Irish Genes and Ancestry Dr. Gianpiero Cavalleri Eneclann Summer Lunchtime Series 2012 Detailed genetic ancestry information through state of the art gene analysis
Overview.. Introduction to DNA, Y chromosome, mtdna How DNA has informed us about global population history Patterns of Y chromosome types we see in Ireland How genetics can inform on genealogy Sources for more information
3 billion letter archive written in ACGT Only small portion of our DNA (the genes) encodes instructions to build a human Changes (mutations) occur in our DNA with each generation These chages are inherited down through generations ~99.9% of our DNA is identical
Single nucleotide polymorphism (SNP) CGTACTATGACCCGAGCTAGCCCTA CGTACGATGACCCAAGCTAGCCCTA Pat Jack M269 M182 Microsatellite/short tandem repeat (STR) CCGTGCATGCATGCATGCATGCACC CCGTGCATGCATGCATGCATGCATGCACC Pat (5 copies) Jack (6 copies) DYS19 T at M269 + G at M182 + 5 copies at DYS19 = haplotype i.e. combination = haplotype
Groups and types found at different frequencies in different populations Isolation (i.e. within population marriage) and fact that some people have more (grand)children than others % 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 Isolation! Distance between spouse birthplaces for all marriages 1855-1955 0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9? distance (miles) Basis of all genetic history work
mtda mtdna tree Y chromosome tree
The evolution of modern humans.. Homo erectus Approx 1.8 1.1 mya Radiated from Africa to Europe & Asia
Homo sapiens spread and diversified, moving out of Africa approx 100 kya Early migration towards South East Asia approx 100 60 kya Later migration towards Eurasia 70 40 kya As a consequence we expect to observe in non-africans, a subset of genetic variation present in modern African populations
~150k years ago ~80k years ago R1b across Europe.. ~60k years ago ~40k years ago ~25k years ago LGM ~18k years ago
Data courtesy of JF Wilson
Discovered in November 2008 Subtype of R1b Found in 73% Irish, 50% Scots, 40% English Very rare in continent Proof of commonality among original inhabitants of the islands Probably palaeolithic origins (>10,000 years)
Ui Neill type.. Very common in Ireland, virtually absent elsewhere Origin around 1500-2000 years ago Data courtesy of JF Wilson
Appears specific to Munster & associated with Eoghanacht surnames Data courtesy of JF Wilson
Found at high frequency around Holland,N. Germany, Denmark Probably arrived in Britain recently Iron age? Anglo- Saxon invasions? Data courtesy of JF Wilson
M17 and the Sea Road.but not to Dublin Data courtesy of JF Wilson
Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19: 212-219
38,000 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19: 212-219
60,000 66,000 Brian McEvoy and Dan Bradley (Trinity College Dublin) Human Genetics (2006) 19: 212-219
What about the rest of our DNA? (chromosomes 1 22) PCA using GWAS data Novembre J. Genes mirror geography within Europe. Nature. 2008 Nov 6;456(7218):98-101. Cluster resolved above reflect ancient fissions in demographic history
IrelandsDNA.com - highest resolution for markers of Irish and British ancestry FTDNA.com Good for surname projects 23&me.com Combined health & history results DNA Atlas Ireland: See: http://www.familyhistory.ie http://www.familyhistory.ie/docs/dna/dna_01.pdf Contact details: Dr. Gianpiero Cavalleri 01 402 2146 gcavalleri@rcsi.ie