke. Contrry to the ove-mentioned results, Tkhshi (2011) found decrese of this prmeter from 1.56 mmol/l (plm oil-fed rts) to 0.58 mmol/l (FO group). Similr conclusions reported lso Kmisko et l. (2012) in mice fed diet with FO in comprison with soyen oil-fed control: FO decresed plsm HDL-C from 1.50 to 0.56 mmol/l. As fr s n interspecies comprison is concerned, n increse of HDL-C due to EPA/DHA intke follows from humn clinicl studies (metnlysis of Jcoson et l. 2012). Zhng et l. (2009) suggest in this context tht hmsters re etter model thn rts for studying plsm cholesterol-lowering effect of functionl foods ecuse they synthesize nd excrete cholesterol (nd ile cids) in mnner similr to humns. CONCLUSION Regrding the hypothesis tested in the present experiment (EPA+DHA increse expression of the Insig-1 gene in the rt liver, which leds to suppression of the Hmgcr gene nd Ldlr gene with consequence of decresed plsm cholesterol), only the first nd the lst step ws confirmed. Therefore, it cn e concluded tht the cholesterol lowering effect of fish oil is t lest prtly sed on mechnisms other thn tested here. However, the inconclusive results of the present study gree with often contrdictory literture dt discussing ll steps of the puttive signlling pthwy from EPA/DHA to plsm cholesterol oth in rodents nd in humns, including the sttement tht mechnism of hypocholesterolemic effect of EPA/DHA in rodents (nd humns) hs still not een fully understood. Acknowledgement. The uthors wish to thnk Dr. Jiří Sochor for technicl ssistnce. REFERENCES Ari T., Kim H.J., Chi H., Mtsumoto A. (2009): Antioesity effect of fish oil nd fish oil-fenofirte comintion in femle KK mice. Journl of Atherosclerosis nd Thromosis, 16, Ari T., Kim H.J., Chi H., Mtsumoto A. (2009): Interction of fenofirte nd fish oil in reltion to lipid metolism in mice. Journl of Atherosclerosis nd Thromosis, 16, Botolin D., Wng Y., Christin B., Jump D.B. (2006): Docoshexenoic cid (22:6, n-3) regultes rt heptocyte SREBP-1 nucler undnce y Erk- nd 26S protesome-dependent pthwys. Journl of Lipid Reserch, 47, Cmpioli E., Rustichelli C., Avllone R. (2012): N-3 dietry supplementtion nd lipid metolism: differences etween vegetle- nd fish-derived oils. Journl of Functionl Foods, 4, Cputo M., Zirpoli H., Torino G., Tecce M. (2010): Selective regultion of UGT1A1 nd SREBP-1c mrna expression y docoshexenoic, eicospentenoic, nd rchidonic cids. Journl of Cellulr Physiology, 226, Densupsoontorn N., Worgll T.S., Seo T., Hmi H., Deckelum J. (2007): Ftty cid supplied s triglyceride regultes SRE-medited gene expression s efficiently s free ftty cids. Lipids, 42, Eslick G.D., Howe P.R.C., Smith C., Priest R., Bensoussn A. (2009): Benefits of fish oil supplementtion in hyperlipidemi: systemtic review nd met-nlysis. Interntionl Journl of Crdiology, 136, Fernndez-Alvrez A., Alvrez M.S., Gonzlez R., Cucrell C., Muntne J., Csdo M. (2011): Humn SREBP1c expression in liver is directly regulted y peroxisome prolifertor-ctivted receptor α (PPARα). Journl of Biologicl Chemistry, 286, Ferrmosc A., Conte L., Zr V. (2012): A krill oil supplemented diet reduces the ctivities of the mitochondril tricroxylte crrier nd of the cytosolic lipogenic enzymes in rts. Journl of Animl Physiology nd Animl Nutrition, 96, Givens D.I., Gis R.A. (2008): Current intkes of EPA nd DHA in Europen popultions nd the potentil of nimlderived foods to increse them. Proceedings of the Nutrition Society, 67,

8 Originl Pper Czech J. Anim. Sci., 59, 2014 (9): Hirko S., Kim H.J., Ari T., Chi H., Mtsumoto A. (2010): Effect of concomitntly used fish oil nd cholesterol on lipid metolism. Journl of Nutritionl Biochemistry, 21, Jcoson T.A., Glickstein S.B., Rowe J.D., Soni P.N. (2012): Effects of eicospentenoic cid nd docoshexenoic cid on low-density lipoprotein cholesterol nd other lipids: review. Journl of Clinicl Lipidology, 6, Jump D.B. (2008): N-3 polyunsturted ftty cid regultion of heptic gene trnscription. Current Opinion in Lipidology, 19, Kmisko T., Tnk Y., Iked T., Ymmoto K., Ogw H. (2012): Dietry fish oil regultes gene expression of cholesterol nd ile cid trnsporters in mice. Heptology Reserch, 42, Komprd T. (2012): Eicospentenoic nd docoshexenoic cids s inflmmtion-modulting nd lipid homeostsis influencing nutrceuticls: review. Journl of Functionl Foods, 4, Komprd T., Zornikov G., Rozikov V., Borkovcov M., Przywrov A. (2013): The effect of dietry Slvi hispnic seed on the content of n-3 long-chin polyunsturted ftty cids in tissues of selected niml species, including edile insects. Journl of Food Composition nd Anlysis, 32, Konig B., Koch A., Spielmnn J., Hilgenfeld C., Stngl G.I., Eder K. (2007): Activtion of PPARα lowers synthesis nd concentrtion of cholesterol y reduction of nucler SREBP-2. Biochemicl Phrmcology, 73, Lecker J., Mtthn N.R., Billheimer J.T., Rder D.J., Lichtenstein A.H. (2011): Chnges in cholesterol homeostsis modify the response of F1B hmsters to dietry very long chin n-3 nd n-6 polyunsturted ftty cids. Lipids in Helth nd Disese, 10:186. Lopez-Huerts E. (2009): Helth effects of oleic cid nd long chin omeg-3 ftty cids (EPA nd DHA) enriched milks. A review of intervention studies. Phrmcologicl Reserch, 61, Lu J., Borthwick F., Hssnli Z., Wng Y., Mngt R., Ruth M., Shi D., Jeschke A., Russel J.C., Field C.J., Proctor S.D., Vine D.F. (2011): Chronic dietry n-3 PUFA intervention improves dislipidemi nd susequent crdiovsculr complictions in the JSR:LA-cp rt model of the metolic syndrome. British Journl of Nutrition, 105, Luci S., Konig B., Giems B., Huer S., Huse G., Kluge H., Stngl G.I., Eder K. (2007): Feeding of deep-fried ft cuses PPARα ctivtion in the liver of pigs s non-proliferting species. British Journl of Nutrition, 97, Mki K.C., Vn Elswyk M.E., McCrthy D., Seeley M.A., Veith P.E., Hess S.P., Ingrm K.A., Hlvorson J.J., Clgus E.M., Dvidson M.H. (2003): Lipid responses in mildly hypertriglyceridemic men nd women to consumption of docoshexenoic cid-enriched eggs. Interntionl Journl for Vitmin nd Nutrition Reserch, 73, Nkmur M.T., Cheon Y., Li Y., Nr T.Y. (2004): Mechnisms of regultion of gene expression y ftty cids. Lipids, 39, Popovic T., Borozn S., Arsic A., Deeljk-Mrtcic J., Vucic V., de Luk S., Milovnovic I., Trovic A., Glietic M. (2011): Effects of n-3 supplementtion on plsm nd liver phospholipid ftty cids profile in ged Wistr rts. Crotic Chemic Act, 84, Rmprsth V.R., Jones P.J.H., Buckley D.D., Woollett L.A., Heui J.E. (2012): Decresed plsm cholesterol concentrtions fter PUFA-rich diets re not due to reduced cholesterol sorption/synthesis. Lipids, 47, Sto R. (2010): Sterol metolism nd SREBP ctivtion. Archives of Biochemistry nd Biophysics, 501, Sugiym E., Ishikw Y., Li Y., Kgi T., Noyshi M., Tnk N., Kmijo Y., Yokoym S., Hr A., Aoym T. (2008): Eicospentenoic cid lowers plsm nd liver cholesterol levels in the presence of peroxisome prolifertors-ctivted receptor lph. Life Sciences, 83, Tkhshi Y. (2011): Soy protein nd fish oil independently decrese serum lipid concentrtions ut interctively reduce heptic enzymtic ctivity nd gene expression involved in ftty cid synthesis in rts. Journl of Nutritionl Science nd Vitminology, 57, Xio Y., Qinchun G., Jiqu X., Fenghong G., Qingde H., Zhihu Y., Jine Y. (2012): Effects of cold-pressed nd vitmin E- enriched flxseed oils on lipid profile nd ntioxidnt sttus in high-ft fed rts. Europen Journl of Lipid Science nd Technology, 114, Ymzki R.K., Brito G.A.P., Coelho I., Pequitto D.C.T., Ymguchi A.A., Borghetti G., Schiessel D.L., Kryczyk M., Mchdo J., Roch R.E.R., Aikw J., Igher F., Nliwko K., Tnhoffer R.A., Nunes N.A., Fernndes L.C. (2011): Low fish oil intke improves insulin sensitivity, lipid profile nd muscle metolism on insulin resistnt MSG-oese rts. Lipids in Helth nd Disese, 10, 66. Zhng Z., Wng H., Jio R., Peng C., Wong Y.M., Yeung V.S.Y., Hung Y., Chen Z.-Y. (2009): Choosing hmsters ut not rts s model for studying plsm cholesterol-lowering ctivity of functionl foods. Moleculr Nutrition nd Food Reserch, 53, Received: Accepted fter corrections: Corresponding Author Prof. MVDr. Ing. Tomáš Komprd, CSc., Mendel University in Brno, Deprtment of Food Technology, Zemědělská 1, Brno, Czech Repulic Phone: , e-mil: 398

Treatment Spring Late Summer Fall 0.10 5.56 3.85 0.61 6.97 3.01 1.91 3.01 2.13 2.99 5.33 2.50 1.06 3.53 6.10 Mean = 1.33 Mean = 4.88 Mean = 3.

Treatment Spring Late Summer Fall 0.10 5.56 3.85 0.61 6.97 3.01 1.91 3.01 2.13 2.99 5.33 2.50 1.06 3.53 6.10 Mean = 1.33 Mean = 4.88 Mean = 3. The nlysis of vrince (ANOVA) Although the t-test is one of the most commonly used sttisticl hypothesis tests, it hs limittions. The mjor limittion is tht the t-test cn be used to compre the mens of only

More information



More information

Effects of Testosterone Replacement on Renal Function and Apoptosis on Mesangial and Renal Tubule Cells in Rats

Effects of Testosterone Replacement on Renal Function and Apoptosis on Mesangial and Renal Tubule Cells in Rats Yongo Act medic 21;41:37 44 Effects of Testosterone Replcement on Renl Function nd Apoptosis on Mesngil nd Renl Tuule Cells in Rts Kuniysu Murok Deprtment of Urology nd First Deprtment of Pthology, Tottori

More information

Fat-Soluble Vitamin and Micromineral Concentrations in Preruminant Dairy Calves Fed to Achieve Different Growth Rates

Fat-Soluble Vitamin and Micromineral Concentrations in Preruminant Dairy Calves Fed to Achieve Different Growth Rates Animl Industry Report AS 654 ASL R2298 2008 Ft-Solule Vitmin nd Microminerl Concentrtions in Preruminnt Diry Clves Fed to Achieve Different Growth Rtes Brin J. Nonnecke United Sttes Deprtment of Agriculture

More information

Effect of viscosity on C sugar in Beet sugar factories

Effect of viscosity on C sugar in Beet sugar factories ANNUAL TRANSACTIONS OF THE NORDIC RHEOLOGY SOCIETY, VOL. 16, 2008 Effect of on C sugr in Beet sugr fctories Mohmmd Hojjtoleslmy 1, Rez Shokrni 2 nd Ahmd Krsi 3 1 Deprtment of food technology, College of

More information

Rate and Activation Energy of the Iodination of Acetone

Rate and Activation Energy of the Iodination of Acetone nd Activtion Energ of the Iodintion of Acetone rl N. eer Dte of Eperiment: //00 Florence F. Ls (prtner) Abstrct: The rte, rte lw nd ctivtion energ of the iodintion of cetone re detered b observing the

More information

** Dpt. Chemical Engineering, Kasetsart University, Bangkok 10900, Thailand

** Dpt. Chemical Engineering, Kasetsart University, Bangkok 10900, Thailand Modelling nd Simultion of hemicl Processes in Multi Pulse TP Experiment P. Phnwdee* S.O. Shekhtmn +. Jrungmnorom** J.T. Gleves ++ * Dpt. hemicl Engineering, Ksetsrt University, Bngkok 10900, Thilnd + Dpt.hemicl

More information

Reversing Medications That Cause Bleeding

Reversing Medications That Cause Bleeding Reversing Medictions Tht Cuse Bleeding Dine M. Birnbumer, M.D., FACEP Professor of Medicine University of Cliforni, Los Angeles Senior Fculty Deprtment of Emergency Medicine Hrbor-UCLA Medicl Center The

More information

Small Businesses Decisions to Offer Health Insurance to Employees

Small Businesses Decisions to Offer Health Insurance to Employees Smll Businesses Decisions to Offer Helth Insurnce to Employees Ctherine McLughlin nd Adm Swinurn, June 2014 Employer-sponsored helth insurnce (ESI) is the dominnt source of coverge for nonelderly dults

More information

Effect of Palm Tocotrienols versus Alpha- Tocopherol on Lymphocyte's Proliferation in Streptozotocin-Induced Diabetic Rats

Effect of Palm Tocotrienols versus Alpha- Tocopherol on Lymphocyte's Proliferation in Streptozotocin-Induced Diabetic Rats IBIMA Pulishing Reserch in Immunology: An Interntionl Journl Vol. 2013 (2013), Article ID 189211, 9 pges DOI: 10.5171/2013.189211 Reserch Article Effect

More information

Unit 29: Inference for Two-Way Tables

Unit 29: Inference for Two-Way Tables Unit 29: Inference for Two-Wy Tbles Prerequisites Unit 13, Two-Wy Tbles is prerequisite for this unit. In ddition, students need some bckground in significnce tests, which ws introduced in Unit 25. Additionl

More information

Study on enzyme-assisted aqueous extraction of oil from soybean

Study on enzyme-assisted aqueous extraction of oil from soybean 8 Journl Scientific & Industril Reserch J SCI IND RES VOL 69 NOVEMBER 2010 Vol. 69, November 2010, pp. 8-865 Study on enzyme-ssisted queous extrction oil from soyben Jun-Qing Qin*, De-Hui Qin, Xing-Mo

More information

Quantitative relationship of two viruses (MrNV and XSV) in white-tail disease of Macrobrachium rosenbergii

Quantitative relationship of two viruses (MrNV and XSV) in white-tail disease of Macrobrachium rosenbergii DISEASES OF AQUATIC ORGANISMS Vol. 71: 11 17, 26 Pulished July 11 Dis Aqut Org Quntittive reltionship of two viruses (MrNV nd XSV) in white-til disese of Mcrorchium rosenergii Hujun Zhng 1, Jinmin Wng

More information


EQUATIONS OF LINES AND PLANES EQUATIONS OF LINES AND PLANES MATH 195, SECTION 59 (VIPUL NAIK) Corresponding mteril in the ook: Section 12.5. Wht students should definitely get: Prmetric eqution of line given in point-direction nd twopoint

More information

Effect of in vitro B-6 Vitameric Forms on Lymphocyte Proliferation in Healthy Young Women with Oral Vitamin B-6 Supplementation

Effect of in vitro B-6 Vitameric Forms on Lymphocyte Proliferation in Healthy Young Women with Oral Vitamin B-6 Supplementation J Community Nutrition 7279 ~ 84, 2005 Originl Article Effect of in vitro B-6 Vitmeric Forms on Lymphocyte Prolifertion in Helthy Young Women with Orl Vitmin B-6 Supplementtion Ho Kyung Kwk, 1)2) Jmes E.

More information

Reasoning to Solve Equations and Inequalities

Reasoning to Solve Equations and Inequalities Lesson4 Resoning to Solve Equtions nd Inequlities In erlier work in this unit, you modeled situtions with severl vriles nd equtions. For exmple, suppose you were given usiness plns for concert showing

More information

Answer, Key Homework 10 David McIntyre 1

Answer, Key Homework 10 David McIntyre 1 Answer, Key Homework 10 Dvid McIntyre 1 This print-out should hve 22 questions, check tht it is complete. Multiple-choice questions my continue on the next column or pge: find ll choices efore mking your

More information

Utilization of Smoking Cessation Benefits in Medicaid Managed Care, 2009-2013

Utilization of Smoking Cessation Benefits in Medicaid Managed Care, 2009-2013 Utiliztion of Smoking Cesstion Benefits in Medicid Mnged Cre, 2009-2013 Office of Qulity nd Ptient Sfety New York Stte Deprtment of Helth Jnury 2015 Introduction According to the New York Stte Tocco Control

More information

Indicate (X) client(s) to whom this final report is submitted. Replace any of these with other relevant clients if required.

Indicate (X) client(s) to whom this final report is submitted. Replace any of these with other relevant clients if required. CFPA Cnning Fruit Producers Assoc. Submit to: Wiehhn Victor Tel: +27 (0)21 872 1501 SAAPPA / SASPA / SAT Fruitgro Science Submit to: Louise Liebenberg Tel: +27 (0)21 882 8470/1

More information

The LENA TM Language Environment Analysis System:

The LENA TM Language Environment Analysis System: FOUNDATION The LENA TM Lnguge Environment Anlysis System: Audio Specifictions of the DLP-0121 Michel Ford, Chrles T. Ber, Dongxin Xu, Umit Ypnel, Shrmi Gry LENA Foundtion, Boulder, CO LTR-03-2 September

More information

DlNBVRGH + Sickness Absence Monitoring Report. Executive of the Council. Purpose of report

DlNBVRGH + Sickness Absence Monitoring Report. Executive of the Council. Purpose of report DlNBVRGH + + THE CITY OF EDINBURGH COUNCIL Sickness Absence Monitoring Report Executive of the Council 8fh My 4 I.I...3 Purpose of report This report quntifies the mount of working time lost s result of

More information


THE EFFECTS OF INCREASED PROTEIN INTAKE ON KIDNEY SIZE AND FUNCTION The Journl of Experimentl iology 21, 281 29 (1998) Printed in Gret ritin The Compny of iologists Limited 1998 JE1492 281 THE EFFECTS OF INCRESED PROTEIN INTKE ON KIDNEY SIZE ND FUNCTION KIMERLY. HMMOND

More information

Assuming all values are initially zero, what are the values of A and B after executing this Verilog code inside an always block? C=1; A <= C; B = C;

Assuming all values are initially zero, what are the values of A and B after executing this Verilog code inside an always block? C=1; A <= C; B = C; B-26 Appendix B The Bsics of Logic Design Check Yourself ALU n [Arthritic Logic Unit or (rre) Arithmetic Logic Unit] A rndom-numer genertor supplied s stndrd with ll computer systems Stn Kelly-Bootle,

More information

Simulation of operation modes of isochronous cyclotron by a new interative method

Simulation of operation modes of isochronous cyclotron by a new interative method NUKLEONIKA 27;52(1):29 34 ORIGINAL PAPER Simultion of opertion modes of isochronous cyclotron y new intertive method Ryszrd Trszkiewicz, Mrek Tlch, Jcek Sulikowski, Henryk Doruch, Tdeusz Norys, Artur Srok,

More information

INITIATION OF THERAPY Patient-specific considerations for initiation of apixaban therapy include the following:

INITIATION OF THERAPY Patient-specific considerations for initiation of apixaban therapy include the following: UNC HEALTH CARE GUIDELINE Mngement of Apixn in Adults Apixn (Eliquis ) is n orl nticogulnt tht cts s fctor X inhiitor. It is pproved y the FDA for the prevention of stroke nd systemic emolism in ptients

More information

ARTICLE IN PRESS. i n t e r n a t i o n a l j o u r n a l o f m e d i c a l i n f o r m a t i c s x x x ( 2 0 1 2 ) xxx xxx

ARTICLE IN PRESS. i n t e r n a t i o n a l j o u r n a l o f m e d i c a l i n f o r m a t i c s x x x ( 2 0 1 2 ) xxx xxx IJB-2938; No. of Pges 12 i n t e r n t i o n l j o u r n l o f m e d i c l i n f o r m t i c s x x x ( 2 0 1 2 ) xxx xxx j ourn l homepge: Description nd comprison of qulity of electronic

More information

Polynomial Functions. Polynomial functions in one variable can be written in expanded form as ( )

Polynomial Functions. Polynomial functions in one variable can be written in expanded form as ( ) Polynomil Functions Polynomil functions in one vrible cn be written in expnded form s n n 1 n 2 2 f x = x + x + x + + x + x+ n n 1 n 2 2 1 0 Exmples of polynomils in expnded form re nd 3 8 7 4 = 5 4 +

More information

Free Serum Testosterone Level in Male Rats Treated with Tribulus Alatus Extracts

Free Serum Testosterone Level in Male Rats Treated with Tribulus Alatus Extracts Investigtive Urology Triulus Altus Extrcts nd Testosterone Level Interntionl Brz J Urol Vol. 33 (4): 554-559, July - August, 2007 Free Serum Testosterone Level in Mle Rts Treted with Triulus Altus Extrcts

More information



More information

Variable Dry Run (for Python)

Variable Dry Run (for Python) Vrile Dr Run (for Pthon) Age group: Ailities ssumed: Time: Size of group: Focus Vriles Assignment Sequencing Progrmming 7 dult Ver simple progrmming, sic understnding of ssignment nd vriles 20-50 minutes

More information

Homework #6 Chapter 7 Homework Acids and Bases

Homework #6 Chapter 7 Homework Acids and Bases Homework #6 Chpter 7 Homework Acids nd Bses 18. ) H O(l) H 3O (q) OH (q) H 3 O OH Or H O(l) H (q) OH (q) H OH ) HCN(q) H O(l) H 3O (q) CN (q) H 3 O HCN CN Or HCN(q) H (q) CN (q) H CN HCN c) NH 3(q) H O(l)

More information

Economics Letters 65 (1999) 9 15. macroeconomists. a b, Ruth A. Judson, Ann L. Owen. Received 11 December 1998; accepted 12 May 1999

Economics Letters 65 (1999) 9 15. macroeconomists. a b, Ruth A. Judson, Ann L. Owen. Received 11 December 1998; accepted 12 May 1999 Economics Letters 65 (1999) 9 15 Estimting dynmic pnel dt models: guide for q mcroeconomists b, * Ruth A. Judson, Ann L. Owen Federl Reserve Bord of Governors, 0th & C Sts., N.W. Wshington, D.C. 0551,

More information

In addition, the following elements form an integral part of the Agency strike prevention plan:

In addition, the following elements form an integral part of the Agency strike prevention plan: UNITED STTES DEPRTMENT OF GRICULTURE Wshington, DC 20250 Federl Grin Inspection Service FGIS Directive 4711.2 6/16/80 STRIKE PREVENTION ND STRIKE CONTINGENCY PLNS I PURPOSE This Instruction: Estlishes

More information

ORIGINAL ARTICLE OPEN. A Barden 1, R Singh 1, B Walters 2, M Phillips 3 and LJ Beilin 1

ORIGINAL ARTICLE OPEN. A Barden 1, R Singh 1, B Walters 2, M Phillips 3 and LJ Beilin 1 OPEN Cittion: Nutrition & Dietes (2013) 3, e72; doi:10.1038/nutd.2013.15 & 2013 Mcmilln Pulishers Limited All rights reserved 2044-4052/13 ORIGINAL ARTICLE A simple scoring method using

More information

A Note on Complement of Trapezoidal Fuzzy Numbers Using the α-cut Method

A Note on Complement of Trapezoidal Fuzzy Numbers Using the α-cut Method Interntionl Journl of Applictions of Fuzzy Sets nd Artificil Intelligence ISSN - Vol. - A Note on Complement of Trpezoidl Fuzzy Numers Using the α-cut Method D. Stephen Dingr K. Jivgn PG nd Reserch Deprtment

More information

The Effect of Crumb Rubber Modifier (CRM) on the Performance Properties of Rubberized Binders in HMA pavements

The Effect of Crumb Rubber Modifier (CRM) on the Performance Properties of Rubberized Binders in HMA pavements The Effect of Crum Ruer Modifier (CRM) on the Performnce Properties of Ruerized Binders in HMA pvements Soon-Je Lee* Ph.D. Grdute Student Deprtment of Civil Engineering Clemson University Clemson, SC 29634-0911

More information

The Acoustic Design of Soundproofing Doors and Windows

The Acoustic Design of Soundproofing Doors and Windows 3 The Open Acoustics Journl, 1, 3, 3-37 The Acoustic Design of Soundproofing Doors nd Windows Open Access Nishimur Yuy,1, Nguyen Huy Qung, Nishimur Sohei 1, Nishimur Tsuyoshi 3 nd Yno Tkshi 1 Kummoto Ntionl

More information

July 2005, NCJ 209588 Substance Dependence, Abuse, and Treatment of Jail Inmates, 2002. Highlights. No dependence or abuse 53 47 32.

July 2005, NCJ 209588 Substance Dependence, Abuse, and Treatment of Jail Inmates, 2002. Highlights. No dependence or abuse 53 47 32. U.S. Deprtment of Justice Office of Justice Progrms Bureu of Justice Sttistics Specil Report By Jennifer C. Krerg nd Doris J. Jmes BJS Sttisticins In 2002 more thn two-thirds of jil inmtes were found to

More information


THERMAL EXPANSION OF TUNGSTEN . THERMAL EXPANSION OF TUNGSTEN S515 By Peter Hidnert nd W. T. Sweeney ABSTRACT This pper gives the results of n investigtion on the therml expnsion of tungsten (99.98 per cent) over vrious temperture

More information

Learner-oriented distance education supporting service system model and applied research

Learner-oriented distance education supporting service system model and applied research SHS Web of Conferences 24, 02001 (2016) DOI: 10.1051/ shsconf/20162402001 C Owned by the uthors, published by EDP Sciences, 2016 Lerner-oriented distnce eduction supporting service system model nd pplied

More information

Basic Analysis of Autarky and Free Trade Models

Basic Analysis of Autarky and Free Trade Models Bsic Anlysis of Autrky nd Free Trde Models AUTARKY Autrky condition in prticulr commodity mrket refers to sitution in which country does not engge in ny trde in tht commodity with other countries. Consequently

More information

Antibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening

Antibody Screening. Antibody Screening in Pre-transfusion Testing and Antenatal Screening Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Antiody Screening in Pre-trnsfusion Testing nd Antentl Screening Q. Wht re nturlly occurring or expected ntiodies? Q. Wht re typicl or unexpected

More information

1 Numerical Solution to Quadratic Equations

1 Numerical Solution to Quadratic Equations cs42: introduction to numericl nlysis 09/4/0 Lecture 2: Introduction Prt II nd Solving Equtions Instructor: Professor Amos Ron Scribes: Yunpeng Li, Mrk Cowlishw Numericl Solution to Qudrtic Equtions Recll

More information

Appendix D: Completing the Square and the Quadratic Formula. In Appendix A, two special cases of expanding brackets were considered:

Appendix D: Completing the Square and the Quadratic Formula. In Appendix A, two special cases of expanding brackets were considered: Appendi D: Completing the Squre nd the Qudrtic Formul Fctoring qudrtic epressions such s: + 6 + 8 ws one of the topics introduced in Appendi C. Fctoring qudrtic epressions is useful skill tht cn help you

More information



More information

Role of TRAIL and the pro-apoptotic Bcl-2 homolog Bim in acetaminophen-induced liver damage

Role of TRAIL and the pro-apoptotic Bcl-2 homolog Bim in acetaminophen-induced liver damage Role of TRAIL nd the pro-poptotic Bcl-2 homolog Bim in cetminophen-induced liver dmge A Bdmnn 1, A Keough 2, T Kufmnn 3, P Bouillet 4, T Brunner",1,5,6 nd N Corzz",1,6 Acetminophen (N-cetyl-pr-minophenol

More information

Effect of Treadmill Exercise on Interleukin-15 Expression and Glucose Tolerance in Zucker Diabetic Fatty Rats

Effect of Treadmill Exercise on Interleukin-15 Expression and Glucose Tolerance in Zucker Diabetic Fatty Rats Originl Article Obesity nd Metbolic Syndrome pissn 2233-679 eissn 2233-687 DIABETES & METABOLISM JOURNAL Effect of Tredmill Exercise on Interleukin-15 Expression

More information

Econ 4721 Money and Banking Problem Set 2 Answer Key

Econ 4721 Money and Banking Problem Set 2 Answer Key Econ 472 Money nd Bnking Problem Set 2 Answer Key Problem (35 points) Consider n overlpping genertions model in which consumers live for two periods. The number of people born in ech genertion grows in

More information

Project Recovery. . It Can Be Done

Project Recovery. . It Can Be Done Project Recovery. It Cn Be Done IPM Conference Wshington, D.C. Nov 4-7, 200 Wlt Lipke Oklhom City Air Logistics Center Tinker AFB, OK Overview Mngement Reserve Project Sttus Indictors Performnce Correction

More information

Quality Evaluation of Entrepreneur Education on Graduate Students Based on AHP-fuzzy Comprehensive Evaluation Approach ZhongXiaojun 1, WangYunfeng 2

Quality Evaluation of Entrepreneur Education on Graduate Students Based on AHP-fuzzy Comprehensive Evaluation Approach ZhongXiaojun 1, WangYunfeng 2 Interntionl Journl of Engineering Reserch & Science (IJOER) ISSN [2395-6992] [Vol-2, Issue-1, Jnury- 2016] Qulity Evlution of Entrepreneur Eduction on Grdute Students Bsed on AHP-fuzzy Comprehensive Evlution

More information

Homework #4: Answers. 1. Draw the array of world outputs that free trade allows by making use of each country s transformation schedule.

Homework #4: Answers. 1. Draw the array of world outputs that free trade allows by making use of each country s transformation schedule. Text questions, Chpter 5, problems 1-5: Homework #4: Answers 1. Drw the rry of world outputs tht free trde llows by mking use of ech country s trnsformtion schedule.. Drw it. This digrm is constructed

More information

Helicopter Theme and Variations

Helicopter Theme and Variations Helicopter Theme nd Vritions Or, Some Experimentl Designs Employing Pper Helicopters Some possible explntory vribles re: Who drops the helicopter The length of the rotor bldes The height from which the

More information


9 CONTINUOUS DISTRIBUTIONS 9 CONTINUOUS DISTIBUTIONS A rndom vrible whose vlue my fll nywhere in rnge of vlues is continuous rndom vrible nd will be ssocited with some continuous distribution. Continuous distributions re to discrete

More information



More information

Comparison of Environment and Mice in Static and Mechanically Ventilated Isolator Cages with Different Air Velocities and Ventilation Designs

Comparison of Environment and Mice in Static and Mechanically Ventilated Isolator Cages with Different Air Velocities and Ventilation Designs Comprison of Environment nd Mice in Sttic nd Mechniclly Ventilted Isoltor Cges with Different Air Velocities nd Ventiltion Designs FARHAD MEMARZADEH, PHD, PE, 1 PAUL C. HARRISON, PHD, 2* GERALD L. RISKOWSKI,

More information

Original Research Accumulation of Pb and Cd and its Effect on Ca Distribution in Maize Seedlings (Zea Mays L.)

Original Research Accumulation of Pb and Cd and its Effect on Ca Distribution in Maize Seedlings (Zea Mays L.) Polish Journl of Environmentl Studies Vol. 14, No. 2 (2005), 203-207 Originl Reserch Accumultion of Pb nd Cd nd its Effect on C Distribution in Mize Seedlings (Ze Mys L.) E. Młkowski 1 *, R. Kurtyk 1,

More information

Additional Protocol to the Convention on Human Rights and Biomedicine concerning Genetic Testing for Health Purposes

Additional Protocol to the Convention on Human Rights and Biomedicine concerning Genetic Testing for Health Purposes Council of Europe Trety Series - No. 203 Additionl Protocol to the Convention on Humn Rights nd Biomedicine concerning Genetic Testing for Helth Purposes Strsourg, 27.XI.2008 2 CETS 203 Humn Rights nd

More information

C-crcs Cognitive - Counselling Research & Conference Services (eissn: 2301-2358)

C-crcs Cognitive - Counselling Research & Conference Services (eissn: 2301-2358) C-crcs Cognitive - Counselling Reserch & Conference Services (eissn: 2301-2358) Volume I Effects of Music Composition Intervention on Elementry School Children b M. Hogenes, B. Vn Oers, R. F. W. Diekstr,

More information

AntiSpyware Enterprise Module 8.5

AntiSpyware Enterprise Module 8.5 AntiSpywre Enterprise Module 8.5 Product Guide Aout the AntiSpywre Enterprise Module The McAfee AntiSpywre Enterprise Module 8.5 is n dd-on to the VirusScn Enterprise 8.5i product tht extends its ility

More information

Subjective health complaints and psychosocial work environment among university personnel

Subjective health complaints and psychosocial work environment among university personnel Occuptionl Medicine Advnce Access published November 8, 2012 Occuptionl Medicine doi:10.1093/occmed/kqs188 Subjective helth complints nd psychosocil work environment mong university personnel Bente E.

More information

Radioimmunoassay of Human Plasma Retinol-Binding Protein

Radioimmunoassay of Human Plasma Retinol-Binding Protein Rdioimmunossy of Humn Plsm Retinol-Binding Protein FRNK REES SMITH, MIRM RZ, nd DEWITT S. GOODMN From the Deprtment of Medicine, Columbi University College of Physicins nd Surgeons, New York 132 B S T

More information

Space Vector Pulse Width Modulation Based Induction Motor with V/F Control

Space Vector Pulse Width Modulation Based Induction Motor with V/F Control Interntionl Journl of Science nd Reserch (IJSR) Spce Vector Pulse Width Modultion Bsed Induction Motor with V/F Control Vikrmrjn Jmbulingm Electricl nd Electronics Engineering, VIT University, Indi Abstrct:

More information

Wolbachia uses a host microrna to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti

Wolbachia uses a host microrna to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti Wolchi uses host microrna to regulte trnscripts of methyltrnsferse, contriuting to dengue virus inhiition in Aedes egypti Gungmei Zhng, Mzhr Hussin, Scott L. O Neill,c, nd Sssn Asgri,1 Austrlin Infectious

More information

* corresponding author. Keywords: bioactive compounds, antioxidant capacity, plasma triglycerides and antioxidant activity

* corresponding author. Keywords: bioactive compounds, antioxidant capacity, plasma triglycerides and antioxidant activity Chrcteristics of Blond nd Red Str Ruy Jff Grpefruits (Citrus prdisi): Results of the Studies In Vitro, In Vivo nd on Ptients Suffering from Atherosclerosis Yong Seo Prk Deprtment of Horticulturl Science

More information

Genetic variation in PNPLA3 confers susceptibility to nonalcoholic fatty liver disease

Genetic variation in PNPLA3 confers susceptibility to nonalcoholic fatty liver disease Nture Pulishing Group Genetic vrition in PNPLA3 confers susceptiility to nonlcoholic ftty liver disese Stefno Romeo,, Juli Kozlitin,3,, Cho Xing,, Alexnder Pertsemlidis,

More information

Strong acids and bases

Strong acids and bases Monoprotic Acid-Bse Equiliri (CH ) ϒ Chpter monoprotic cids A monoprotic cid cn donte one proton. This chpter includes uffers; wy to fi the ph. ϒ Chpter 11 polyprotic cids A polyprotic cid cn donte multiple

More information

Research Notes. RatSWD. Research Note No. 11. Population Aging and Trends in the Provision of Continued Education

Research Notes. RatSWD. Research Note No. 11. Population Aging and Trends in the Provision of Continued Education RtSWD Reserch Notes Reserch Note No. 11 Previously relesed s RtSWD Working Pper No. 15 Popultion Aging nd Trends in the Provision of Continued Eduction Regin T. Riphhn, Prvti Trübswetter 2007 Reserch Notes

More information

Module 2. Analysis of Statically Indeterminate Structures by the Matrix Force Method. Version 2 CE IIT, Kharagpur

Module 2. Analysis of Statically Indeterminate Structures by the Matrix Force Method. Version 2 CE IIT, Kharagpur Module Anlysis of Stticlly Indeterminte Structures by the Mtrix Force Method Version CE IIT, Khrgpur esson 9 The Force Method of Anlysis: Bems (Continued) Version CE IIT, Khrgpur Instructionl Objectives

More information

Improving Library Users' Perceived Quality, Satisfaction and Loyalty: An Integrated Measurement and Management System

Improving Library Users' Perceived Quality, Satisfaction and Loyalty: An Integrated Measurement and Management System Improving Librry Users' Perceived Qulity, Stisfction nd Loylty: An Integrted Mesurement nd Mngement System by Anne Mrtensen nd Lrs Gr0nholdt This rticle describes the development nd ppliction of structurl

More information

Immunoglobulins in Umbilical Cord Plasma

Immunoglobulins in Umbilical Cord Plasma Arch. Dis. Childh., 1968, 43, 161. Immunoglobulins in Umbilicl Cord Plsm III: Hemolytic Disese of Newborn nd Respirtory Distress Syndrome RIC McKAY, HAZL THOM, nd DRK GRAY From the Deprtment of Child Helth,

More information

Lecture 3 Gaussian Probability Distribution

Lecture 3 Gaussian Probability Distribution Lecture 3 Gussin Probbility Distribution Introduction l Gussin probbility distribution is perhps the most used distribution in ll of science. u lso clled bell shped curve or norml distribution l Unlike

More information

A generic Decision Support System for integrated weed management

A generic Decision Support System for integrated weed management A generic Decision Support System for integrted weed mngement By: Per Rydhl, IPM Consult, Denmrk nd: Nicols Munier-Jolin (INRA), Frnce Robert Msin, University of Pdov, Itly Murizio Sttin (IBAF-CNR), Itly

More information

1. Find the zeros Find roots. Set function = 0, factor or use quadratic equation if quadratic, graph to find zeros on calculator

1. Find the zeros Find roots. Set function = 0, factor or use quadratic equation if quadratic, graph to find zeros on calculator AP Clculus Finl Review Sheet When you see the words. This is wht you think of doing. Find the zeros Find roots. Set function =, fctor or use qudrtic eqution if qudrtic, grph to find zeros on clcultor.

More information

Walnut Consumption Increases Satiation but Has No Effect on Insulin Resistance or the Metabolic Profile Over a 4-day Period

Walnut Consumption Increases Satiation but Has No Effect on Insulin Resistance or the Metabolic Profile Over a 4-day Period nture publishing group Wlnut Consumption Increses Stition but Hs No Effect on Insulin Resistnce or the Metbolic Profile Over 4-dy Period Aoife M. Brennn 1, Lur L. Sweeney 1, Xiowen Liu 1 nd Christos S.

More information

1. In the Bohr model, compare the magnitudes of the electron s kinetic and potential energies in orbit. What does this imply?

1. In the Bohr model, compare the magnitudes of the electron s kinetic and potential energies in orbit. What does this imply? Assignment 3: Bohr s model nd lser fundmentls 1. In the Bohr model, compre the mgnitudes of the electron s kinetic nd potentil energies in orit. Wht does this imply? When n electron moves in n orit, the

More information

Effect of Alloxan-Diabetes and Subsequent Treatment with Insulin on Kinetic Properties of Succinate Oxidase Activity from Rat Liver Mitochondria

Effect of Alloxan-Diabetes and Subsequent Treatment with Insulin on Kinetic Properties of Succinate Oxidase Activity from Rat Liver Mitochondria Effect of Alloxn-Dibetes nd Subsequent Tretment with Insulin on Kinetic Properties of Succinte Oxidse Activity from Rt Liver Mitochondri Smir P. Ptel, * nd Surendr S. Ktyre b Spinl Cord & Brin Injury Reserch

More information

Quick Reference Guide: One-time Account Update

Quick Reference Guide: One-time Account Update Quick Reference Guide: One-time Account Updte How to complete The Quick Reference Guide shows wht existing SingPss users need to do when logging in to the enhnced SingPss service for the first time. 1)

More information

Available online Research Article

Available online Research Article Aville online Journl of Chemicl nd Phrmceuticl Reserch, 2014, 6(8):545-552 Reserch Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 The influence of dietic nd non-dietic very low density lipoproteins

More information

Folia Forestalia Polonica, series A, 2014, Vol. 56 (2), 79 92 ORIGINAL ARTICLE

Folia Forestalia Polonica, series A, 2014, Vol. 56 (2), 79 92 ORIGINAL ARTICLE Foli Forestli Polonic, series A, 214, Vol. 56 (2), 79 92 ORIGINAL ARTICLE DOI: 1.2478/ffp-214-8 Vriility of selected trits of Ips typogrphus (L.) (Col.: Scolytine) popultions in Beskid ywiecki (Western

More information

An Undergraduate Curriculum Evaluation with the Analytic Hierarchy Process

An Undergraduate Curriculum Evaluation with the Analytic Hierarchy Process An Undergrdute Curriculum Evlution with the Anlytic Hierrchy Process Les Frir Jessic O. Mtson Jck E. Mtson Deprtment of Industril Engineering P.O. Box 870288 University of Albm Tuscloos, AL. 35487 Abstrct

More information

All pay auctions with certain and uncertain prizes a comment

All pay auctions with certain and uncertain prizes a comment CENTER FOR RESEARC IN ECONOMICS AND MANAGEMENT CREAM Publiction No. 1-2015 All py uctions with certin nd uncertin prizes comment Christin Riis All py uctions with certin nd uncertin prizes comment Christin

More information

Experiment 6: Friction

Experiment 6: Friction Experiment 6: Friction In previous lbs we studied Newton s lws in n idel setting, tht is, one where friction nd ir resistnce were ignored. However, from our everydy experience with motion, we know tht

More information

Mateus et al. BMC Biology 2014, 12:97

Mateus et al. BMC Biology 2014, 12:97 Mteus et l. BMC Biology 2014, 12:97 RESEARCH ARTICLE Open Access Adptive developmentl plsticity: Comprtmentlized responses to environmentl cues nd to corresponding

More information

Humana Critical Illness/Cancer

Humana Critical Illness/Cancer Humn Criticl Illness/Cncer Criticl illness/cncer voluntry coverges py benefits however you wnt With our criticl illness nd cncer plns, you'll receive benefit fter serious illness or condition such s hert

More information

Version 001 CIRCUITS holland (1290) 1

Version 001 CIRCUITS holland (1290) 1 Version CRCUTS hollnd (9) This print-out should hve questions Multiple-choice questions my continue on the next column or pge find ll choices efore nswering AP M 99 MC points The power dissipted in wire

More information

Small Business Cloud Services

Small Business Cloud Services Smll Business Cloud Services Summry. We re thick in the midst of historic se-chnge in computing. Like the emergence of personl computers, grphicl user interfces, nd mobile devices, the cloud is lredy profoundly

More information

P.3 Polynomials and Factoring. P.3 an 1. Polynomial STUDY TIP. Example 1 Writing Polynomials in Standard Form. What you should learn

P.3 Polynomials and Factoring. P.3 an 1. Polynomial STUDY TIP. Example 1 Writing Polynomials in Standard Form. What you should learn 33337_0P03.qp 2/27/06 24 9:3 AM Chpter P Pge 24 Prerequisites P.3 Polynomils nd Fctoring Wht you should lern Polynomils An lgeric epression is collection of vriles nd rel numers. The most common type of

More information

Operations with Polynomials

Operations with Polynomials 38 Chpter P Prerequisites P.4 Opertions with Polynomils Wht you should lern: Write polynomils in stndrd form nd identify the leding coefficients nd degrees of polynomils Add nd subtrct polynomils Multiply

More information

The International Association for the Properties of Water and Steam. Release on the Ionization Constant of H 2 O

The International Association for the Properties of Water and Steam. Release on the Ionization Constant of H 2 O The Interntionl Assocition for the Properties of Wter nd Stem Lucerne, Sitzerlnd August 7 Relese on the Ioniztion Constnt of H O 7 The Interntionl Assocition for the Properties of Wter nd Stem Publiction

More information



More information

NQF Level: 2 US No: 7480

NQF Level: 2 US No: 7480 NQF Level: 2 US No: 7480 Assessment Guide Primry Agriculture Rtionl nd irrtionl numers nd numer systems Assessor:.......................................... Workplce / Compny:.................................

More information

Source Code verification Using Logiscope and CodeReducer. Christophe Peron Principal Consultant Kalimetrix

Source Code verification Using Logiscope and CodeReducer. Christophe Peron Principal Consultant Kalimetrix Source Code verifiction Using Logiscope nd CodeReducer Christophe Peron Principl Consultnt Klimetrix Agend Introducing Logiscope: Improving confidence nd developer s productivity Bsed on stte-of-the-rt

More information

Oxidative Stress During Rehabilitation from Protein Malnutrition Associated with Aerobic Exercise in Rats

Oxidative Stress During Rehabilitation from Protein Malnutrition Associated with Aerobic Exercise in Rats 45 Vol.50, n. 1 : pp.45-55, Jnury 2007 ISSN 1516-8913 Printed in Brzil BRAZILIAN ARCHIVES OF BIOLOGY AND TECHNOLOGY A N I N T E R N A T I O N A L J O U R N A L Oxidtive Stress During Rehilittion from Protein

More information

Effects of yam dioscorin interventions on improvements of the metabolic syndrome in high-fat diet-induced obese rats

Effects of yam dioscorin interventions on improvements of the metabolic syndrome in high-fat diet-induced obese rats Shih et l. Botnicl Studies (215) 56:4 DOI 1.1186/s4529-15-84-8 RESEARCH Effects of ym dioscorin interventions on improvements of the metolic syndrome in high-ft diet-induced oese rts Shen-Ling Shih 1,

More information


EXPERIMENTAL AND THERAPEUTIC MEDICINE 8: 1191-1196, 2014 EXPERIMENTAL AND THERAPEUTIC MEDICINE 8: 1191-1196, 2014 Comprison of continuous subcutneous insulin infusion nd insulin glrgine-bsed multiple dily insulin sprt injections with preferentil djustment of

More information

Swine Health Impact on Carcass Contamination and Human Foodborne Risk

Swine Health Impact on Carcass Contamination and Human Foodborne Risk Reserch Articles Swine Helth Impct on Crcss Contmintion nd Humn Foodorne Risk H. Scott Hurd, DVM, PhD Jen Brudvig, DVM, MPH Jmes Dickson, PhD Jovn Mircet, DVM c Miroslv Polovinski c Nel Mtthews, MS, PhD

More information

Laboratory testing for recent alcohol consumption: comparison of ethanol, methanol, and 5-hydroxytryptophol

Laboratory testing for recent alcohol consumption: comparison of ethanol, methanol, and 5-hydroxytryptophol Clinicl Chemist y 42:4 618-624 (1996) Lbortory testing for recent lcohol consumption: comprison of ethnol, methnol, nd 5-hydroxytryptophol ANDRS HLANDR,l* OLOF BCK,2 nd A. WAYN JoNs3 The rtio of 5-hydroxytryptophol

More information

Network Configuration Independence Mechanism

Network Configuration Independence Mechanism 3GPP TSG SA WG3 Security S3#19 S3-010323 3-6 July, 2001 Newbury, UK Source: Title: Document for: AT&T Wireless Network Configurtion Independence Mechnism Approvl 1 Introduction During the lst S3 meeting

More information

Chapter 8 - Practice Problems 1

Chapter 8 - Practice Problems 1 Chpter 8 - Prctice Problems 1 MULTIPLE CHOICE. Choose the one lterntive tht best completes the sttement or nswers the question. A hypothesis test is to be performed. Determine the null nd lterntive hypotheses.

More information

Adenovirus Transduction is Required for the Correction of Diabetes Using Pdx-1 or Neurogenin-3 in the Liver

Adenovirus Transduction is Required for the Correction of Diabetes Using Pdx-1 or Neurogenin-3 in the Liver & The Americn Society of Gene Therpy originl rticle Adenovirus Trnsduction is Required for the Correction of Dietes Using Pdx-1 or Neurogenin-3 in the Liver Alfred Y Wng 1, Anj Ehrhrdt 2,3, Hui Xu 2 nd

More information