Agrobacterium-mediated transformation

Similar documents
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

GENE CLONING AND RECOMBINANT DNA TECHNOLOGY

Recombinant DNA and Biotechnology

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

Agrobacterium tumefaciens-mediated transformation of Colletotrichum graminicola and Colletotrichum sublineolum

Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development

Production of antigens and antibodies in plants: alternative technology?

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Chapter 23 Definitions of GMO/LMO and modern biotechnology. Three different definitions but the same legal interpretation?

ARABIDOPSIS. A Laboratory Manual DETLEF WEIGEL JANE GLAZEBROOK

restriction enzymes 350 Home R. Ward: Spring 2001

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Making transgenic plants

Biotechnology: DNA Technology & Genomics

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2

Genetic Engineering and Biotechnology

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure enzymes control cell chemistry ( metabolism )

Cells & Cell Organelles

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram. Project ID: 1 April 2000 to 31 August Project Duration:

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Milestones of bacterial genetic research:

Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein

Guidance. 2. Definitions. 1. Introduction

Molecular Genetics. RNA, Transcription, & Protein Synthesis

1 Mutation and Genetic Change

LAB 16 Rapid Colony Transformation of E. coli with Plasmid DNA

Transformation of the bacterium E. coli. using a gene for Green Fluorescent Protein

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP)

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

Recombinant DNA Technology

Microarray Technology

From DNA to Protein

Chapter 18: Applications of Immunology

HCS Exercise 1 Dr. Jones Spring Recombinant DNA (Molecular Cloning) exercise:

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Genetics Lecture Notes Lectures 1 2

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Structure and Function of DNA

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Transcription and Translation of DNA

Protein Synthesis How Genes Become Constituent Molecules

Respiration occurs in the mitochondria in cells.

GUIDELINES FOR THE REGISTRATION OF BIOLOGICAL PEST CONTROL AGENTS FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

Genetics Module B, Anchor 3

Forensic DNA Testing Terminology

An Overview of Cells and Cell Research

European Medicines Agency

KMS-Specialist & Customized Biosimilar Service

PLANT TRANSFORMATION: Problems and Strategies for Practical Application

Enzymes: Practice Questions #1

AP Biology Essential Knowledge Student Diagnostic

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

Cell Division Mitosis and the Cell Cycle

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

The Steps. 1. Transcription. 2. Transferal. 3. Translation

Basics of Immunology

TransformAid Bacterial Transformation Kit

Protein Expression. A Practical Approach J. HIGGIN S

2) Macrophages function to engulf and present antigen to other immune cells.

Multiple Choice Questions

CHAPTER 2 ANTIGEN/ANTIBODY INTERACTIONS

An Introduction to Transfection Methods Technical Reference Guide

PRACTICE TEST QUESTIONS

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins

Immunology Ambassador Guide (updated 2014)

Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell

The Huntington Library, Art Collections, and Botanical Gardens. How Sweet It Is: Enzyme Action in Seed Germination

Compartmentalization of the Cell. Objectives. Recommended Reading. Professor Alfred Cuschieri. Department of Anatomy University of Malta

13.2 Ribosomes & Protein Synthesis

Gene Therapy and Genetic Counseling. Chapter 20

Cell Biology Questions and Learning Objectives

Transfection. Transfection Technologies 282. Lipid Transfection Reagents 283. Electroporation Systems and Reagents 284

Date: Student Name: Teacher Name: Jared George. Score: 1) A cell with 1% solute concentration is placed in a beaker with a 5% solute concentration.

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

JIANGSU CARTMAY INDUSTRIAL CO.,LTD mail:

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

ELISA BIO 110 Lab 1. Immunity and Disease

How to construct transgenic mice

Name (print) Name (signature) Period. (Total 30 points)

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

10. T and B cells are types of a. endocrine cells. c. lymphocytes. b. platelets. d. complement cells.

RNA Viruses. A Practical Approac h. Alan J. Cann

Transcription:

CSS451 CSS/HRT 451 Agrobacterium-mediated transformation Guo-qing Song

Gene Delivery System Agrobacterium Viral vectors Biolistic Microinjection PEG - Polyethylene Glycol Electroporation 2

Biolistic Transformation ------- Advantage and Disadvantage Advantage: This method can be use to transform all plant species. No binary vector is required. Transformation protocol is relatively l simple. Disadvantage: Difficulty in obtaining single copy transgenic events. High cost of the equipment and microcarriers. Intracellular target is random (cytoplasm, nucleus, vacuole, plastid, etc.). Transfer DNA is not protected. 3

Learning Objectives Understand what key changes had to be made to the Agro tumor-inducing (Ti) or root-inducing (Ri) plasmid for the transfer of novel genes into plants Understand the binary plasmid transformation system Understand some mechanisms of gene transfer 4

OUTLINE CSS451 Agrobacterium Tumefaciens & Crown Gall Disease Mechanism of Gene Transfer using A. tumefaciens Ti-plasmid Chromosomal and Vir Genes T-DNA Transfer T-DNA Integration Engineering binary vectors for plant transformation Transformation protocols using Agrobacterium Factors influencing transformation efficiency 5

Why Agrobacterium? CSS451 Agrobacteria are naturally occurring, ubiquitous soil borne pathogens. A. tumefaciens causes crown gall disease (tumors) A. rhizogenes causes root hair disease (hairy root) Other bacterial groups also contain species capable of interkingdom genetic exchange (Gelvin 2005). Agrobacterium tumefaciens- or Agrobacterium rhizogenes-mediated transformation is to date the most commonly used method for obtaining transgenic plants. The tumorigenic host plant species for range A. tumefaciens include: Large number of dicots and some monocots and Gymnosperms. 6

7 CSS451

A.Tumefaciens & Crown Gall Disease CSS451 http://arabidopsis.info/students/agrobacterium/ Stanton B. Gelvin. Nature 433: 8 583-584 (2005).

Gene Transfer using Agrobacterium Ti-plasmid id GGCAGGATATTCAATTGTAAAT Left T-DNA border GGCAGGATATTCAATTGTAAAT Right T-DNA border Right and left border (RB, LB) sequences are the only parts of T-DNA needed to enable transfer into plants- 9 Removal of other T-DNA genes creates a disarmed Ti plasmid

Gene Transfer using Agrobacterium Agro types Hellens et al (2000; Trends in Plant Science 5:446-451) Agropine-type (strain EHA105::pEHA105): Carry genes for agropine synthesis and catabolism. Tumors do not differentiate and die out. Octopine-typetype (strain LBA4404::pAL4404): Carry genes(3 required) to synthesize octopine in the plant and catabolism in the bacteria. Tumors do not differentiate, but remain as callus tissue. Nopaline-type (strain GV3101::pMP90 (ptic58)): Carry gene for synthesizing nopaline in the plant and for utilization (catabolism) in the bacteria. Tumors can differentiate into shooty masses (teratomas). 10

Gene Transfer using Agrobacterium Agro types LBA4404: rifampicin (chromosomal) and streptomycin (on the Ti plasmid) EHA105:rifampicin (chromosomal) and streptomycin (on the Ti plasmid) GV3101: streptomycin 500 mg/l 11 Hellens et al (2000; Trends in Plant Science 5:446-451)

Gene Transfer using Agrobacterium CSS451 Chromosomal and Vir Genes Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer Virulence genes vir A vir B vir C vir D vir E vir F vir G Chemoreceptor, activator of vir G Transmembrane complex Host-range specificity Site-specific endonuclease T-DNA processing and protection Host range specificity Positive regulator of vir B, C, D, E, F Chromosomal genes Attachment to plant cell, vir gene regulation 12

Disarmed Ti-plasmid T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism 13

Disarmed Ti-plasmid LB RB vir genes ori opine catabolism Disarmed Ti -plasmid 14

A Binary Vector Map 15

A Binary Vector Map Plant selectable marker Km R Bacterial selectable marker 16 From Dr. S. Gelvin, Purgue University

Introduction of Binary Vector into Agro Electroporation Freeze/Thaw Triparental Mating Agrobacterium Competent Agrobacterial Cells 17

Introduction of Binary Vector into Agro Electroporation Freeze/Thaw Liquid nitrogen (196C) 3 min---- ----37C 30 min 18

Binary Vector System Agro only Ti Helper Plasmid Agro/E. Coli Binary Vector Binary Vector System 19

Plant selectable marker Km R Bacterial selectable marker 20

Introduction of Binary Vector into Agro Agro colonies Agro culture Agro stock (-80C with Glycerol) 21

CSS451 Mechanism of Gene Transfer using Agrobacterium External Signals such as Acetosyringone Passage of T-DNA from Agrobacterium cells into plant22 genomic DNA Stanton B. Gelvin. Nature 433: 583-584 (2005)

Mechanism of Gene Transfer using Agrobacterium ------ The Plant Cell Step Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer The plant cell step of T-DNA transfer is poorly understood CSS451 Entry into plant cell? Nuclear uptake? Integration into chromosome? 23

24 CSS451

Expression of the Transgene CSS451 External Signal Cell Receptor Regulatory Elements Promoter Gene Terminator Where When How much Go Transcription STO P Constitutive promoters: CaMV35S, Actin, Ubi Inducible prompters: rbcs Tissue specific promoters: Cab mrna Protein Translation a stop codon (or termination codon): UAG (in RNA) / TAG (in DNA) ("amber"), UAA / TAA ("ochre"), and UGA / TGA ("opal" or "umber" 25

Summary: T-DNA transfer CSS451 1. Agrobacteria attach to plant cell surfaces at wound sites. 2. The plant releases wound signal compounds, such as acetosyringone. 3. Vir C and/or Vir F recognize the host plant cells. 4. The signal binds to vir A on the Agrobacterium membrane. 5. Vir A with signal bound activates vir G. 6. Activated vir G turns on other vir genes, including vir D and E. 7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left border. 8. Single stranded T-DNA is bound by vir E product as the DNA unwinds from the vir D cut site. Binding and unwinding stop at the right border. 9. Vir B + T-DNA complex is transferred to the plant cell, where it integrates in nuclear DNA. T-DNA codes for proteins that produce hormones and opines. Hormones encourage growth of the transformed plant tissue. Opines feed bacteria ----a carbon and nitrogen source. 26 Zhu et al. Journal of Bacteriology (2000)

Agrobacterium Preparation Agro-transformation Streak the plate Temperature: 30C Medium: LB Antibiotic: Km vector. Time: 2-3 days. Temperature: 30C Medium: LB, YEB, or YEP Antibiotic: Km or based on the SMG in the vector. Time: 24-48 hr. Concentration: O.D. 600 =0.5-1.0 27

Agrobacterium Protocols---Transformation CSS451 Tobacco Rice Tobacco Rice 4 Re-growth 1 Inoculation 5 Molecular verification of gene presence & expression 2 Co-cultivation PCR Southern Blot 3 Selection and regeneration 6 Flowering and setting seeds 28

The Floral Dip Method CSS451 A good stage for floral dipping Co-cultivation Infection Seed setting Harvest seeds Selection Agrobacterium-mediated t d transformation ti of Arabidopsis thaliana using the floral dip method 29 Zhang et al. Nature Protocols 1(2) (2006)

Experiment 2: Tobacco Transformation Objectives: To get familiarwith A. tumefaciens-mediated mediated transformation, such as explants, T-DNA, infection, co-cultivation, selection, binary vector, right border and left border, selectable marker gene (SMG), markers for screening, regeneration, antibiotics, and etc. To understand the differences between the wild-type T-DNA and the disarmed T-DNA. 30

Experiment 2: Tobacco Transformation CSS451 Agro strains: LBA4404:pBI121 & ACH5 1. LBA4404 has the Ach5 chromosomal background 2. ACH5 (ptiach5---a wild-type octopine plasmid) 3. LBA4404 (pal4404---a disarmed octopine plasmid) NOS-pro NPT II (Kan R ) NOS-ter 35S-pro GUS NOS-ter pbi121 LBA 4404 with the Ach5 chromosomal background exhibits clumping 31

Experiment 2 CSS451 Plant materials: Tobacco cv. Samsun Seeds Seed germination Seedling Plant Mature seeds harvested from wild type tobacco plant cv. Samsun 1. Surface sterilization (50% clorox + 0.02% Tween 20, 15 min; 4 washes in sterile water). 2. Seed germination on MS medium. Sterile seedling was maintained in Magenta box GA7 containing 50 ml MS medium. Subcuture cy cutting the internodes. Culture conditions: 25C, 16 h- photoperiod, 35-50 µe m -2 s -1. 32

Experiment 2 Explant preparation 1. Explant size: 0.5-0.8 cm X 0.5-0.8 cm. 2. To prepare the explants using sterile techniques. 3. Do not let the explants too dry. 1 Inoculation 1. Agro concentration: O.D. 600 = 0.5-0.8. 2. Infection time: 10-15 min. 3. Infection medium: Regeneration medium (RM) 4. Acetosyringone (Ac): 100 µm 2 Co-cultivation 1Cocultivation 1. Co-cultivation medium: RM 2-3 d A. tumefaciens 2. Co-cultivation time: 2-4 d 5 d S. meliloti 5 d M. loti 3. Environmental conditions: in the dark 5-11Rhizobium sp. NGR234 4. Ac: 100 µm 3 Selection and regeneration 1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn 2. Subculture: every 3 wk 33

CSS451 Explant preparation 1. Segments from hypocotyl, cotyledons, epicotyl, leaf, internodes and petiole (Dicot) 2. Embryogenic calluses (Monocot) 3. Well developed regeneration system via either organogenesis or somatic embryogenesis Inoculation 1. Agro concentration: O.D. OD 600 = 0508 0.5-0.8. 2. Infection time: 10-15 min. 3. Infection medium: Regeneration medium (RM) 4. Acetosyringone (Ac): 100 µm Co-cultivation 1. Co-cultivation medium: RM 2-3 d A. tumefaciens 5 d S. meliloti 5 d M. loti 5-11Rhizobium sp. NGR234 Selection and regeneration 2. Co-cultivation time: 2-4 d 3. Environmental conditions: i in the dark 4. Ac: 100 µm 1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn 2. Subculture: every 3 wk 34

CSS451 CSS/HRT 451 Biolistic-mediated transformation Guo-qing Song

Gene Delivery System Agrobacterium Viral vectors Biolistic Microinjection PEG - Polyethylene Glycol Electroporation

Biolistic Transformation ------- Advantage and Disadvantage Advantage: This method can be use to transform all plant species. No binary vector is required. Transformation protocol is relatively l simple. Disadvantage: Difficulty in obtaining single copy transgenic events. High cost of the equipment and microcarriers. Intracellular target is random (cytoplasm, nucleus, vacuole, plastid, etc.). Transfer DNA is not protected.

Gene Delivery System ------Biolistic-mediated transformation Known as: Particle Bombardment Biolistics Microprojectile bombardment Particle acceleration Particle inflow gun Gene gun Using a gene gun directly shoots a piece of DNA into the recipient plant tissue. Tungsten or gold beads are coated in the gene of interest t and fired through a stopping screen, accelerated by Helium, into the plant tissue. The particles pass through the plant cells, leaving the DNA inside.

Biolistic-Mediated Gene Transfer ------- Mechanism

Biolistic-Mediated Gene Transfer ------- Equipment PDS-1000/He The Helios Gene Gun www.bio-rad.com/genetransfer/ Particle Inflow Guns (PIG) http://www.oardc.ohio-state.edu/plantranslab/pig.htm

PDS-1000/He Biolistic-Mediated Gene Transfer ------- Equipment- PDS-1000/He DNA-coated microcarriers are loaded on microcarrier. Micro-carriers are shot towards target tissues during helium gas decompression. A stopping screen placed allowing the coated microprojectiles to pass through and reach the target cells. www.bio-rad.com/genetransfer/

Biolistic-Mediated Gene Transfer ------- PDS-1000/He References Arnold D et al., Proc Natl Acad Sci USA 91, 9970 9974 (1994) Castillo AM et al., Biotechnology 12, 1366 13711371 (1994) Duchesne LC et al., Can J For Res 23, 312 316 (1993) Fitzpatrick-McElligott S, Biotechnology 10, 1036 1040 (1992) Hartman CL et al., Biotechnology 12, 919 923 (1994) Heiser WC, Anal Biochem 217, 185 196 (1994) Lo DC et al., Neuron 13, 1263 1268 (1994) Sanford JC et al., Technique 3, 3 16 (1991) Shark KB et al., 480 485485 (1991) Smith FD et al., J Gen Microbiol 138, 239 248 (1992) Svab Z and Maliga P, Proc Natl Acad Sci USA 90, 913 917917 (1993) Toffaletti DL et al., J Bacteriol 175, 1405 1411 (1993) www.bio-rad.com/genetransfer/

Biolistic-Mediated Gene Transfer ------- Equipment- Particle Inflow Gun Finer JJ, P Vain, MW Jones, MD McMullen (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Reports 11:232-238. Vain P, N Keen, J Murillo, C Rathus, C Nemes, JJ Finer (1993) Development of the Particle Inflow Gun. Plant Cell Tiss Org Cult 33:237-246.

Biolistic-Mediated Gene Transfer ------- Equipment- Helios Gene Gun www.bio-rad.com/genetransfer/ The helium pulse sweeps the DNA- or RNA-coated gold microcarriers from the inside wall of the sample cartridge. The microcarriers accelerate for maximum penetration as they move through the barrel, while the helium pulse diffuses outward. The spacer maintains the optimal target distance for in vivo The spacer maintains the optimal target distance for in vivo applications and vents the helium gas away from the target to minimize cell surface impact.

Biolistic-Mediated Gene Transfer ------- Helios Gene Gun System References Fynan EF et al., DNA vaccines: Protective immunizations by parenteral, mucosal, and gene-gun inoculations, Proc Natl Acad Sci USA 90, 11478 11482 (1993) (99 Qiu P et al., Gene gun delivery of mrna in situ results in efficient transgene expression and genetic immunization, Gene Ther 3, 262 268 (1996) Sun WH et al., In vivo cytokine gene transfer by gene gun reduces tumor growth in mice, Proc Natl Acad Sci USA 92, 2889 28932893 (1995) Sundaram P et al., Particle-mediated delivery of recombinant expression vectors to rabbit skin induces high-titered polyclonal antisera (and circumvents purification of a protein immunogen), Nucleic Acids Res 24, 1375 1377 (1996) Tang DC et al., Genetic immunization is a simple method for eliciting an immune response, Nature 356, 152 154 (1992) www.bio-rad.com/genetransfer/

Biolistic Transformation ------- Parameters A number of parameters has been identified d and need to be considered d carefully in experiments involving particle bombardment Parameter categories: - Physical parameters - Biological parameters - Environmental parameters

Biolistic Transformation ------- Parameters - Physical parameters Nature, chemical and physical properties of the metal particles used as a macrocarrier for the foreign DNA Particles should be high enough mass in order to possess adequate momentum to penetrate into appropriate tissue. Suitable metal particles include gold, tungsten, palladium, rhodium, platinum and iridium. Metals should be chemically inert to prevent adverse reaction with DNA and cell components. Additional desirable properties for the metal include size and shape, as well as agglomeration and dispersion i properties diameter t 0.36-6 6 μm. Nature, preparation and binding of DNA onto the particles Target tissue -Biologicalparameters - Environmental parameters

Biolistic Transformation ------- Parameters - Physical parameters Nature, chemical and physical properties of the metal particles used as a macrocarrier for the foreign DNA Nature, preparation and binding of DNA onto the particles The nature of DNA (single vs double stranded, d circular vs linerizedi DNA). Optimal: double stranded circular DNA molecules (e.g. plasmid) In the process of coating the metal particls with DNA certain additives such as spermididne dd and CaClCl 2 appear to be useful. Target tissue -Biologicalparameters - Environmental parameters

Biolistic Transformation ------- Parameters - Physical parameters Nature, chemical and physical properties of the metal particles used as a macrocarrier for the foreign DNA Nature, preparation and binding of DNA onto the particles Target tissue It is important to target the appropriate cells that are competent for both transformation and regeneration. Depth of penetration is one of the most important variables in order to achieve particle delivery to particular cells. -Biologicalparameters - Environmental parameters

Biolistic Transformation ------- Parameters - Physical parameters -Biologicalparameters Temperature, photoperiod and humidity These parameters have a direct effect on the physiology of tissues. Such factors will influence receptiveness of target tissue to foreign DNA delivery and also affect its susceptibility to damage and injury that may adversely affect the outcome of transformation process. Some explants may require a healing period after bombardment under special regiments of light, temperature, and humidity. - Environmental parameters

Biolistic Transformation ------- Parameters - Physical parameters -Biologicalparameters - Environmental parameters Nature of explants as well as pre- and post-bombardment culture conditions. Explants derived from plants that are under stress will provide inferior materials for bombardment experiments. Metal particles need to be directed to the nucleus. Transformation frequencies may also be influenced by cell cycle stage. Osmotic pretreatment of target tissues has also been shown to be of importance. Physical trauma and tungsten toxicity were found to reduce efficiency of transformation rm ti n in experiments performed rmed with tobacco cell suspension culture.

Biolistic Transformation ------- Summary For biolistic transformation, tungsten or gold particles are coated with DNA and accelerated towards target plant tissues. Most devices use compressed helium as the force to accelerate the particles. The particles punch holes in the plant cell and ususally ypetetrate only 1-2 cell layerswall. Particle bombardment is a physical method for DNA introduction. h d l d h The DNA-coated particles can end up either near or in the nucleus,where the DNA comes off the particles and integrated into plant chromosomal DNA.