BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit and protocol, so it is important to always use the protocol included with the kit. NEXTflex Small RNA Barcode Primers Set A (Illumina Compatible) Catalog #: 513305 (96 reactions) BIOO Scientific Corp. 2014 V14.07
TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents, Storage and Shelf Life... 1 Warnings and Precautions... 1 APPENDIX A... 2 Oligonucleotide Sequences... 2 RELATED PRODUCTS... 3 Illumina Compatible DNA NGS Kits and Adapters... 3 DNA Fragmentation... 4 Illumina Compatible RNA NGS Kits and Adapters... 5 The NEXTflex Small RNA Barcode Primers are intended for laboratory use only. NEXTflex is a trademark of Bioo Scientific.
GENERAL INFORMATION GENERAL INFORMATION Product Overview The NEXTflex Small RNA Barcode Primers are designed to prepare multiplexed small RNA libraries for sequencing using Illumina platforms. The index is designed within the NEXTflex barcode primers and incorporated during PCR. Pooling of samples may be performed either after PCR or after gel validation. Contents, Storage and Shelf Life The NEXTflex Small RNA Barcode Primers contain 12 barcoded primers with enough material for 8 reactions each when using the NEXTflex Small RNA Sequencing Kit v2 (catalog numbers 5132-04 and 5132-04) or 4 reactions each when using the NEXTflex Small RNA Sequencing Kit* (catalog numbers 5132-01 and 5132-02). The shelf life of all reagents is 12 months when stored at -20 C. *If using the NEXTflex Small RNA Sequencing Kit (catalog numbers 5132-01 and 5132-02) please make sure to use manual version 14.07 or later. Please contact Bioo Scientific at the phone number or email address shown at the end of this document for the latest manual. Kit Contents Volume NEXTflex Barcode Primer 1-12 8 µl Warnings and Precautions Bioo Scientific strongly recommends that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, you may contact your local distributor or Bioo Scientific at nextgen@biooscientific.com. Do not use the kit past the expiration date. Try to maintain a laboratory temperature of 20 25 C (68 77 F). Vortex and micro centrifuge each tube prior to use, to ensure material has not lodged in the cap or the side of the tube. The NEXTflex Small RNA Barcode Primers are intended for laboratory use only. NEXTflex is a trademark of Bioo Scientific. Bioo Scientific makes no warranty of any kind, either expressed or implied, except that the materials from which its products are made are of standard quality. There is no warranty of merchantability of this product, or of the fitness of the product for any purpose. Bioo Scientific shall not be liable for any damages, including special or consequential damage, or expense arising directly or indirectly from the use of this product. BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 1
APPENDIX A APPENDIX A Possible Causes Recommended Action Oligonucleotide Sequences Poor RNA quality NEXTflex Small RNA Barcode Primers Set A - 513305 Check the RNA quality before beginning the protocol. NAME SEQUENCE (5 3 ) NEXTflex Barcode Primer CAAGCAGAAGACGGCATACGAGATXXXXXX 1 GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 1 XXXXXX denotes the index region of adapter. The index sequences and their respective reverse complements of each primer are listed below. NEXTflex Barcode Primer Barcode Sequence Reverse Complement* Barcode Primer 1 CGTGAT ATCACG Barcode Primer 2 ACATCG CGATGT Barcode Primer 3 GCCTAA TTAGGC Barcode Primer 4 TGGTCA TGACCA Barcode Primer 5 CACTGT ACAGTG Barcode Primer 6 ATTGGC GCCAAT Barcode Primer 7 GATCTG CAGATC Barcode Primer 8 TCAAGT ACTTGA Barcode Primer 9 CTGATC GATCAG Barcode Primer 10 AAGCTA TAGCTT Barcode Primer 11 GTAGCC GGCTAC Barcode Primer 12 TACAAG CTTGTA *The reverse complement is the sequence that is reported in the index read. BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 2
RELATED PRODUCTS RELATED PRODUCTS Illumina Compatible DNA NGS Kits and Adapters Product Catalog Number NEXTflex 16S V4 Amplicon-Seq kit 4 4201-01 NEXTflex 16S V4 Amplicon-Seq kit 12 4201-02 NEXTflex 16S V4 Amplicon-Seq kit 24 4201-03 NEXTflex 16S V4 Amplicon-Seq kit 48 4201-04 NEXTflex 16S V4 Amplicon-Seq kit 96 4201-05 NEXTflex 16S V4 Amplicon-Seq kit 288 4201-07 NEXTflex 16S V1-V3 Amplicon-Seq kit 4 4202-01 NEXTflex 16S V1-V3 Amplicon-Seq kit 12 4202-02 NEXTflex 16S V1-V3 Amplicon-Seq kit 48 4202-03 NEXTflex 16S V1-V3 Amplicon-Seq kit 96 4202-04 NEXTflex 16S V1-V3 Amplicon-Seq kit 192 4202-05 NEXTflex 16S V1-V3 Amplicon-Seq kit 384 4202-07 NEXTflex DNA Barcodes 6 514101 NEXTflex DNA Barcodes 12 514102 NEXTflex DNA Barcodes 24 514103 NEXTflex DNA Barcodes 48 514104 NEXTflex-96 DNA Barcodes 514106 NEXTflex DNA Sequencing Kit (8 reactions) 5140-01 NEXTflex DNA Sequencing Kit (48 reactions) 5140-02 NEXTflex Rapid DNA Sequencing Kit (8 reactions) 5144-01 NEXTflex Rapid DNA Sequencing Kit (48 reactions) 5144-02 NEXTflex Bisulfite-Seq kit (8 reactions) 5119-01 NEXTflex Bisulfite-Seq kit (48 reactions) 5119-02 NEXTflex Bisulfite-Seq Barcodes 6 511911 NEXTflex Bisulfite-Seq Barcodes 12 511912 NEXTflex Msp 1 (8 reactions) 511921 NEXTflex Msp 1 (48 reactions) 511922 NEXTflex ChIP-Seq Kit (8 reactions) 5143-01 NEXTflex ChIP-Seq Kit (48 reactions) 5143-02 NEXTflex ChIP-Seq Barcodes 6 514120 NEXTflex ChIP-Seq Barcodes 12 514121 NEXTflex ChIP-Seq Barcodes 24 514122 NEXTflex ChIP-Seq Barcodes 48 514123 NEXTflex-96 ChIP-Seq Barcodes 514124 NEXTflex PCR-Free DNA Sequencing Kit (8 reactions) 5142-01 NEXTflex PCR-Free DNA Sequencing Kit (48 reactions) 5142-02 NEXTflex PCR-Free Barcodes 6 514110 NEXTflex PCR-Free Barcodes 12 514111 NEXTflex PCR-Free Barcodes 24 514112 NEXTflex PCR-Free Barcodes 48 514113 NEXTflex Methyl-Seq 1 kit (8 reactions) 5118-01 BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 3
NEXTflex Methyl-Seq 1 kit (48 reactions) 5118-02 DNA Fragmentation Product Catalog Number AIR DNA Fragmentation Kit (10 reactions) 5135-01 AIR DNA Fragmentation Kit (40 reactions) 5135-02 BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 4
Illumina Compatible RNA NGS Kits and Adapters Product Catalog Number NEXTflex Poly(A) Beads (8 reactions) 512979 NEXTflex Poly(A) Beads (48 reactions) 512980 NEXTflex Poly(A) Beads (100 reactions) 512981 NEXTflex RNA-Seq Barcodes 6 512911 NEXTflex RNA-Seq Barcodes 12 512912 NEXTflex RNA-Seq Barcodes 24 512913 NEXTflex RNA-Seq Barcodes 48 512914 NEXTflex-96 RNA-Seq Barcodes 512916 NEXTflex RNA-Seq Kit (8 reactions) 5129-01 NEXTflex RNA-Seq Kit (48 reactions) 5129-02 NEXTflex Directional RNA-Seq Kit V2 (8 reactions) 5129-07 NEXTflex Directional RNA-Seq Kit V2 (48 reactions) 5129-08 NEXTflex Rapid RNA-Seq Kit (8 reactions) 5138-01 NEXTflex Rapid RNA-Seq Kit (48 reactions) 5138-02 NEXTflex Rapid Directional RNA-Seq Kit (8 reactions) 5138-07 NEXTflex Rapid Directional RNA-Seq Kit (48 reactions) 5138-08 NEXTflex qrna-seq Kit 4 barcodes (8 reactions) 5130-01 NEXTflex qrna-seq Kit 24 barcodes - Set A (48 reactions) 5130-02 NEXTflex qrna-seq Kit 24 barcodes - Set B (48 reactions) 5130-03 NEXTflex qrna-seq Kit 24 barcodes - Set C (48 reactions) 5130-04 NEXTflex qrna-seq Kit 24 barcodes - Set D (48 reactions) 5130-05 NEXTflex Rapid Directional qrna-seq Kit 4 barcodes (8 reactions) 5130-01D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set A (48 reactions) 5130-02D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set B (48 reactions) 5130-03D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set C (48 reactions) 5130-04D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set D (48 reactions) 5130-05D NEXTflex Small RNA Sequencing Kit (24 reactions) 5132-01 NEXTflex Small RNA Sequencing Kit (48 reactions) 5132-02 NEXTflex Small RNA Barcodes Set A 513305 NEXTflex Small RNA Barcodes Set B 513306 NEXTflex Small RNA Barcodes Set C 513307 NEXTflex Small RNA Barcodes Set D 513308 Bioo Scientific offers library prep kits and barcodes for the Ion Torrent, 5500 SOLiD and SOLiD 4 sequencing platforms. For more information about any of these kits visit our website at www.biooscientific.com. Bioo Scientific Corporation 7050 Burleson Road Austin, TX 78744 USA Tel: 1.888.208.2246 Fax: (512) 707-8122 Made in USA BIOO Research Products Group nextgen@biooscientific.com www.biooscientific.com BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 5