CSS451 CSS/HRT 451 Agrobacterium-mediated transformation Guo-qing Song
Gene Delivery System Agrobacterium Viral vectors Biolistic Microinjection PEG - Polyethylene Glycol Electroporation 2
Biolistic Transformation ------- Advantage and Disadvantage Advantage: This method can be use to transform all plant species. No binary vector is required. Transformation protocol is relatively l simple. Disadvantage: Difficulty in obtaining single copy transgenic events. High cost of the equipment and microcarriers. Intracellular target is random (cytoplasm, nucleus, vacuole, plastid, etc.). Transfer DNA is not protected. 3
Learning Objectives Understand what key changes had to be made to the Agro tumor-inducing (Ti) or root-inducing (Ri) plasmid for the transfer of novel genes into plants Understand the binary plasmid transformation system Understand some mechanisms of gene transfer 4
OUTLINE CSS451 Agrobacterium Tumefaciens & Crown Gall Disease Mechanism of Gene Transfer using A. tumefaciens Ti-plasmid Chromosomal and Vir Genes T-DNA Transfer T-DNA Integration Engineering binary vectors for plant transformation Transformation protocols using Agrobacterium Factors influencing transformation efficiency 5
Why Agrobacterium? CSS451 Agrobacteria are naturally occurring, ubiquitous soil borne pathogens. A. tumefaciens causes crown gall disease (tumors) A. rhizogenes causes root hair disease (hairy root) Other bacterial groups also contain species capable of interkingdom genetic exchange (Gelvin 2005). Agrobacterium tumefaciens- or Agrobacterium rhizogenes-mediated transformation is to date the most commonly used method for obtaining transgenic plants. The tumorigenic host plant species for range A. tumefaciens include: Large number of dicots and some monocots and Gymnosperms. 6
7 CSS451
A.Tumefaciens & Crown Gall Disease CSS451 http://arabidopsis.info/students/agrobacterium/ Stanton B. Gelvin. Nature 433: 8 583-584 (2005).
Gene Transfer using Agrobacterium Ti-plasmid id GGCAGGATATTCAATTGTAAAT Left T-DNA border GGCAGGATATTCAATTGTAAAT Right T-DNA border Right and left border (RB, LB) sequences are the only parts of T-DNA needed to enable transfer into plants- 9 Removal of other T-DNA genes creates a disarmed Ti plasmid
Gene Transfer using Agrobacterium Agro types Hellens et al (2000; Trends in Plant Science 5:446-451) Agropine-type (strain EHA105::pEHA105): Carry genes for agropine synthesis and catabolism. Tumors do not differentiate and die out. Octopine-typetype (strain LBA4404::pAL4404): Carry genes(3 required) to synthesize octopine in the plant and catabolism in the bacteria. Tumors do not differentiate, but remain as callus tissue. Nopaline-type (strain GV3101::pMP90 (ptic58)): Carry gene for synthesizing nopaline in the plant and for utilization (catabolism) in the bacteria. Tumors can differentiate into shooty masses (teratomas). 10
Gene Transfer using Agrobacterium Agro types LBA4404: rifampicin (chromosomal) and streptomycin (on the Ti plasmid) EHA105:rifampicin (chromosomal) and streptomycin (on the Ti plasmid) GV3101: streptomycin 500 mg/l 11 Hellens et al (2000; Trends in Plant Science 5:446-451)
Gene Transfer using Agrobacterium CSS451 Chromosomal and Vir Genes Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer Virulence genes vir A vir B vir C vir D vir E vir F vir G Chemoreceptor, activator of vir G Transmembrane complex Host-range specificity Site-specific endonuclease T-DNA processing and protection Host range specificity Positive regulator of vir B, C, D, E, F Chromosomal genes Attachment to plant cell, vir gene regulation 12
Disarmed Ti-plasmid T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism 13
Disarmed Ti-plasmid LB RB vir genes ori opine catabolism Disarmed Ti -plasmid 14
A Binary Vector Map 15
A Binary Vector Map Plant selectable marker Km R Bacterial selectable marker 16 From Dr. S. Gelvin, Purgue University
Introduction of Binary Vector into Agro Electroporation Freeze/Thaw Triparental Mating Agrobacterium Competent Agrobacterial Cells 17
Introduction of Binary Vector into Agro Electroporation Freeze/Thaw Liquid nitrogen (196C) 3 min---- ----37C 30 min 18
Binary Vector System Agro only Ti Helper Plasmid Agro/E. Coli Binary Vector Binary Vector System 19
Plant selectable marker Km R Bacterial selectable marker 20
Introduction of Binary Vector into Agro Agro colonies Agro culture Agro stock (-80C with Glycerol) 21
CSS451 Mechanism of Gene Transfer using Agrobacterium External Signals such as Acetosyringone Passage of T-DNA from Agrobacterium cells into plant22 genomic DNA Stanton B. Gelvin. Nature 433: 583-584 (2005)
Mechanism of Gene Transfer using Agrobacterium ------ The Plant Cell Step Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer The plant cell step of T-DNA transfer is poorly understood CSS451 Entry into plant cell? Nuclear uptake? Integration into chromosome? 23
24 CSS451
Expression of the Transgene CSS451 External Signal Cell Receptor Regulatory Elements Promoter Gene Terminator Where When How much Go Transcription STO P Constitutive promoters: CaMV35S, Actin, Ubi Inducible prompters: rbcs Tissue specific promoters: Cab mrna Protein Translation a stop codon (or termination codon): UAG (in RNA) / TAG (in DNA) ("amber"), UAA / TAA ("ochre"), and UGA / TGA ("opal" or "umber" 25
Summary: T-DNA transfer CSS451 1. Agrobacteria attach to plant cell surfaces at wound sites. 2. The plant releases wound signal compounds, such as acetosyringone. 3. Vir C and/or Vir F recognize the host plant cells. 4. The signal binds to vir A on the Agrobacterium membrane. 5. Vir A with signal bound activates vir G. 6. Activated vir G turns on other vir genes, including vir D and E. 7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left border. 8. Single stranded T-DNA is bound by vir E product as the DNA unwinds from the vir D cut site. Binding and unwinding stop at the right border. 9. Vir B + T-DNA complex is transferred to the plant cell, where it integrates in nuclear DNA. T-DNA codes for proteins that produce hormones and opines. Hormones encourage growth of the transformed plant tissue. Opines feed bacteria ----a carbon and nitrogen source. 26 Zhu et al. Journal of Bacteriology (2000)
Agrobacterium Preparation Agro-transformation Streak the plate Temperature: 30C Medium: LB Antibiotic: Km vector. Time: 2-3 days. Temperature: 30C Medium: LB, YEB, or YEP Antibiotic: Km or based on the SMG in the vector. Time: 24-48 hr. Concentration: O.D. 600 =0.5-1.0 27
Agrobacterium Protocols---Transformation CSS451 Tobacco Rice Tobacco Rice 4 Re-growth 1 Inoculation 5 Molecular verification of gene presence & expression 2 Co-cultivation PCR Southern Blot 3 Selection and regeneration 6 Flowering and setting seeds 28
The Floral Dip Method CSS451 A good stage for floral dipping Co-cultivation Infection Seed setting Harvest seeds Selection Agrobacterium-mediated t d transformation ti of Arabidopsis thaliana using the floral dip method 29 Zhang et al. Nature Protocols 1(2) (2006)
Experiment 2: Tobacco Transformation Objectives: To get familiarwith A. tumefaciens-mediated mediated transformation, such as explants, T-DNA, infection, co-cultivation, selection, binary vector, right border and left border, selectable marker gene (SMG), markers for screening, regeneration, antibiotics, and etc. To understand the differences between the wild-type T-DNA and the disarmed T-DNA. 30
Experiment 2: Tobacco Transformation CSS451 Agro strains: LBA4404:pBI121 & ACH5 1. LBA4404 has the Ach5 chromosomal background 2. ACH5 (ptiach5---a wild-type octopine plasmid) 3. LBA4404 (pal4404---a disarmed octopine plasmid) NOS-pro NPT II (Kan R ) NOS-ter 35S-pro GUS NOS-ter pbi121 LBA 4404 with the Ach5 chromosomal background exhibits clumping 31
Experiment 2 CSS451 Plant materials: Tobacco cv. Samsun Seeds Seed germination Seedling Plant Mature seeds harvested from wild type tobacco plant cv. Samsun 1. Surface sterilization (50% clorox + 0.02% Tween 20, 15 min; 4 washes in sterile water). 2. Seed germination on MS medium. Sterile seedling was maintained in Magenta box GA7 containing 50 ml MS medium. Subcuture cy cutting the internodes. Culture conditions: 25C, 16 h- photoperiod, 35-50 µe m -2 s -1. 32
Experiment 2 Explant preparation 1. Explant size: 0.5-0.8 cm X 0.5-0.8 cm. 2. To prepare the explants using sterile techniques. 3. Do not let the explants too dry. 1 Inoculation 1. Agro concentration: O.D. 600 = 0.5-0.8. 2. Infection time: 10-15 min. 3. Infection medium: Regeneration medium (RM) 4. Acetosyringone (Ac): 100 µm 2 Co-cultivation 1Cocultivation 1. Co-cultivation medium: RM 2-3 d A. tumefaciens 2. Co-cultivation time: 2-4 d 5 d S. meliloti 5 d M. loti 3. Environmental conditions: in the dark 5-11Rhizobium sp. NGR234 4. Ac: 100 µm 3 Selection and regeneration 1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn 2. Subculture: every 3 wk 33
CSS451 Explant preparation 1. Segments from hypocotyl, cotyledons, epicotyl, leaf, internodes and petiole (Dicot) 2. Embryogenic calluses (Monocot) 3. Well developed regeneration system via either organogenesis or somatic embryogenesis Inoculation 1. Agro concentration: O.D. OD 600 = 0508 0.5-0.8. 2. Infection time: 10-15 min. 3. Infection medium: Regeneration medium (RM) 4. Acetosyringone (Ac): 100 µm Co-cultivation 1. Co-cultivation medium: RM 2-3 d A. tumefaciens 5 d S. meliloti 5 d M. loti 5-11Rhizobium sp. NGR234 Selection and regeneration 2. Co-cultivation time: 2-4 d 3. Environmental conditions: i in the dark 4. Ac: 100 µm 1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn 2. Subculture: every 3 wk 34
CSS451 CSS/HRT 451 Biolistic-mediated transformation Guo-qing Song
Gene Delivery System Agrobacterium Viral vectors Biolistic Microinjection PEG - Polyethylene Glycol Electroporation
Biolistic Transformation ------- Advantage and Disadvantage Advantage: This method can be use to transform all plant species. No binary vector is required. Transformation protocol is relatively l simple. Disadvantage: Difficulty in obtaining single copy transgenic events. High cost of the equipment and microcarriers. Intracellular target is random (cytoplasm, nucleus, vacuole, plastid, etc.). Transfer DNA is not protected.
Gene Delivery System ------Biolistic-mediated transformation Known as: Particle Bombardment Biolistics Microprojectile bombardment Particle acceleration Particle inflow gun Gene gun Using a gene gun directly shoots a piece of DNA into the recipient plant tissue. Tungsten or gold beads are coated in the gene of interest t and fired through a stopping screen, accelerated by Helium, into the plant tissue. The particles pass through the plant cells, leaving the DNA inside.
Biolistic-Mediated Gene Transfer ------- Mechanism
Biolistic-Mediated Gene Transfer ------- Equipment PDS-1000/He The Helios Gene Gun www.bio-rad.com/genetransfer/ Particle Inflow Guns (PIG) http://www.oardc.ohio-state.edu/plantranslab/pig.htm
PDS-1000/He Biolistic-Mediated Gene Transfer ------- Equipment- PDS-1000/He DNA-coated microcarriers are loaded on microcarrier. Micro-carriers are shot towards target tissues during helium gas decompression. A stopping screen placed allowing the coated microprojectiles to pass through and reach the target cells. www.bio-rad.com/genetransfer/
Biolistic-Mediated Gene Transfer ------- PDS-1000/He References Arnold D et al., Proc Natl Acad Sci USA 91, 9970 9974 (1994) Castillo AM et al., Biotechnology 12, 1366 13711371 (1994) Duchesne LC et al., Can J For Res 23, 312 316 (1993) Fitzpatrick-McElligott S, Biotechnology 10, 1036 1040 (1992) Hartman CL et al., Biotechnology 12, 919 923 (1994) Heiser WC, Anal Biochem 217, 185 196 (1994) Lo DC et al., Neuron 13, 1263 1268 (1994) Sanford JC et al., Technique 3, 3 16 (1991) Shark KB et al., 480 485485 (1991) Smith FD et al., J Gen Microbiol 138, 239 248 (1992) Svab Z and Maliga P, Proc Natl Acad Sci USA 90, 913 917917 (1993) Toffaletti DL et al., J Bacteriol 175, 1405 1411 (1993) www.bio-rad.com/genetransfer/
Biolistic-Mediated Gene Transfer ------- Equipment- Particle Inflow Gun Finer JJ, P Vain, MW Jones, MD McMullen (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Reports 11:232-238. Vain P, N Keen, J Murillo, C Rathus, C Nemes, JJ Finer (1993) Development of the Particle Inflow Gun. Plant Cell Tiss Org Cult 33:237-246.
Biolistic-Mediated Gene Transfer ------- Equipment- Helios Gene Gun www.bio-rad.com/genetransfer/ The helium pulse sweeps the DNA- or RNA-coated gold microcarriers from the inside wall of the sample cartridge. The microcarriers accelerate for maximum penetration as they move through the barrel, while the helium pulse diffuses outward. The spacer maintains the optimal target distance for in vivo The spacer maintains the optimal target distance for in vivo applications and vents the helium gas away from the target to minimize cell surface impact.
Biolistic-Mediated Gene Transfer ------- Helios Gene Gun System References Fynan EF et al., DNA vaccines: Protective immunizations by parenteral, mucosal, and gene-gun inoculations, Proc Natl Acad Sci USA 90, 11478 11482 (1993) (99 Qiu P et al., Gene gun delivery of mrna in situ results in efficient transgene expression and genetic immunization, Gene Ther 3, 262 268 (1996) Sun WH et al., In vivo cytokine gene transfer by gene gun reduces tumor growth in mice, Proc Natl Acad Sci USA 92, 2889 28932893 (1995) Sundaram P et al., Particle-mediated delivery of recombinant expression vectors to rabbit skin induces high-titered polyclonal antisera (and circumvents purification of a protein immunogen), Nucleic Acids Res 24, 1375 1377 (1996) Tang DC et al., Genetic immunization is a simple method for eliciting an immune response, Nature 356, 152 154 (1992) www.bio-rad.com/genetransfer/
Biolistic Transformation ------- Parameters A number of parameters has been identified d and need to be considered d carefully in experiments involving particle bombardment Parameter categories: - Physical parameters - Biological parameters - Environmental parameters
Biolistic Transformation ------- Parameters - Physical parameters Nature, chemical and physical properties of the metal particles used as a macrocarrier for the foreign DNA Particles should be high enough mass in order to possess adequate momentum to penetrate into appropriate tissue. Suitable metal particles include gold, tungsten, palladium, rhodium, platinum and iridium. Metals should be chemically inert to prevent adverse reaction with DNA and cell components. Additional desirable properties for the metal include size and shape, as well as agglomeration and dispersion i properties diameter t 0.36-6 6 μm. Nature, preparation and binding of DNA onto the particles Target tissue -Biologicalparameters - Environmental parameters
Biolistic Transformation ------- Parameters - Physical parameters Nature, chemical and physical properties of the metal particles used as a macrocarrier for the foreign DNA Nature, preparation and binding of DNA onto the particles The nature of DNA (single vs double stranded, d circular vs linerizedi DNA). Optimal: double stranded circular DNA molecules (e.g. plasmid) In the process of coating the metal particls with DNA certain additives such as spermididne dd and CaClCl 2 appear to be useful. Target tissue -Biologicalparameters - Environmental parameters
Biolistic Transformation ------- Parameters - Physical parameters Nature, chemical and physical properties of the metal particles used as a macrocarrier for the foreign DNA Nature, preparation and binding of DNA onto the particles Target tissue It is important to target the appropriate cells that are competent for both transformation and regeneration. Depth of penetration is one of the most important variables in order to achieve particle delivery to particular cells. -Biologicalparameters - Environmental parameters
Biolistic Transformation ------- Parameters - Physical parameters -Biologicalparameters Temperature, photoperiod and humidity These parameters have a direct effect on the physiology of tissues. Such factors will influence receptiveness of target tissue to foreign DNA delivery and also affect its susceptibility to damage and injury that may adversely affect the outcome of transformation process. Some explants may require a healing period after bombardment under special regiments of light, temperature, and humidity. - Environmental parameters
Biolistic Transformation ------- Parameters - Physical parameters -Biologicalparameters - Environmental parameters Nature of explants as well as pre- and post-bombardment culture conditions. Explants derived from plants that are under stress will provide inferior materials for bombardment experiments. Metal particles need to be directed to the nucleus. Transformation frequencies may also be influenced by cell cycle stage. Osmotic pretreatment of target tissues has also been shown to be of importance. Physical trauma and tungsten toxicity were found to reduce efficiency of transformation rm ti n in experiments performed rmed with tobacco cell suspension culture.
Biolistic Transformation ------- Summary For biolistic transformation, tungsten or gold particles are coated with DNA and accelerated towards target plant tissues. Most devices use compressed helium as the force to accelerate the particles. The particles punch holes in the plant cell and ususally ypetetrate only 1-2 cell layerswall. Particle bombardment is a physical method for DNA introduction. h d l d h The DNA-coated particles can end up either near or in the nucleus,where the DNA comes off the particles and integrated into plant chromosomal DNA.