BIOO LIFE SCIENCE PRODUCTS



Similar documents
FOR REFERENCE PURPOSES

Introduction Bioo Scientific

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

TruSeq DNA Methylation Library Preparation Guide

ab Hi-Fi cdna Synthesis Kit

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #:

Genomic DNA Extraction Kit INSTRUCTION MANUAL

The RNAi Consortium (TRC) Broad Institute

CompleteⅡ 1st strand cdna Synthesis Kit

RealLine HCV PCR Qualitative - Uni-Format

How To Write An Ipa

PreciseTM Whitepaper

TaqMan Fast Advanced Master Mix. Protocol

Path-ID Multiplex One-Step RT-PCR Kit

Introduction to next-generation sequencing data

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

UltraClean Soil DNA Isolation Kit

Application Guide... 2

ZR DNA Sequencing Clean-up Kit

SEQUENCING. From Sample to Sequence-Ready

Reverse Transcription System

qpcr Quantification Protocol Guide

UltraClean Forensic DNA Isolation Kit (Single Prep Format)

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

RT-PCR: Two-Step Protocol

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

GenScript BloodReady TM Multiplex PCR System

Host OS Compatibility Guide

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

How To Get Rid Of Small Dna Fragments

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

Mercodia Diabetes Antigen Control Rat/Mouse (Low, Medium, High)

First Strand cdna Synthesis

Bioanalyzer Applications for

Next Generation Sequencing

One Shot TOP10 Competent Cells

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from μL of Plasma and Serum

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

AffinityScript QPCR cdna Synthesis Kit

Software Getting Started Guide

Taq98 Hot Start 2X Master Mix

mircute mirna qpcr Detection Kit (SYBR Green)

RevertAid Premium First Strand cdna Synthesis Kit

Data Analysis for Ion Torrent Sequencing

NimbleGen DNA Methylation Microarrays and Services

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

USER GUIDE. Encore PART NOS and SP Rapid Library Systems

PicoMaxx High Fidelity PCR System

UltraClean PCR Clean-Up Kit

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Instruction manual for product # PNAC Version 1.2

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

Stratagene QPCR Mouse Reference Total RNA

Mir-X mirna First-Strand Synthesis Kit User Manual

Automated Lab Management for Illumina SeqLab

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

How to Run the PacBio RS II Instrument. 1. Run Instrument. 1.1 How to Run the RS II Instrument

TruSeq Custom Amplicon v1.5

Troubleshooting Sequencing Data

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

Real-time quantitative RT -PCR (Taqman)

Concepts and methods in sequencing and genome assembly

Automated Library Preparation for Next-Generation Sequencing

empcr Amplification Method Manual - Lib-A

BacReady TM Multiplex PCR System

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

HBV Quantitative Real Time PCR Kit

Oligonucleotide Stability Study

DyNAmo cdna Synthesis Kit for qrt-pcr

Applied Biosystems 3500/3500xL Genetic Analyzer

Amplicon Template Preparation and Sequencing

TIANquick Mini Purification Kit

G E N OM I C S S E RV I C ES

PowerFecal DNA Isolation Kit

AxyPrep TM Mag PCR Clean-up Protocol

All-in-One First-Strand cdna Synthesis Kit

HiPer RT-PCR Teaching Kit

illustra MicroSpin G-25 Columns

INSTRUCTION Probemaker

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Table of Contents. I. Description II. Kit Components III. Storage IV. 1st Strand cdna Synthesis Reaction... 3

DNA Sequence Analysis

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

PCR Instruments and Consumables

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

LABORATORY ORDERING INFORMATION (valid June 2011)

Agilent High Sensitivity DNA Kit Guide

qstar mirna qpcr Detection System

FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS

LifeScope Genomic Analysis Software 2.5

Transcription:

BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit and protocol, so it is important to always use the protocol included with the kit. NEXTflex Small RNA Barcode Primers Set A (Illumina Compatible) Catalog #: 513305 (96 reactions) BIOO Scientific Corp. 2014 V14.07

TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents, Storage and Shelf Life... 1 Warnings and Precautions... 1 APPENDIX A... 2 Oligonucleotide Sequences... 2 RELATED PRODUCTS... 3 Illumina Compatible DNA NGS Kits and Adapters... 3 DNA Fragmentation... 4 Illumina Compatible RNA NGS Kits and Adapters... 5 The NEXTflex Small RNA Barcode Primers are intended for laboratory use only. NEXTflex is a trademark of Bioo Scientific.

GENERAL INFORMATION GENERAL INFORMATION Product Overview The NEXTflex Small RNA Barcode Primers are designed to prepare multiplexed small RNA libraries for sequencing using Illumina platforms. The index is designed within the NEXTflex barcode primers and incorporated during PCR. Pooling of samples may be performed either after PCR or after gel validation. Contents, Storage and Shelf Life The NEXTflex Small RNA Barcode Primers contain 12 barcoded primers with enough material for 8 reactions each when using the NEXTflex Small RNA Sequencing Kit v2 (catalog numbers 5132-04 and 5132-04) or 4 reactions each when using the NEXTflex Small RNA Sequencing Kit* (catalog numbers 5132-01 and 5132-02). The shelf life of all reagents is 12 months when stored at -20 C. *If using the NEXTflex Small RNA Sequencing Kit (catalog numbers 5132-01 and 5132-02) please make sure to use manual version 14.07 or later. Please contact Bioo Scientific at the phone number or email address shown at the end of this document for the latest manual. Kit Contents Volume NEXTflex Barcode Primer 1-12 8 µl Warnings and Precautions Bioo Scientific strongly recommends that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, you may contact your local distributor or Bioo Scientific at nextgen@biooscientific.com. Do not use the kit past the expiration date. Try to maintain a laboratory temperature of 20 25 C (68 77 F). Vortex and micro centrifuge each tube prior to use, to ensure material has not lodged in the cap or the side of the tube. The NEXTflex Small RNA Barcode Primers are intended for laboratory use only. NEXTflex is a trademark of Bioo Scientific. Bioo Scientific makes no warranty of any kind, either expressed or implied, except that the materials from which its products are made are of standard quality. There is no warranty of merchantability of this product, or of the fitness of the product for any purpose. Bioo Scientific shall not be liable for any damages, including special or consequential damage, or expense arising directly or indirectly from the use of this product. BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 1

APPENDIX A APPENDIX A Possible Causes Recommended Action Oligonucleotide Sequences Poor RNA quality NEXTflex Small RNA Barcode Primers Set A - 513305 Check the RNA quality before beginning the protocol. NAME SEQUENCE (5 3 ) NEXTflex Barcode Primer CAAGCAGAAGACGGCATACGAGATXXXXXX 1 GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 1 XXXXXX denotes the index region of adapter. The index sequences and their respective reverse complements of each primer are listed below. NEXTflex Barcode Primer Barcode Sequence Reverse Complement* Barcode Primer 1 CGTGAT ATCACG Barcode Primer 2 ACATCG CGATGT Barcode Primer 3 GCCTAA TTAGGC Barcode Primer 4 TGGTCA TGACCA Barcode Primer 5 CACTGT ACAGTG Barcode Primer 6 ATTGGC GCCAAT Barcode Primer 7 GATCTG CAGATC Barcode Primer 8 TCAAGT ACTTGA Barcode Primer 9 CTGATC GATCAG Barcode Primer 10 AAGCTA TAGCTT Barcode Primer 11 GTAGCC GGCTAC Barcode Primer 12 TACAAG CTTGTA *The reverse complement is the sequence that is reported in the index read. BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 2

RELATED PRODUCTS RELATED PRODUCTS Illumina Compatible DNA NGS Kits and Adapters Product Catalog Number NEXTflex 16S V4 Amplicon-Seq kit 4 4201-01 NEXTflex 16S V4 Amplicon-Seq kit 12 4201-02 NEXTflex 16S V4 Amplicon-Seq kit 24 4201-03 NEXTflex 16S V4 Amplicon-Seq kit 48 4201-04 NEXTflex 16S V4 Amplicon-Seq kit 96 4201-05 NEXTflex 16S V4 Amplicon-Seq kit 288 4201-07 NEXTflex 16S V1-V3 Amplicon-Seq kit 4 4202-01 NEXTflex 16S V1-V3 Amplicon-Seq kit 12 4202-02 NEXTflex 16S V1-V3 Amplicon-Seq kit 48 4202-03 NEXTflex 16S V1-V3 Amplicon-Seq kit 96 4202-04 NEXTflex 16S V1-V3 Amplicon-Seq kit 192 4202-05 NEXTflex 16S V1-V3 Amplicon-Seq kit 384 4202-07 NEXTflex DNA Barcodes 6 514101 NEXTflex DNA Barcodes 12 514102 NEXTflex DNA Barcodes 24 514103 NEXTflex DNA Barcodes 48 514104 NEXTflex-96 DNA Barcodes 514106 NEXTflex DNA Sequencing Kit (8 reactions) 5140-01 NEXTflex DNA Sequencing Kit (48 reactions) 5140-02 NEXTflex Rapid DNA Sequencing Kit (8 reactions) 5144-01 NEXTflex Rapid DNA Sequencing Kit (48 reactions) 5144-02 NEXTflex Bisulfite-Seq kit (8 reactions) 5119-01 NEXTflex Bisulfite-Seq kit (48 reactions) 5119-02 NEXTflex Bisulfite-Seq Barcodes 6 511911 NEXTflex Bisulfite-Seq Barcodes 12 511912 NEXTflex Msp 1 (8 reactions) 511921 NEXTflex Msp 1 (48 reactions) 511922 NEXTflex ChIP-Seq Kit (8 reactions) 5143-01 NEXTflex ChIP-Seq Kit (48 reactions) 5143-02 NEXTflex ChIP-Seq Barcodes 6 514120 NEXTflex ChIP-Seq Barcodes 12 514121 NEXTflex ChIP-Seq Barcodes 24 514122 NEXTflex ChIP-Seq Barcodes 48 514123 NEXTflex-96 ChIP-Seq Barcodes 514124 NEXTflex PCR-Free DNA Sequencing Kit (8 reactions) 5142-01 NEXTflex PCR-Free DNA Sequencing Kit (48 reactions) 5142-02 NEXTflex PCR-Free Barcodes 6 514110 NEXTflex PCR-Free Barcodes 12 514111 NEXTflex PCR-Free Barcodes 24 514112 NEXTflex PCR-Free Barcodes 48 514113 NEXTflex Methyl-Seq 1 kit (8 reactions) 5118-01 BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 3

NEXTflex Methyl-Seq 1 kit (48 reactions) 5118-02 DNA Fragmentation Product Catalog Number AIR DNA Fragmentation Kit (10 reactions) 5135-01 AIR DNA Fragmentation Kit (40 reactions) 5135-02 BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 4

Illumina Compatible RNA NGS Kits and Adapters Product Catalog Number NEXTflex Poly(A) Beads (8 reactions) 512979 NEXTflex Poly(A) Beads (48 reactions) 512980 NEXTflex Poly(A) Beads (100 reactions) 512981 NEXTflex RNA-Seq Barcodes 6 512911 NEXTflex RNA-Seq Barcodes 12 512912 NEXTflex RNA-Seq Barcodes 24 512913 NEXTflex RNA-Seq Barcodes 48 512914 NEXTflex-96 RNA-Seq Barcodes 512916 NEXTflex RNA-Seq Kit (8 reactions) 5129-01 NEXTflex RNA-Seq Kit (48 reactions) 5129-02 NEXTflex Directional RNA-Seq Kit V2 (8 reactions) 5129-07 NEXTflex Directional RNA-Seq Kit V2 (48 reactions) 5129-08 NEXTflex Rapid RNA-Seq Kit (8 reactions) 5138-01 NEXTflex Rapid RNA-Seq Kit (48 reactions) 5138-02 NEXTflex Rapid Directional RNA-Seq Kit (8 reactions) 5138-07 NEXTflex Rapid Directional RNA-Seq Kit (48 reactions) 5138-08 NEXTflex qrna-seq Kit 4 barcodes (8 reactions) 5130-01 NEXTflex qrna-seq Kit 24 barcodes - Set A (48 reactions) 5130-02 NEXTflex qrna-seq Kit 24 barcodes - Set B (48 reactions) 5130-03 NEXTflex qrna-seq Kit 24 barcodes - Set C (48 reactions) 5130-04 NEXTflex qrna-seq Kit 24 barcodes - Set D (48 reactions) 5130-05 NEXTflex Rapid Directional qrna-seq Kit 4 barcodes (8 reactions) 5130-01D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set A (48 reactions) 5130-02D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set B (48 reactions) 5130-03D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set C (48 reactions) 5130-04D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set D (48 reactions) 5130-05D NEXTflex Small RNA Sequencing Kit (24 reactions) 5132-01 NEXTflex Small RNA Sequencing Kit (48 reactions) 5132-02 NEXTflex Small RNA Barcodes Set A 513305 NEXTflex Small RNA Barcodes Set B 513306 NEXTflex Small RNA Barcodes Set C 513307 NEXTflex Small RNA Barcodes Set D 513308 Bioo Scientific offers library prep kits and barcodes for the Ion Torrent, 5500 SOLiD and SOLiD 4 sequencing platforms. For more information about any of these kits visit our website at www.biooscientific.com. Bioo Scientific Corporation 7050 Burleson Road Austin, TX 78744 USA Tel: 1.888.208.2246 Fax: (512) 707-8122 Made in USA BIOO Research Products Group nextgen@biooscientific.com www.biooscientific.com BIOO LIFE SCIENCE PRODUCTS WWW.BIOOSCIENTIFIC.COM 5