GENETIC CHARACTERIZATION OF INDIGENOUS ANATOLIAN WATER BUFFALO BREED USING MICROSATELLITE DNA MARKERS



Similar documents
An Investigation on the Water Buffalo Breeding in Danamandira Village of Silivri District of Istanbul Province of Turkey

PrimeSTAR HS DNA Polymerase

Milk protein genetic variation in Butana cattle

PicoMaxx High Fidelity PCR System

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.

Polymorphism of selected microsatellite DNA sequences in Simmental cattle chosen for identification of QTLs for meat traits

DNA: A Person s Ultimate Fingerprint

Forensic DNA Testing Terminology

SLAUGHTER AND CARCASS TRAITS OF NATIVE GEESE REARED IN MUŞ PROVINCE

1/12 Dideoxy DNA Sequencing

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Commonly Used STR Markers

A quick and simple method for the identi cation of meat species and meat products by PCR assay

Terra PCR Direct Polymerase Mix User Manual

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

Gene Mapping Techniques

BacReady TM Multiplex PCR System

Application Guide... 2

Individualization of tiger by using microsatellites

RT-PCR: Two-Step Protocol

Analysis of Genetic Polymorphism with Microsatellite Method in Turkey Local Sheep Breeds

GENOTYPING ASSAYS AT ZIRC

GenScript BloodReady TM Multiplex PCR System

DNA MARKERS FOR ASEASONALITY AND MILK PRODUCTION IN SHEEP. R. G. Mateescu and M.L. Thonney

Troubleshooting for PCR and multiplex PCR

Troubleshooting Sequencing Data

HiPer RT-PCR Teaching Kit

Introduction. Preparation of Template DNA

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis

HISTO TYPE SSP Immunogenetic Diagnostics. Robust and fast - validated Taq Polymerase included

Annex to the Accreditation Certificate D-PL according to DIN EN ISO/IEC 17025:2005

Forensic Science International: Genetics

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

360 Master Mix. , and a supplementary 360 GC Enhancer.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

DNA and Forensic Science

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.

Genetic conservation of microsatellite sequences in Suidae* *

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

IMBB Genomic DNA purifica8on

Aurora Forensic Sample Clean-up Protocol

BigDye Terminator v3.1 Cycle Sequencing Kit. Protocol. DRAFT August 27, :32 pm, A_v3.1Title.fm

ABSTRACT. Promega Corporation, Updated September Campbell-Staton, S.

First Strand cdna Synthesis

DNA Sequence Analysis

Human Herpes Virus 4 (Epstein Barr)

PNA BRAF Mutation Detection Kit

Procedures For DNA Sequencing

Reverse Transcription System

mircute mirna qpcr Detection Kit (SYBR Green)

SUMMARY Contribution to the cow s breeding study in one of the small and middle sizes exploitation in Dobrogea

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Hepatitis B Virus Genemer Mix

Introduction To Real Time Quantitative PCR (qpcr)

TaqMan Fast Advanced Master Mix. Protocol

DNA Core Facility: DNA Sequencing Guide

Genomic Selection in. Applied Training Workshop, Sterling. Hans Daetwyler, The Roslin Institute and R(D)SVS

Technical Manual No Update Date

Table of Contents. I. Description II. Kit Components III. Storage IV. 1st Strand cdna Synthesis Reaction... 3

TURKHAYGEN-I PROJECT DATABANK: USING DATABASE AND INFORMATICS TECHNOLOGY ON BIOLOGICAL DATA ORGANIZATION

DNA MICROSATELLITE ANALYSIS OF HORSE AND CATTLE BREEDS

SYBR Green Realtime PCR Master Mix -Plus-

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Y Chromosome Markers

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

Abbreviation key: NS = natural service breeding system, AI = artificial insemination, BV = breeding value, RBV = relative breeding value

Objectives: Vocabulary:

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

Association between Dopamine Gene and Alcoholism in Pategar Community of Dharwad, Karnataka

Taq98 Hot Start 2X Master Mix

ARTICLE IN PRESS. Small Ruminant Research xxx (2010) xxx xxx. Contents lists available at ScienceDirect. Small Ruminant Research

Preparing Samples for Sequencing Genomic DNA

ZR DNA Sequencing Clean-up Kit

illustra puretaq Ready-To-Go PCR Beads

QIAGEN Multiplex PCR Handbook

Chromatin Immunoprecipitation

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

Real-time quantitative RT -PCR (Taqman)

RealStar HBV PCR Kit /2012

PCR Instruments and Consumables

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

Real-Time PCR Vs. Traditional PCR

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

BuccalAmp DNA Extraction Kit QuickExtract DNA Extraction Solution 1.0

Path-ID Multiplex One-Step RT-PCR Kit

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Assist.Prof.Dr. Hasan ÇİÇEK

Herculase Hotstart DNA Polymerase

Transcription:

GENETIC CHARACTERIZATION OF INDIGENOUS ANATOLIAN WATER BUFFALO BREED USING MICROSATELLITE DNA MARKERS SOYSAL, M. _. 1 E. OZKAN 2 S. KOK 3 Y.T.TUNA 4 E.K.GURCAN 4 SUMMARY One indigenous water buffalo population to Anatolia were characterised with 11 cattle autosomal microsatellite loci. A set of 4 cattle microsatellite loci was found to be polymorphic in the Anatolian buffalo genome. Genotyping of these polymorphic microsatellite loci revealed alleles ranging from 3 to 9. The observed heterozygosity ranged from 0.550 to 0.775 and the expected heterozygosity ranged from 0.494 to 0.815. The F IS value changed from 0.101 to 0.205. This result shown that, Anatolian water buffalo population samples seemed to be in Hardy- Weinberg expectation. INTRODUCTION The number of water buffaloes in the world has decreased rapidly over the past three decades (Georgoudis et al., 1998). Most of world buffaloes live in Asia, Egypt, Southern and south-eastern Europe. Also buffaloes have played an important role in the rural economy of developing Asian country from ancient times. According to FAO (2000) data, there are about 166 million domesticated buffaloes raised in the five world continents. However, there are about 158 million buffaloes left in the world (FAO statistics, 2003). Roughly 97 percent of them or 153 million heads are water buffaloes essentially found in the Asian region. Also, in Turkey the buffaloes population have declined dramatically over the last decades. The total population according to FAO statistics is 164.000 heads (2003). Their breeding areas are especially middle of Black sea region in Turkey. These animal are mainly used for milk and meat production in this areas. The creamy part of milk fat of water 1 Prof. Dr., Trakya University, Agriculture Faculty, Department of Animal Science,, 59030 Tekirda_, Turkey 2 Res. Asst., Trakya University, Agriculture Faculty, Department of Animal Science,, 59030 Tekirda_, Turkey 3 Asst. Prof. Dr., Trakya University, Kesan 4 Asst. Prof. Dr., Trakya University, Agriculture Faculty, Department of Animal Science,, 59030 Tekirda_, Turkey

buffaloes milk is populer accompanies to famous Turkish desert. Water buffaloe milk is preferably take place at least in some persantage in Turkish sausage making ındustry. It is estimated that, 4-5 % of total milk and meat production comes from buffaloes sources. 3.65 % percent of red meat production sources from buffaloes genotypes. Total 40-60 % of buffaloes population are raised in Middle of Black Sea region. The largest number of buffalo population existed in Black sea region. Eastern Anatolian buffalo population has second biggest number of population. Third biggest number of population in the Marmara region existed in Istanbul and surroundings this city. Feeding is based on grazing, straw and concentrates. Their purpose of raising is firstly milk and secondly meat production. Table 1 shown that several characteristics about Anatolian water buffalo raised in Turkey. This study was estimated to examine the within population genetic diversity using microsatellite markers. MATERIALS AND METHODS The numbers of animals sampled from the Anatolian water buffalo were 40 individuals. Blood samples of unrelated animals were collected in slaugterhouse in Silivri of Marmara region. Bloods were collected in 10 ml tubes containing K 2 EDTA and stored at 20 0 C until the DNA was extracted by the standart Phenol Chloroform technique (Sambrook, J. et all, 1989). The microsatellite loci used in the study and their characteristics are given in Table 2. The PCR analyses were carried out using an Applied Biosystems GeneAmp PCR System 2700 thermal cycler. The reaction mixture was composed of genomic DNA (100 ng), 200_ m dntps, 2.0 mm MgCl 2, 1X PCR buffer, 5 pmol forward and reversed primers and Taq DNA polymerase (0.5 u/sample) in a total volume of 20 _ l. All samples were amplified in a reaction volume of 20 _ l containing 11.7 _ l of (dh 2 O) distilled water. The PCR reactions were carried out in 0.2 ml PCR plates with the following PCR conditions: 1 cycle of initial denaturation for 5 minutes at 94 0 C, 30 cycle of 45 seconds at 94 0 C, 45 seconds at annealing temperature, 1 minute at 72 0 C and 1 cycle of final extension for 10 minutes at 72 0 C. In order to minimize the artifacts caused during the amplification leading to false size estimations, one or more positive controls were used in each PCR reaction together with a negative control. The PCR product were checked on a 2% Agarose gel

together with DNA size markers standards. For all microsatellites allele size was determined on all samples with a Perkin Elmer ABI Prism 310 Genetic Analyzer using the GeneScan Software (Perkin Elmer). DATA ANALYSIS For the population and for each locus number of alleles (n A ), observed heterozygosity (H 0 ) and unbiased expected heterozygosity (H e ) were calculated using Genetix 4.0 Programs. Also the averages of n A, H 0, H e based on four loci were also computed. The population F IS value of Wright s F statistics based on four loci were estimated and used to test the deviation from the Hardy Weinberg equilibrium. All of the above computations were performed by using Genetix 4.0 statistical programs. RESULTS AND DISCUSSION Heterologous cattle microsatellite markers have been tested on Anatolian buffalo genome. A set of 11 (TGLA227, ILSTS005, CSSM66, BM1818, ETH10, ETH225, ETH3, HAUT24, HEL5, TGLA122, TGLA126) cattle microsatellite loci was analysed in Anatolian buffalo samples. Four cattle microsatellite loci was found to be polymorphic in the anatolian buffalo genome. Allele frequencies for each of four microsatellite loci in each of the individuals are reported. The number of alleles Per locus varied from 3 (ILSTS005) to 9 (BM1818). The mean number of alleles Per locus is about 6.75. Allele numbers distribution at the four analysed loci is given in Table 3. The observed heterozygosity ranged from 0.550 to 0.775, and the expected heterozygosity ranged from 0.494 to 0.815. Arora et al (2003), was studied physical and microsatellite characterization of Tarai Buffalo of India. The Tarai buffalo is riverine with 50 chromosomes, which is similar to Anatolian water buffalo population which is called as subgroup of Mediterrenean water buffaloes. Arora et al (2003), had studyed on heterologous cattle microsatellite loci and were used them for molecular genetic characterization of Tarai genome. A set of 22 cattle microsatellite loci was found to be polymorphic in the Tarai genome. Genotyping of these polymorphic microsatellite loci revealed alleles ranging from two to seven. Observed heterozygosity of changed from 0.1316 to 0.9231. Mean observed heterozygosity of 0.60 in the Tarai buffalo population. Expected heterozygosity of changed from 0.1246 to 0.8149.

BM1818, CSSM66 and ILSTS005 microsatellite loci was found polymorphic in the Tarai buffalo population and also Anatolian water buffalo population. Anatolian water buffalo population heretozygosity was found to similar in Tarai buffalo population. Moioli et al (2001) was studied genetic diversity between Greek, Italian and Egyptian buffalo populations with using 13 polymorphic microsatellite loci. The number of alleles Per locus varied from two (ILSTS005) to 19 (ETH03). Only for two loci (CSSM33 and ILSTS005), all detected alleles were found in all three country populations (Italian, Greek and Egyptian). ILSTS005 loci was shown 3 alleles in Anatolian water buffalo population. Observed average heterozygosity was 0.135, 0.151 and 0.158 in the Italian Greek and Egyptian populations, respectively. It was lower, although not significantly different from the expected heterozygosity (0.173, 0.176 and 0.190 respectively for the Italian, Greek and Egyptian). But Anatolian water buffalo population observed and expected heterozygosity was found very high. The Anatolian water buffalo population F IS value changed from 0.101 to 0.205. This result shown that, Anatolian water buffalo population samples seemed to be in Hardy Weinberg expectation. As a conclusion, it can be said that the present study revealed the presence of high degree of genetic diversity within the water buffalo populations of Turkey. ACKNOWLEDGEMENTS We would like to thank Prof. Dr. Donato Matasino, Dr. Tiziana Sarracco, Dr. Maria Consilia Occidente for helping to study the water buffalo microsatellite loci in ConsDABI.

Table 1. Several Characteristics About Anatolian Water Buffalo Raised in Turkey Maximum Minimum Sources Lactation Yield (kg) 1070.5_279.9 709.6_23.0 _ekerden et al (2000b) Uslu, N.T. (1970b) Lactation Length (day) 269.2_70.0 222.0_44.2 _ekerden et al (2000a) _ekerden et al (2000b) Fat (%) 8.1_0.205 6.6_0.68 Kök, S., (1996) _ekerden et al (2000a) Adulty Body Weight 518.6_17.2 411.0_9.07 _larslan et al (1983) Uslu N.T, (1970a) Calving Interval 434.3_57.1 365.2_17.5 _ekerden et al (2000a) _larslan et al (1983) Ageat first Insemination(day) 679.7_210.9 _ekerden et al (2000a) Age at first calving (day) 1313.2_234.8 964.1_3.94 _ekerden et al (2000b) _larslan et al (1983) Birth Weight (Male) 34.3_1.20 26.7_0.52 Alaçam et al. (1992) Uslu N.T; (1970b) Birth Weight (Female) 31.6_0.90 22.1_0.48 Alaçam et al. (1992) Uslu N.T., (1970b) Servis Periyodu 112.45 70.8 _larslan et al (1983) _ekerden et al (2000b) Gestation Lenght (day) 326.5_5.8 (artificial ınsemination) 317.0_51.5 (natural insemination) _zgi and Asker, (1989) _zgi and Asker, (1989) Daily Live Weight Gaining (gr) (Male) (Female) _ekerden et al. (2000c) (0-3 Month) Male 0.483 Female 0.456 Daily Live Weight Gaining (gr) (Male) (Female) _ekerden et al. (2000c) (3-6 Month) Male 0.305 Female 0.294 Daily Live Weight Gaining (gr) (Female) (Male) _ekerden et al. (2000c) (6-9 Month) Male 0.314 Female 0.357 Daily Live Weight Gaining (gr) (Male) (Female) _ekerden et al. (2000c) (9-12 Month) Male 0.504 Female 0.360 Fat Content of Milk 8.1 6.1 Kök, S. (1996) (Soysal and Kök, 1997) Total Solid Matter of Milk 17.7 (3. Lactation) 15.3 (1. Lactation) _ekerden et al.(2000b) Ash % of Milk 0.830 0.743 _ekerden et al.(2000a) _ekerden et al.(2000b) Water of Milk 82.3 Kök, S.; (1996) Protein % of Milk 4.6 4.2 _ekerden et al. (2000a) (Soysal and Kök, 1997)(Kök, S., 1996) Caseine % of Milk 3.4 (3. Lactation) 3.0 (1. Lactation) _ekerden et al.(2000b)

Table 2. The table shows the name of the microsatellite loci used in the study, their primer sequences, Polymorphism information contents (PIC), annealing temperature, the chromosome number the belong to, and the references articles. Locus Name Primer Sequence PIC Annealing Chromosome Reference Temp. ( 0 C) Number TGLA227 CGAATTCCAAATCTGTTAATTTGCT ACAGACAGAAACTCAATGAAAGCA 55 18 Steigleder et al, (2004) ILSTS005 GGAAGCAATGAAATCTATAGCC TGTTCTGTGAGTTTGTAAGC 0.42 55 10 Arora et al, (2003) CSSM66 ACACAAATCCTTTCTGCCAGCTGA AATTTAATGCACTGAGGAGCTTGG 0.49 58 14 Arora et al, (2003) BM1818 AGCTGGGAATATAACCAAAGG AGTGCTTTCAAGGTCCATGC 0.40 58 23 Arora et al, (2003) Table 3. Characteristics of Bovine Microsatellite Markers Tested on Anatolian Water Buffalo Population. LOCUS Number of alleles Observed Expected Heterozygosity H n.b. F IS (n A ) Heterozygosity (H O ) (He) TGLA227 7 0.600 0.743 0.753 0.205 ILSTS005 3 0.550 0.494 0.500-0.101 CSSM66 8 0.775 0.707 0.716-0.084 BM1818 9 0.750 0.815 0.825 0.092 Mean 6.75 0.668 0.689 0.698 0.043 REFERENCES Arora, R., Lakhchaura B.D., Prosad R.B., Chauhan, A., Bais R.K.S., tantia M.S., Vijh R.K., (2003). Physical and Microsatellite Based Characterization of Tarai Buffalo of India. Buffalo Newsletter, Number 19, June 2003. FAO (2003), Food and Agricultural Organization of The United Nation (FAO). Rome, 2003 (http://www.fao.org) Georgoudis, A. G., V.P. Papanastasis and J.G. Boyazo_lu (1998). Use of Water Buffalo for Environmental Conservation of Waterland. Review. Symposium VIII. Entitled Role of Water Buffaloes in Producing Foods of the 8 th World Conference on June 30, 1998 at Seoul National University, Seoul, Korea. _larslan, M., Karabulut A.; A_kın, A., _zgi N. (1983). Yerli Mandalarda Vücut Yapısı, Döl ve Süt Verimi Üzerine Ara_tırmalar. Zirai Ara_. Enst. Yay. No:14 Afyon _zgi, A.N., Asker, R. (1989). Çe_itli Çevre _artlarının Mandaların Do_um A_ırlı_ı Üzerine Etkisi. Mandacılık Ara_. Enst. Yayın No:18 Afyon.

Kök, S. (1996). Marmara ve Karadeniz Bölgesinin Çe_itli _llerindeki manda Populasyonlarının Kimi Morfolojik ve genetik Özellikleri Üzerinde Bir Ara_tırma. Trakya Üniv. Fen Bilimleri Enst. Doktora Tezi. Molioli, B., A. Georgoudis, F.Napolitano, G. Catillo, E. Giubilei, Ch. Ligda, M. Hassonane (2001). Genetic Diversity Between Italian, Greek and Egyptian Buffalo Populations. Livestock Production Science 70 (2001). 203-211. Sambrook, J., Fritsch E. F., Manıatıs T., (1989). Molecular Closing: A laboratory Manual (2 nd ed.) 3 vol., Cold-Spring Horbar, NewYork (1989). Soysal, M._., S.Kök, 1997. Ergin Mandaların Bazı Vücut Özelliklerine _li_kin Korelasyon Matrixi Sonuçları. T.Ü.Tekirda_ Ziraat Fak. Zootekni Bölümü, Trakya Bölgesi II.Hayvancılık Sempozyumu Kitabı S.147-149. Steigleder, C.S., E.A. Almeida and T.A. Weimer (2004). Genetic Diversity od a Brazilian Crerole cattle Based on Fourteen Microsatellite Loci. Arch. Zootec. 53:3-11.2004. _ekerden Ö., Kebapçı, M., Kopar, A., (2000c).Kocatepe tarımsal Ara_tırma Enstitüsü Anadolu Manda Sürüsünün Kan Serumu Tf Tipleri, Tf tipleri için Genetik Yapısı ve Büyüme Performansı, Tf Tipleri ve Büyüme Özelli_i Arasındaki _li_kiler. Atatürk Üniv. Ziraat Fakültesi Derg. (Basımda). _ekerden, Ö. (2001). Büyükba_ Hayvan Yeti_tirme (Manda Yeti_tiricili_i). Temizyürek Matbaacılık Antakya-Hatay S:18-25 _ekerden, Ö., Kebapçı, M.; (2000b) Afyon Kocatepe Tarımsal Ara_tırma Enstitüsü Anadolu Mandalarında Laktasyon Süt Verim Ve Bile_iminin Laktasyon Dönemlerine Göre De_i_imi. Süt ve Döl Verim Özellikleri. Atatürk Üniversitesi Zir. Fak. Dergisi (Basımda). _ekerden, Ö., Tapkı, _. (2000a). Mustafa Kemal Üniversitesi Manda Sürüsü Süt ve Döl Verim Özellikleri. Atatürk Üniversitesi Zir. Fak. Dergisi (Basımda). Uslu, N.T., (1970a) Afyon Bölgesi Mandalarının Çe_itli Özellikleri ve Köy _artlarında Süt Verimleri Üzerinde Mukayeseli Ara_tırmalar. (Doktora Tezi) Birlik Matbaası, Bornova (1970). Uslu, N.T., (1970b) Büyüme Döneminde Bulunan Mandaların Protein ve Ni_asta De_eri _htiyaçları Üzerinde Çalı_malar. Yem Bitkileri Deneme ve Üretme _st. Yayın No.5 Afyon.